explain xkcd - User contributions [en]

983: Privacy

2021-02-13T14:57:17Z

162.158.158.225: /* Explanation */ fix grammar

{{comic
| number = 983
| date = November 28, 2011
| title = Privacy
| image = privacy.png
| titletext = Eventual headline: 'University Researchers Create Life in Lab! Darkness, Faulty Condoms Blamed.'
}}

==Explanation==
This comic is about [[Cueball]] and [[Megan]] attempting to find some privacy to "hook up", which is slang for engaging in sexual activity.

They start at a dormitory, which would offer some privacy{{Citation needed}}. Unfortunately, the door is locked. They go to another dorm, but it is occupied by someone playing a {{w|Massively multiplayer online role-playing game|MMORPG}} who is "in a {{w|Raid (gaming)|raid}}", which means that the gamer is teaming up with others to "raid" something, probably an enemy, and loot their items. This also pokes fun at the fact that some raids may take a very long time to execute, in this case apparently taking on the order of 24 hours. (This comic was published on a Monday morning.)

In the third frame, the two try to go to the library's rare book collection. Such a place would usually be deserted, making it usable for sexual activity. However, it is currently occupied by a visiting {{w|Nelson Mandela}}, who is on a tour of the school.

Moving on to more bizarre places, they next try an {{w|Particle accelerator|accelerator tunnel}}, another place that would be private. However, the particle accelerator is in use and the door is sealed tight. This would be a normal safety feature to protect researchers from being exposed to potentially dangerous ionizing radiation from the particle beam.

The couple then try a {{w|beaver lodge}}, which, despite being private, is too tiny to fit in, and the only entrance is underwater. What makes it more difficult to get in is that it is winter, and the ground is presumably frozen solid.

The last place they attempt to go to is {{w|hyperspace}}, a nickname for the alternate dimension that starships enter when traveling faster than the speed of light. The name is commonly used in ''{{w|Star Wars}}''. However, there is no proof that hyperspace exists in reality, as the current understanding of physics makes it impossible for it to exist.

The caption is a parody of other laws of physics, such as "brightness is inversely proportional to distance from the source".

The title text indicates that the two eventually found privacy for sex in a laboratory, but inadvertently got Megan pregnant. This is a parody of news articles discussing whether scientists can create synthetic life in a lab. This eventual headline appears in a few [[1037: Umwelt]] frames as "Scientists Create Life In Lab", with a similar secondary headline/caption as the punchline.

The comic [[658: Orbitals]] is similar.

==Transcript==
:Dorm:
:[Cueball and Megan holding hands in front of a door. Megan is attempting to turn the doorknob.]
:Locked

:Other Dorm:
:[Cueball and Megan holding hands inside another dorm room. The roommate is sitting at a computer wearing a headset.]
:Roommate: I'll be done Tuesday.
:Roommate in raid

:Library Rare Book Collection:
:[Cueball and Megan looking through a closed door. Inside Nelson Mandela and two university workers are talking amongst various items on display.]
:Occupied by tour for visiting Nelson Mandela

:Accelerator Tunnel:
:[Cueball and Megan in silhouette in front of an imposing-looking door. The door is marked "NO ENTRY" with a radioactive trefoil symbol, and has a passcode scanner beside it.]
:Sealed while beam is in operation

:Beaver Lodge:
:[Megan climbing on top of a dirt mound while Cueball stands on the ice beside it. A cross-section reveals a beaver inside the mound and a submerged entrance.]
:Frozen over for winter to keep out predators, only accessible via underwater entrance

:Hyperspace:
:[Megan reading a textbook in front of a table piled with five other textbooks. Cueball looks over Megan's shoulder.]
:Cueball: Are you ''sure''?
:Ruled out by current understanding of physics

:College Law #27:
:The availibility [sic] of private space is inversely proportional to the desirability of the hookup.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring real people]]
[[Category:Sex]]
[[Category:Video games]]
[[Category:Physics]]
[[Category:Multiple Cueballs]]

Talk:2375: Worst Ladder

2020-10-22T02:46:28Z

162.158.158.225:

Their ladder is obviously placed somewhere where they all have to walk under it to get into the boardroom. [[Special:Contributions/162.158.158.247|162.158.158.247]] 00:59, 22 October 2020 (UTC)

I find it extremely pleasing that within 20 minutes the XKCD itself in on the front page of Google results [[Special:Contributions/108.162.237.4|108.162.237.4]] 01:09, 22 October 2020 (UTC)

Google searches gonna be skyrocketing for "Worst Ladder". --01:24, 22 October 2020‎ (UTC) 198.41.238.108 (Please sign your comments)

Can someone create a category for "business"-related comics? There are quite a few (some related to Beret Guy's businesses, but others just general). [[Special:Contributions/172.69.33.37|172.69.33.37]] 01:31, 22 October 2020 (UTC)

Can someone confirm if this comic is related to Quibi's shutdown announcement? Because if it isn't, then it's one major coincidence. [[User:Aderon|Aderon]] ([[User talk:Aderon|talk]]) 01:50, 22 October 2020 (UTC)
:I'm not entirely sure of the parallels but I'd love them to be in the article--[[User:FrankHightower|FrankHightower]] ([[User talk:FrankHightower|talk]]) 02:07, 22 October 2020 (UTC)

I thought someone had added a practical screenshot of Google's "worst ladder" search, before realising it was one of the inline Google-powered ads, this one 'aptly' for a certain popular online auction site which illustrated various ladders apparently up for sale upon its platform.... [[Special:Contributions/141.101.107.82|141.101.107.82]] 01:55, 22 October 2020 (UTC)
:I tried doing it, but it says I'm not allowed--[[User:FrankHightower|FrankHightower]] ([[User talk:FrankHightower|talk]]) 02:07, 22 October 2020 (UTC)
:: I saw that link (yours?) too, and appreciated it. Now, being just an IP I'm fairly sure I'd not be allowed to upload media to the Explain wiki, but I know it's been possible for others. Like with created highlights of the XKCD Garden, IIRC. But maybe it isn't automatic to all usernames but time/authorisation-prompted, after a certain length of engagement. Maybe the answer lies in the Community Portal, or the question could be asked there if not. [[Special:Contributions/162.158.158.225|162.158.158.225]] 02:46, 22 October 2020 (UTC)

2372: Dialect Quiz

2020-10-16T20:52:02Z

162.158.158.225: /* Explanation */ space

{{comic
| number = 2372
| date = October 14, 2020
| title = Dialect Quiz
| image = dialect_quiz.png
| titletext = Do you make a distinction between shallots, scallops, and scallions? If you use all three words, do they all have different meanings, all the same, or are two the same and one different?
}}

==Explanation==
{{incomplete|Created by a LIGHTBULB EATER and Delaware Line painter. Poll results should be added into the Trivia section. Do NOT delete this tag too soon.}}

This comic is a parody of online quizzes that offer to compare the user's dialect of American English with others around the country. These quizzes generally contain questions about word usage, names for certain objects, and pronunciations that vary between different regions of the US. There are also quizzes about broader English dialects, but this comic focuses on commonly cited differences between American dialects.

The earliest quiz of this type to be widely disseminated online was the [http://dialect.redlog.net/ Harvard Dialect Survey], conducted in the early 2000s by Bert Vaux and Scott Golder. The survey created maps of the distribution of various word usage (such as pop/soda/Coke for a fizzy drink) and was a relatively early example of widely shared Internet "viral" content. In 2013, Josh Katz of the New York Times created [https://www.nytimes.com/interactive/2014/upshot/dialect-quiz-map.html a new version] based on the Harvard survey, which became the Times' [https://www.theatlantic.com/technology/archive/2014/01/-em-the-new-york-times-em-most-popular-story-of-2013-was-not-an-article/283167/ most popular content of 2013] and spread the idea to many more people. Many of the questions in this comic directly derive from entries in those surveys.

Randall's previous two comics have been about election predictions, leading up to the 2020 US General Presidential Election. A prominent predictor of the election results is Nate Silver, who runs the FiveThirtyEight website. [https://twitter.com/NateSilver538/status/1315348221565206530 @NateSilver538 posted his results] of taking the New York Times version of the survey on October 11, 2020... just three days before this comic was posted. [[2371: Election Screen Time]] specifically suggests that Randall may be spending too much time obsessing over new posts and content from the election predictors. It's coincidental, but likely, that Nate Silver's tweet inspired Randall's post: he was reminded of the 2013 feature from the Times.

{| border =1 width=100% cellpadding=5 class="wikitable"
! # !! Question !! Answers !! Explanation
|-
! 1
|How do you address a group of two or more people?
|style="width: 15%;"|
* A) You
* B) Y'all
* C) I have not been around two or more people for so long that I can't remember
| Reference to the first question of the Times quiz: "How would you address {{w|You#Informal_plural_forms|a group of two or more people}}?" (with options including "you all", "you guys", "y'all", etc.). Option C may reference the significant decrease in human interaction and social contact during the COVID-19 pandemic. Alternatively, it may suggest that some xkcd readers are particularly introverted.
|-
! 2
| How do you pronounce "Penelope"?
|
* A) Rhymes with "Antelope"
* B) Rhymes with "Develop"
| Both the options for this are wrong, making it the first of many quiz questions it is impossible to answer correctly.

Neither Option A's "PEN-e-lohp" /ˈpɛnɪˌloʊp/ and Option B's "pe-NELL-up" /pɪˈnɛləp/ are a typical pronunciation of this name (beyond mispronunciations). In English, the only correct way to pronounce this name is "pe-NELL-o-pee" /pəˈnɛləpi/, which is not listed. (Penelope is a proper name, but usually encountered in literature rather than as the name of a neighbor, and is therefore less subject to dialect shifts.)
|-
! 3
| What do you call the scientific field that studies the stars?
|
* A) Astrology
* B) Agronomy
* C) Cosmetology
| The actual answer is {{w|Astronomy}}, which is not listed. {{w|Astrology}} is the pseudo-scientific "study" of the influence of the stars and planets on our lives, including horoscopes (often confused with Astronomy due to its similar name), {{w|Agronomy}} ''is'' scientific but instead studies agriculture, and {{w|Cosmetology}} is the study of cosmetics and makeup (with a name close to {{w|Cosmology}}, a branch of Astronomy). The last may also be referring to the (occasionally makeup-heavy) faces of movie and television "stars".
|-
! 4
| How do you pronounce "genre"?
|
* A) Gone-ra
* B) Juh-neer
* C) Jen-er-uh
| Reference to a question found on some quizzes: "How do you pronounce ''genre''? ZHAHN-ruh, or JAHN-ruh?"

A majority of (American) English speakers pronounce "genre" as either "'''ZH'''AHN-ruh" /ˈʒɑnrə/ (beginning with the "zh" sound found in "trea'''s'''ure") or "'''J'''AHN-ruh" /ˈdʒɑnrə/ (beginning with the "j" sound in "justice"). Neither of these are listed, and none of the quiz's pronunciation options are common. However, they are close to other words: ''GONE-ra'' /ˈgɑnrə/ sounds like {{w|gonorrhea}} /ˌgɑnəˈriə/, ''juh-NEER'' /dʒəˈnɪər/ is the way the second and third syllables of ''engineer'' are are pronounced, and ''JEN-er-uh'' /ˈdʒɛnərə/ is a word (genera), the plural of {{w|genus}}.
|-
! 5
| You pronounce "Google" with a high-pitched yelp on the...
|
* A) First syllable
* B) Second syllable
| Reference to general questions regarding differences in pronunciation of words. "Google" is not generally pronounced with a high-pitched yelp on either syllable.{{Citation needed}} {{w|Yahoo!}}, on the other hand, has advertised its services with a [https://www.youtube.com/watch?v=Fm5FE0x9eY0 high-pitched yodeling jingle], with the high-pitched yelp on the second syllable (as opposed to {{w|Goofy}}'s [https://www.youtube.com/watch?v=H-70mtXw35c iconic holler], with the high yelp on the first syllable).
|-
! 6
| What do you call the thing on the wall at school that you drink water from?
|
* A) Gutter pipe
* B) Drainpipe
| Reference to a quiz question in the Harvard and Times quizzes, "What do you call the thing from which you might drink water in a school?" Answers included "drinking fountain", "water fountain", and "bubbler". However, the question in this comic implies that school children (or at least the quiz maker) drink out of {{w|Rain gutter|gutter pipes}} or drain pipes, which are used to collect rainwater and/or {{w|sewage|should absolutely not be drunk from.}}
|-
! 7
| How do you pronounce the name for a short silent video file?
|
* A) Animated give
* B) Animated gift
| Reference to the "{{w|Gif}}" pronunciation debate, with people split between pronouncing it "gif" (with the hard-G sound in "graphics") or "jif" (with the soft-G sound in "giraffe"). Both options presented in this quiz use the hard-G sound, but neither option uses the commonly-agreed on pronunciation for the ending of the word, “if”.

Both options refute the “jif” argument that a "g" followed by an "i" can result in a “j” sound, as in "giraffe" or the fluid-measuring "gill". Most people would agree that "give" and "gift" (and a fish's "gill", "girth", "girl", ...) clearly incline to the hard-G, and the aforementioned "genre" has the soft-G ''without'' the "i", thus proving nothing but the general mutability and variability of English pronunciation.

The most authoritative pronouncement is actually that of the original authors of the standard, who clarified they intended it to be said as if "jif". Maybe it is entirely appropriate that their product, which lacks any audio stream, was made known to most of its end-users without a sound-guide and left everyone to spontaneously derive their own 'logical' way of voicing its name.
|-
! 8
| What do you call the baseball-sized garden bugs that, when poked, glow brightly and emit a warbling scream?
|
* A) What?
* B) Lawn buddies
| There are many different varieties of common insects with distinctive traits and behaviors, some of which even have multiple names; the (as-of-yet undiscovered) "lawn buddies" combine three of these traits into one (rather peculiar) creature.
1. The Harvard and Times quizzes actually include the question: "What do you call the {{w|Armadillidiidae|small gray bug}} that curls up into a ball when it’s touched?" (options include "roly-poly," "pill-bug", "potato bug", "doodle bug", etc.).

It is also worth mentioning that "potato bug" itself can refer to three completely different kinds of insect; besides the aforementioned "{{w|Armadillidiidae|small gray bug}}," it can also refer to the {{w|Colorado potato beetle}} or to the {{w|Jerusalem cricket}}. A dialect quiz such as this one might ask the quiz-taker to identify what kind of insect they associate the term with.

2. The {{w|Firefly|Lampyridae}} family of insects do glow (although not exactly "brightly".) These insects emit their light spontaneously, as a mating signal, and not in response to external stimuli such as being poked. These are variously called "fireflies," "glowworms," or "lightning bugs;" a dialect quiz might reasonably ask the quiz-taker's preferred term.

3. {{w|cicada|Cicadas}} and {{w|Madagascar_hissing_cockroach|cockroaches}} can approach being "baseball-sized" and can make very loud noises indeed, although it would be a bit of a stretch to describe any of their associated sounds as a "warbling scream."
|-
! 9
| What do you call the misleading lines painted by disgruntled highway workers to trick cars into driving off the road?
|
* A) Prank lines
* B) Devil's Marks
* C) Fool-me lines
* D) Fauxguides
* E) Delaware lines
| Reference to the fact that some quiz questions ask about road features, such as "verge/berm/parking strip/curb strip" and "roundabout/traffic circle". However, these particular road lines, if they have ever been made, aren't common enough to warrant different names. The Delaware Line was a formation within the Continental Army. May also just be a dig at Delaware. Devil's Marks may be a takeoff of [https://www.urbandictionary.com/define.php?term=Devil%27s%20Strip Devil's Strip]

Misleading lines on the road were also mentioned in [[1958: Self-Driving Issues]].
|-
! 10
| What do you call the blue-green planet in the outer Solar System?
|
* A) Uranus
* B) Neptune
| This question references the two common pronunciations of Uranus: "YURR-ə-nəss" and "yoo-RAY-nəss" (which sounds like the phrase "{{tvtropes|UranusIsShowing|Your anus}}", a favorite joke of little kids). The original pronunciation is "oo-ra-noos", both u's pronounced the same way, but this is not a common pronunciation among the general public. It also references the fact that Uranus and Neptune are both blue-ish colored planets in the outer solar system and are often confused by people who don't know much about them. Uranus is closer to being the correct answer - it could plausibly be described as cyan, a color intermediate between blue and green - while Neptune is a deep, unambiguous blue.
|-
! 11
| What do you call this tool?
[[File:CloveHammer.png|150px]] (image of a claw hammer)
|
* A) Banger
* B) Nail axe
* C) Wood mage wand
* D) I'm familiar with this tool but have no specific word for it
* E) I have never seen it before
| The only name most people would ever call this tool is a "hammer".

The last two options reference options in many quiz questions along the lines of "I'm familiar with this but have no specific word for it" and "I am not familiar with this" (such as on the pill-bug/roly-poly question on the real quiz). These may appear as options to questions that ask about something that might not exist everywhere, or something which many may not have a word for (for example, some areas of the United States have a name for "sunshowers," while most don't). However, it's a bit absurd for these options to be present for this question (and this question alone), as virtually all users in an English dialect test would be expected to know what a hammer is. This also serves as a bit of reverse perspective on "When the only tool you have is a hammer ..."
|-
! 12
| What do you call a long sandwich with meats and lettuce and stuff?
|
* A) A long sandwich with meats and lettuce and stuff
* B) A longwich
* C) A salad hot dog
| Reference to a common dialect quiz question: "What do you call a {{w|Submarine sandwich|long sandwich}}?" with options typically including "sub", "hoagie", "hero", etc.

The hot dog answer could refer to the common online discussion: "Is a hot dog a sandwich?"
|-
! 13
| What do you call the scaly many-legged animal often found in attics?
|
* A) Lightbulb eater
* B) I have no special name for them
* C) I've never looked in my attic
| Another reference to the frequent appearance of quiz questions asking what users call various creepy crawlies.

{{w|Millipedes}} best fit the description. They have many legs, though rarely if ever a thousand of them, as their name (from the Latin word for "thousand feet") suggests. The hard rings that separate an individual's body into segments give the animal a scaly appearance. And of the thousands of species, only a few have common names, hence "no special name for them". The reference to "lightbulb eater" is obscure, but may refer to the tendency of millipedes to congregate in large numbers in dark crevices. Perhaps Randall found some in empty (no bulb) light fixtures in his attic.

Or maybe it is just the sort of spooky monster that lives in the dark and makes you afraid to check the attic (or basement).

Normally, questions about uncommon things would include an "I've never seen one" option, like option E in the hammer question. Instead, this question has "I've never looked in my attic" as an option, implying that these creatures are present in all attics, and anyone who doesn't know them is simply unaware of the monster dwelling in their own attic.
|-
! 14
| What do you say when someone around you sneezes?
|
* A) "What was that?"
* B) "Oh, wow."
* C) [Quietly] "Yikes."
| Reference to a question on some quizzes about which of several words/phrases you say in response to a sneeze, with usual answers including "bless you", "God bless you", and "{{w|Gesundheit}}" (from the German word for 'health').

This question may also be referencing the {{w|COVID-19 pandemic}} in answer C (and possibly answer B). Sneezing isn't a primary symptom of COVID-19, but most people are hyper-aware of possibly contracting the disease from the people around them so sneezes are treated with suspicion and it's seen as rude to sneeze openly.

It is also possible that a person who has been able to catch a sneeze-producing condition has also caught COVID-19 and, while the sneeze itself isn't ''caused'' by it, the air and various airway fluids so forcefully projected are a possible infective vector with that little extra frisson of concern, given the current situation.
|-
! Title Text
| colspan=2 | Do you make a distinction between shallots, scallops, and scallions? If you use all three words, do they all have different meanings, all the same, or are two the same and one different?
| Phrased similarly to questions like, on the Times quiz, "How do you pronounce the words Mary, merry, and marry?" Options included "all three are pronounced the same", "all three are pronounced differently," or all three combinations of two being the same and one different. Refers to the naming confusion around {{w|scallions}} and {{w|shallots}} - also known as 'eschalots' - but with the unrelated but similar-sounding {{w|scallops}} substituted in the middle.

'Shallots', 'scallions' and 'eschalots' are names used in different dialects, for various species and cultivars of onion used in cooking, either as a small bulb (especially [[wikipedia:shallot|Allium cepa var. Aggregatum]]) or as a green leaf (especially [[wikipedia:Allium_fistulosum|Allium fistulosum]]). In many dialects, the green leaf type is called a 'scallion' and the bulb a 'shallot'. In at least one dialect (NSW Australia) the green leaf type is called a 'shallot' and the bulb an 'eschalot'. This causes confusion in recipes posted online. The word 'shallot' is also pronounced with emphasis on either the first or second syllable, as refered to in question 5. Despite the answer options offered, there is no evidence of dialects which use all three terms, or where 'shallot' and 'scallion' are interchangeable.

{{w|Scallops}} are invertebrate marine animals similar to oysters and clams, frequently harvested for food. In some regions of the UK and Australia potato {{w|fritters}} are also called 'scallops'. The word 'scallop' itself can be pronounced either as /ˈskɒləp/ or /ˈskæləp/, and its spelling has varied over time in a similar way to that of 'shallot'. However, these are difficult to confuse with shallots or scallions.
|}

==Transcript==

[Box with title at the top]
:<big>Dialect Quiz</big>
[Smaller subtitle underneath]
:Compare answers with your friends!

[Quiz is divided into two columns. Answers to questions are indicated by a letter followed by a closed parentheses, such as A). These letters are greyed out]

[Column 1:]
 
How do you address a group of two or more people?
:A) You
:B) Y'all
:C) I have not been around two or more people for so long that I can't remember

How do you pronounce "Penelope"?
:A) Rhymes with "Antelope"
:B) Rhymes with "Develop"

What do you call the scientific field that studies the stars?
:A) Astrology
:B) Agronomy
:C) Cosmetology

How do you pronounce "genre"?
:A) Gone-ra
:B) Juh-neer
:C) Jen-er-uh

You pronounce "Google" with a high-pitched yelp on the...
:A) First syllable
:B) Second syllable

What do you call the thing on the wall at school that you drink water from?
:A) Gutter pipe
:B) Drainpipe

How do you pronounce the name for a short silent video file?
:A) Animated give
:B) Animated gift

What do you call the baseball-sized garden bugs that, when poked, glow brightly and emit a warbling scream?
:A) What?
:B) Lawn buddies

[Column 2:]
 
What do you call the misleading lines painted by disgruntled highway workers to trick cars into driving off the road?
:A) Prank lines
:B) Devil's Marks
:C) Fool-me lines
:D) Fauxguides
:E) Delaware lines

What do you call the blue-green planet in the outer Solar System?
:A) Uranus
:B) Neptune

What do you call this tool?
 
[Image of a claw hammer]
:A) Banger
:B) Nail axe
:C) Wood mage wand
:D) I'm familiar with this tool but have no specific word for it
:E) I have never seen it before

What do you call a long sandwich with meats and lettuce and stuff?
:A) A long sandwich with meats and lettuce and stuff
:B) A longwich
:C) A salad hot dog

What do you call the scaly many-legged animal often found in attics?
:A) Lightbulb eater
:B) I have no special name for them
:C) I've never looked in my attic

What do you say when someone around you sneezes?
:A) "What was that?"
:B) "Oh, wow."
:C) [Quietly] "Yikes."

==Trivia==

*The xkcd Twitter account posted a [https://twitter.com/xkcd/status/1316484953480323072 series of Twitter polls] asking the questions in this comic.
**How do you address a group of two or more people?
***You (31.2%)
***Y'all (33.5%)
***'''Can’t remember anymore (35.3%)'''
**How do you pronounce “Penelope”?
***'''Rhymes with “antelope” (58.6%)'''
***Rhymes with “develop” (41.4%)
**What do you call the scientific field that studies the stars?
***Astrology (34.5%)
***Agronomy (18.5%)
***'''Cosmetology (47%)'''
**How do you pronounce "genre"?
***Gone-ra (24.7%)
***Juh-neer (18.8%)
***'''Jen-er-uh (56.5%)'''
**Do you pronounce "Google" with a high-pitched yelp on the...
***'''First syllable (63.6%)'''
***Second syllable (36.4%)
**What do you call the thing on the wall at school that you drink water from?
***Gutter pipe (32.9%)
***'''Drainpipe (67.1%)'''
**How do you pronounce the name for a short silent video file?
***Animated give (29.6%)
***'''Animated gift (70.4%)'''
**What do you call the baseball-sized garden bugs that, when poked, glow brightly and emit a warbling scream?
***What? (48.6%)
***'''Lawn buddies (51.4%)'''
**What do you call the misleading lines painted by disgruntled highway workers to trick cars into driving off the road?
***Prank/fool-me lines (14.8%)
***Devil's marks (22%)
***Fauxguides (22.5%)
***'''Delaware lines (40.6%)'''
**What do you call the blue-green planet in the outer solar system?
***'''Uranus (51.7%)'''
***Neptune (48.3%)
**What do you call this tool? 🔨
***'''Banger (29.7%)'''
***Nail axe (22%)
***Wood mage wand (29.1%)
***Don't know/not familiar (19.2%)
**What do you call a long sandwich with meats and lettuce and stuff?
***'''That description verbatim (43.1%)'''
***A longwich (33.2%)
***A salad hot dog (23.7%)
**What do you call the scaly many-legged animal often found in attics?
***Lightbulb eater (29.5%)
***Don't have a name for it (19%)
***'''Never looked in my attic (51.5%)'''
**What do you say when someone around you sneezes?
***"What was that?" (8.6%)
***"Oh, wow." (17.1%)
***'''[quietly] "Yikes." (74.3%)'''
*Shallots, scallops, and scallions ran against each other in [[1529: Bracket]]

{{comic discussion}}

[[Category:Language]]
[[Category:COVID-19]]

2372: Dialect Quiz

2020-10-15T09:07:05Z

162.158.158.225: /* Explanation */ non-US speakers don't use the /AH/ sound

{{comic
| number = 2372
| date = October 14, 2020
| title = Dialect Quiz
| image = dialect_quiz.png
| titletext = Do you make a distinction between shallots, scallops, and scallions? If you use all three words, do they all have different meanings, all the same, or are two the same and one different?
}}

==Explanation==
{{incomplete|Created by a LIGHTBULB EATER. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}

This comic is a parody of online quizzes that offer to compare the user's dialect of American English with others around the country. These quizzes generally contain questions about word usage, names for certain objects, and pronunciations that vary between different regions of the US. There are also quizzes about broader English dialects, but this comic focuses on commonly cited differences between American dialects.

The earliest quiz of this type to be widely disseminated online was the [http://dialect.redlog.net/ Harvard Dialect Survey], conducted in the early 2000s by Bert Vaux and Scott Golder. The survey created maps of the distribution of various word usage (such as pop/soda/Coke for a fizzy drink) and was a relatively early example of widely shared Internet "viral" content. In 2013, Josh Katz of the New York Times created [https://www.nytimes.com/interactive/2014/upshot/dialect-quiz-map.html a new version] based on the Harvard survey, which became the Times' [https://www.theatlantic.com/technology/archive/2014/01/-em-the-new-york-times-em-most-popular-story-of-2013-was-not-an-article/283167/ most popular content of 2013] and spread the idea to many more people. Many of the questions in this comic directly derive from entries in those surveys.

Randall's previous two comics have been about election predictions, leading up to the 2020 US General Presidential Election. A prominent predictor of the election results is Nate Silver, who runs the FiveThirtyEight website. [https://twitter.com/NateSilver538/status/1315348221565206530 @NateSilver538 posted his results] of taking the New York Times version of the survey on October 11, 2020... just three days before this comic was posted. [[2371: Election Screen Time]] specifically suggests that Randall may be spending too much time obsessing over new posts and content from the election predictors. It's coincidental, but likely, that Nate Silver's tweet inspired Randall's post: he was reminded of the 2013 feature from the Times.

{| border =1 width=100% cellpadding=5 class="wikitable"
! # !! Question !! Answers !! Explanation
|-
! 1
| How do you address a group of two or more people?
|
* A) You
* B) Y'all
* C) I have not been around two or more people for so long that I can't remember
| Reference to the first question of the Times quiz: "How would you address {{w|You#Informal_plural_forms|a group of two or more people}}?" (with options including "you all", "you guys", "y'all", etc.). Option C references the significant decrease in human interaction and social contact during the COVID-19 pandemic.
|-
! 2
| How do you pronounce "Penelope"?
|
* A) Rhymes with "Antelope"
* B) Rhymes with "Develop"
| Both the options for this are wrong, making it the first of many quiz questions it is impossible to answer correctly.

Neither Option A's "PEN-e-lohp" and Option B's "pe-NELL-up" are a typical pronunciation of this name (beyond mispronunciations). In English, the only correct way to pronounce this name is "pe-NELL-o-pee," which is not listed.
|-
! 3
| What do you call the scientific field that studies the stars?
|
* A) Astrology
* B) Agronomy
* C) Cosmetology
| The actual answer is {{w|Astronomy}}, which is not listed. {{w|Astrology}} is the pseudo-scientific "study" of the influence of the stars and planets on our lives, including horoscopes (often confused with Astronomy due to its similar name), {{w|Agronomy}} ''is'' scientific but instead studies agriculture, and {{w|Cosmetology}} is the study of cosmetics and makeup (with a name close to {{w|Cosmology}}, a branch of Astronomy). The last may also be referring to the (occasionally heavily made-up) faces of movie and television "stars".
|-
! 4
| How do you pronounce "genre"?
|
* A) Gone-ra
* B) Juh-neer
* C) Jen-er-uh
| Reference to a question found on some quizzes: "How do you pronounce ''genre''? ZHAHN-ruh, or JAHN-ruh?"

A majority of (American) English speakers pronounce "genre" as either "'''ZH'''AHN-ruh" (beginning with the "zh" sound found in "trea'''s'''ure") or "'''J'''AHN-ruh" (beginning with the "j" sound in "justice"). Neither of these are listed, and none of the quiz's pronunciation options are common. However, they are close to other words: ''Gone-ra'' sounds like {{w|gonorrhea}}, ''Juh-neer'' is the way the second and third syllables of ''engineer'' are are pronounced, and ''Jen-er-uh'' is a word (genera), the plural of {{w|genus}}.
|-
! 5
| You pronounce "Google" with a high-pitched yelp on the...
|
* A) First syllable
* B) Second syllable
| Reference to general questions regarding differences in pronunciation of words. "Google" is not generally pronounced with a high-pitched yelp on either syllable.{{Citation needed}} Yahoo! [https://en.wikipedia.org/wiki/Yahoo!], however, had advertisements pronouncing it with high pitch sounds.{{Citation needed}}
|-
! 6
| What do you call the thing on the wall at school that you drink water from?
|
* A) Gutter pipe
* B) Drainpipe
| Reference to a quiz question in the Harvard and Times quizzes, "What do you call the thing from which you might drink water in a school?" Answers included "drinking fountain", "water fountain", and "bubbler". However, the question in this comic implies that school children (or at least the quiz maker) drink out of gutter pipes or drain pipes, which are used to collect rainwater and should not be drunk from.{{Citation needed}}
|-
! 7
| How do you pronounce the name for a short silent video file?
|
* A) Animated give
* B) Animated gift
| Reference to the "{{w|Gif}}" pronunciation debate, with people split between pronouncing it "gif" (with the hard G sound in "graphics") or "jif" (with the soft G sound in "giraffe"). However, both options presented in this quiz use the hard G sound.
|-
! 8
| What do you call the baseball-sized garden bugs that, when poked, glow brightly and emit a warbling scream?
|
* A) What?
* B) Lawn buddies
| Reference to a question in the Harvard and Times quizzes: "What do you call the {{w|Armadillidiidae|small gray bug}} that curls up into a ball when it’s touched?" (options include "roly-poly," "pill-bug", "potato bug", "doodle bug", etc.). However, there are no common "baseball-sized garden bugs".{{Citation needed}} May also be a reference to what "potato bug" means to people in the eastern part of the United States and {{w|Jerusalem cricket|what it means}} to people in the western part of the United States.
|-
! 9
| What do you call the misleading lines painted by disgruntled highway workers to trick cars into driving off the road?
|
* A) Prank lines
* B) Devil's Marks
* C) Fool-me lines
* D) Fauxguides
* E) Delaware lines
| Reference to the fact that some quiz questions ask about road features, such as "verge/berm/parking strip/curb strip" and "roundabout/traffic circle". However, these particular road lines, if they have ever been made, aren't common enough to warrant different names. The Delaware Line was a formation within the Continental Army. May also just be a dig at Delaware.

Misleading lines on the road were also mentioned in [[1958: Self-Driving Issues]].
|-
! 10
| What do you call the blue-green planet in the outer Solar System?
|
* A) Uranus
* B) Neptune
| This question references the two common pronunciations of Uranus: "YURR-ə-nəss" and "yoo-RAY-nəss" (which sounds like the phrase "{{tvtropes|UranusIsShowing|Your anus}}", a favorite joke of little kids). It also references the fact that Uranus and Neptune are both blue-ish colored planets in the outer solar system and are often confused by people who don't know much about them. Uranus is closer to being the correct answer - it could plausibly be described as cyan, a color intermediate between blue and green - while Neptune is a deep, unambiguous blue.
|-
! 11
| What do you call this tool?
[[File:CloveHammer.png|150px]] (image of a clove hammer)
|
* A) Banger
* B) Nail axe
* C) Wood mage wand
* D) I'm familiar with this tool but have no specific word for it
* E) I have never seen it before
| The only name most people would ever call this tool is a "hammer".

The last two options reference options in many quiz questions along the lines of "I'm familiar with this but have no specific word for it" and "I am not familiar with this" (such as on the pill-bug/roly-poly question on the real quiz). These may appear as options to questions that ask about something that might not exist everywhere, or something which many may not have a word for (for example, some areas of the United States have a name for "sunshowers," while most don't). However, it's a bit absurd for these options to be present for this question (and this question alone), as most users would be expected to know what a hammer is.
|-
! 12
| What do you call a long sandwich with meats and lettuce and stuff?
|
* A) A long sandwich with meats and lettuce and stuff
* B) A longwich
* C) A salad hot dog
| Reference to a common dialect quiz question: "What do you call a {{w|Submarine sandwich|long sandwich}}?" with options typically including "sub", "hoagie", "hero", etc.

The hot dog answer could refer to the common online discussion: "Is a hot dog a sandwich?"
|-
! 13
| What do you call the scaly many-legged animal often found in attics?
|
* A) Lightbulb eater
* B) I have no special name for them
* C) I've never looked in my attic
| Another reference to the frequent appearance of quiz questions asking what users call various creepy crawlies.

{{w|Millipedes}} best fit the description. They have many legs, though rarely if ever a thousand of them, as their name (from the Greek for "thousand feet") suggests. The hard rings that separate an individual's body into segments give the animal a scaly appearance. And of the thousands of species, only a few have common names, hence "no special name for them". The reference to "lightbulb eater" is obscure, but may refer to the tendency of millipedes to congregate in large numbers in dark crevices. Perhaps Randall found some in empty (no bulb) light fixtures in his attic.
|-
! 14
| What do you say when someone around you sneezes?
|
* A) "What was that?"
* B) "Oh, wow."
* C) [Quietly] "Yikes."
| Reference to a question on some quizzes about which of several words/phrases you say in response to a sneeze, with usual answers including "bless you", "God bless you", and "{{w|Gesundheit}}" (from the German word for 'health').

This question may also be referencing the {{w|COVID-19 pandemic}} in answer C (and possibly answer B). Sneezing isn't a primary symptom of COVID-19, but most people are hyper-aware of possibly contracting the disease from the people around them so sneezes are treated with suspicion and it's seen as rude to sneeze openly.

It is also possible that a person who has been able to catch a sneeze-producing condition has also caught COVID-19 and, while the sneeze itself isn't ''caused'' by it, the air and various airway fluids so forcefully projected are a possible infective vector with that little extra frisson of concern, given the current situation.
|-
! Title Text
| colspan=2 | Do you make a distinction between shallots, scallops, and scallions? If you use all three words, do they all have different meanings, all the same, or are two the same and one different?
| Phrased similarly to questions like, on the Times quiz, "How do you pronounce the words Mary, merry, and marry?" Options included "all three are pronounced the same", "all three are pronounced differently," or all three combinations of two being the same and one different.

{{w|Shallots}} and {{w|scallions}} are both types of onions (the former somewhat resembling garlic cloves, the latter being long green/white stalks also called spring onions). {{w|Scallops}} (either pronounced
''skollops'' or ''skallops'') are invertebrate marine animals similar to oysters and clams, frequently harvested for food (also what potato fritters are called in some regions of the UK and Australia). The three sound somewhat similar, but are quite different.
|}

==Transcript==

[Box with title at the top]
:<big>Dialect Quiz</big>
[Smaller subtitle underneath]
:Compare answers with your friends!

[Quiz is divided into two columns. Answers to questions are indicated by a letter followed by a closed parentheses, such as A). These letters are greyed out]

[Column 1:]
 
How do you address a group of two or more people?
:A) You
:B) Y'all
:C) I have not been around two or more people for so long that I can't remember

How do you pronounce "Penelope"?
:A) Rhymes with "Antelope"
:B) Rhymes with "Develop"

What do you call the scientific field that studies the stars?
:A) Astrology
:B) Agronomy
:C) Cosmetology

How do you pronounce "genre"?
:A) Gone-ra
:B) Juh-neer
:C) Jen-er-uh

You pronounce "Google" with a high-pitched yelp on the...
:A) First syllable
:B) Second syllable

What do you call the thing on the wall at school that you drink water from?
:A) Gutter pipe
:B) Drainpipe

How do you pronounce the name for a short silent video file?
:A) Animated give
:B) Animated gift

What do you call the baseball-sized garden bugs that, when poked, glow brightly and emit a warbling scream?
:A) What?
:B) Lawn buddies

[Column 2:]
 
What do you call the misleading lines painted by disgruntled highway workers to trick cars into driving off the road?
:A) Prank lines
:B) Devil's Marks
:C) Fool-me lines
:D) Fauxguides
:E) Delaware lines

What do you call the blue-green planet in the outer Solar System?
:A) Uranus
:B) Neptune

What do you call this tool?
 
[Image of a claw hammer]
:A) Banger
:B) Nail axe
:C) Wood mage wand
:D) I'm familiar with this tool but have no specific word for it
:E) I have never seen it before

What do you call a long sandwich with meats and lettuce and stuff?
:A) A long sandwich with meats and lettuce and stuff
:B) A longwich
:C) A salad hot dog

What do you call the scaly many-legged animal often found in attics?
:A) Lightbulb eater
:B) I have no special name for them
:C) I've never looked in my attic

What do you say when someone around you sneezes?
:A) "What was that?"
:B) "Oh, wow."
:C) [Quietly] "Yikes."

==Trivia==

*The xkcd Twitter account posted a [https://twitter.com/xkcd/status/1316484953480323072 series of Twitter polls] asking the questions in this comic.
*Shallots, scallops, and scallions ran against each other in [[1529: Bracket]]

{{comic discussion}}

[[Category:Language]]
[[Category:COVID-19]]

Talk:2372: Dialect Quiz

2020-10-15T00:51:21Z

162.158.158.225: ge-ne-ra means something else

Fun fact: shallots, scallops, and scallions ran against each other in [[1529: Bracket]]. (This will probably end up in the Trivia tab when one is created.) [[Special:Contributions/172.69.10.135|172.69.10.135]] 20:50, 14 October 2020 (UTC)

Cosmetology both sounds like "Cosmology" but it's also the fancy word for people who study cosmetics. --[[Special:Contributions/172.68.174.92|172.68.174.92]] 21:22, 14 October 2020 (UTC)

I mean the water fountains might as well be gutter pipes
21:49, 14 October 2020 (UTC)

@kswoll: Pretty sure this is a direct parody of the NYTimes quiz here: https://www.nytimes.com/interactive/2014/upshot/dialect-quiz-map.html

The Google pronunciation question might be a reference to a reference to [https://youtu.be/epj8OzP6z-M?t=177 a scene] from the second-to-last episode of Halt and Catch Fire. [[Special:Contributions/162.158.79.165|162.158.79.165]] 23:35, 14 October 2020 (UTC)

My guess is it is a reference to Yahoo another search engine that had commercials with high pitched yelp and some might put emphasis on either the "Ya" or the "hoo"

While I agree that most people know what a hammer is, this is not hammer - or rather, may not be considered "standard" hammer. Personally I would call it "Hammer with that thing for pulling nails out", but I could be easily convinced that it has some other name which doesn't include the word "hammer", instead of (presumably correct) {{w|claw hammer}}. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 23:55, 14 October 2020 (UTC)
* Yeah, I was thinking it was a claw hammer, also. I do have a friend that pronounces the word jen-er-uh, even though I have specifically said the word correctly around him after he has used it. [[User:SDSpivey|SDSpivey]] ([[User talk:SDSpivey|talk]]) 00:40, 15 October 2020 (UTC)
:: "genera" is a word. I typed it into Google, marvelled at the incomprehensible phonetic version, and tapped a speaker button. My computer said "Genera" and a box popped up that reads "Learn to pronounce", which I consider to be rude. But after all, I pressed the button. Robert Carnegie rja.carnegie@excite.com [[Special:Contributions/162.158.158.225|162.158.158.225]] 00:51, 15 October 2020 (UTC)

790: Control

2020-10-12T14:55:58Z

162.158.158.225: Mark Missing Citation

{{comic
| number = 790
| date = September 8, 2010
| title = Control
| image = control.png
| titletext = Which, at one point, led to a study showing that LSD produces no more hallucinations than a placebo.
}}

==Explanation==
In a product experiment, two groups of people are given a certain pill or lotion. Some people are given the product to be tested, while others (the control group) are given a placebo; nobody is told which group they belong to. The control group acts as a norm for comparison against the others.

Randall has messed with this process by giving LSD ({{w|lysergic acid diethylamide}}) to the control group. LSD is a drug that causes hallucinations and distortions in the perception of time and space. [[Megan]], apparently a control, is experiencing spiders in her hallucinations. Since the control group is supposed to reflect what "normally" happens, this is indeed very confusing to the scientists. While hallucinating in the comic Megan is drawn as if she has 8 limbs showing that she's waving her arms. Alternatively, although not especially likely, this could signify that she actually has grown four extra arms - which would be very confusing even if the scientists knew about the LSD.{{Citation needed}}

However, given the scientists are confused, this means that they must know which person is in which group. This implies that the trial isn't double-blinded, which in and of itself would impact the veracity of the study. In a properly double-blinded study, the scientists would not know Cueball or [[Megan]] was the control and would only dutifully record their observations. (Alternatively, this is simply an unexpected result for either group.)

The title text suggests that, in a different study, this substitution was performed when the product being tested was itself LSD. This led to the conclusion that LSD is no more likely to cause hallucinations than a placebo, somehow implying that LSD is not a hallucinogen. We can only hope they were able to redo the test, as in layman's terms "Nonsense MUST be wrong". If this were true, this would imply that Randall would only have needed to sneak placebo LSD into the studies to get the same effect.

==Transcript==
:[Caption above the frame:]
:My Hobby:

:[Cueball looks down at his arm calmly, while next to him Megan is violently flailing around in terror. In the foreground a Cueball-like guy stands next to Ponytail who is holding a clipboard. They look on in puzzlement.]
:Cueball: My rash seems to have shrunk by about 20% today.
:Megan: OH GOD SPIDERS
:Cueball-like guy: ? ?
:Ponytail: ?

:[Caption below the frame:]
:Sneaking into experiments and
:giving LSD to the control group.

{{comic discussion}}

[[Category:My Hobby]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Ponytail]]
[[Category:Multiple Cueballs]]
[[Category:Spiders]]
[[Category:Science]]

Talk:2369: All-in-One

2020-10-08T09:15:22Z

162.158.158.225: /* Accessibility adjustment */

Is the title text a reference the Librareome project in Rainbow's End (Vernor Vinge)?

See, e.g., [http://www.technovelgy.com/ct/content.asp?Bnum=1856]

--[[Special:Contributions/162.158.79.124|162.158.79.124]] 18:06, 7 October 2020 (UTC)

I wonder if Randall took inspiration from [this Dilbert](https://dilbert.com/strip/1994-04-25). [[User:Moosenonny10|Moosenonny10]] ([[User talk:Moosenonny10|talk]]) 18:52, 7 October 2020 (UTC)

I don't think "eat" and "corrugate" are intended as malfunctions. People sometimes eat paper -- it's a common trope in spy parodies where someone will eat a document to prevent someone from getting access to it. And corrugate just sounds like it's making corrugated cardboard from the input paper. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 19:22, 7 October 2020 (UTC)
:I changed it. What do you think? ''welp, i'' [[User:Donthaveusername|Donthaveusername]] ([[User talk:Donthaveusername|talk]]) 19:37, 7 October 2020 (UTC)

Seems like plagiarize would be somehow related to scan and copy.
: I imagine the internal sub-functions would be: Scan (or read from prepocessed page data from an original document 'sent to printer'), OCR (as necessary - implied in Translate but not mentioned as a function, despite being an actually popular 'one touch' function with appropriate desktop software involved), Comprehend (natural-language processing), De-Source (remove references that indicate the true source, including headers, watermarks, logos), Re-Arrange (optional shuffling/re-wording in places, maybe even synonyms), Re-Source (personalise back up again, for the plagiarist's benefit), then Print (if scan-for-copy/printed) or Save (if scan-for-storage, maybe even 'print'-to-storage via the device). [[Special:Contributions/141.101.98.52|141.101.98.52]] 00:21, 8 October 2020 (UTC)

shred and scan (or scanf) are also unix and C functions. Shred overwrites a file on disk, deleting it and preventing any subsequent recovery of the lost data. scan reads input according to a format string. Should one take a standard file and scan a string per the format '%s', the program will read in the variable until an end-of-line character is encountered. If the file were shredded first, resulting in a random set of bits, this end of line character might never be read. This seems to be more of a memory problem than a CPU problem, thus might not be the full explanation of the alt-text. --[[Special:Contributions/162.158.126.126|162.158.126.126]] 21:10, 7 October 2020 (UTC)

The incomplete template mentions that there might be a reason for Randall making this topic, but I don't think there is other than just making a funny joke. [[Special:Contributions/172.69.34.146|172.69.34.146]] 22:42, 7 October 2020 (UTC)

What, it can fold but not spindle or mutilate? :( [[Special:Contributions/162.158.75.114|162.158.75.114]] 23:14, 7 October 2020 (UTC)

Is staple removal a real printer feature? [[User:BunsenH|BunsenH]] ([[User talk:BunsenH|talk]]) 23:17, 7 October 2020 (UTC)
:Doubt it. [[Special:Contributions/172.68.132.243|172.68.132.243]] 23:39, 7 October 2020 (UTC)
::Staple-detection is (fairly) trivial, but consistently extracting them 'nicely' while preserving the paper as much as possible might be beyond a device (it's tricky enough for a person, sometimes). [[Special:Contributions/141.101.99.211|141.101.99.211]] 23:51, 7 October 2020 (UTC)
:::It's not beyond a staple remover. [[Special:Contributions/172.69.35.59|172.69.35.59]] 00:52, 8 October 2020 (UTC)
::::Even for a staple remover, it's sometimes not a trivial task, sometimes requiring some "intelligence". I don't think this feature is available in off-the-shelf tech. [[User:BunsenH|BunsenH]] ([[User talk:BunsenH|talk]]) 01:25, 8 October 2020 (UTC)

I'm disappointed there's no "jam for no particular reason in the most difficult place to access" option. [[Special:Contributions/108.162.216.184|108.162.216.184]] 23:18, 7 October 2020 (UTC)
: I thought there should be Paper Cranes in the right-hand column... But your suggestion is also an obvious omission. [[Special:Contributions/141.101.99.211|141.101.99.211]] 23:51, 7 October 2020 (UTC)

Regarding the "possibility that this printer is a complex computer": most printers are. Any printer which can process postscript OR is connected to network obviously contains computer more powerful than first {{w|IBM Personal Computer|IBM PCs}}, not speaking about the computer used in {{w|Apollo Guidance Computer|Apollo}}. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 00:35, 8 October 2020 (UTC)
:Well, it's ''more'' complex now. [[Special:Contributions/172.69.35.59|172.69.35.59]] 00:53, 8 October 2020 (UTC)

== Multi-function machines in pairs ==

I used to work for a temporary services company. At a tech-company, I noticed several instances where there were two multi-function machines close to each other. I asked about that. I was told company security policy forbade having a copier connected to a communications line. So, one machine was used only for copying. The other machine was used as a fax machine. The security police came about because, in the past, some people trying to copy company confidential pages sometimes mistakenly faxed them. [[Special:Contributions/162.158.75.194|162.158.75.194]] 01:00, 8 October 2020 (UTC)

== Accessibility adjustment ==

I added "(selected)" to all items that are highlighted in green, for the benefit of readers who can't see the green highlight. While one may argue that such readers could refer to the transcript, which has the text "(lit green)," there is no reason to force readers to scroll back and forth between the explanation and transcript sections to discover this, and it would be onerous for those using a screen reader to listen to the page multiple times. [[User:Thisisnotatest|Thisisnotatest]] ([[User talk:Thisisnotatest|talk]]) 08:29, 8 October 2020 (UTC)
:I like that. It was neither green nor annotated when I was last here and I think both elements are nice touches, I'd like you and the greening editor to each know. (I changed "lighted" to "lit" in the transcript version, and it seems nobody has reverted that yet, which was always possible. I'd considered "illuminated", but "selected" is a good one if there remain any future objections.) [[Special:Contributions/162.158.158.225|162.158.158.225]] 09:15, 8 October 2020 (UTC)

Talk:2365: Messaging Systems

2020-09-29T11:29:43Z

162.158.158.225: tweak to clarify subject

I guess ordinary email should be in the same section as SMS as well. [[Special:Contributions/162.158.158.171|162.158.158.171]] 00:20, 29 September 2020 (UTC)

The comic should mention MMS, which is well integrated into SMS, so that it's supported by not quite as much as SMS but still by almost everybody, and counts as vaguely modern in that you can attach images and have no length limit. ―[[User:TobyBartels|TobyBartels]] ([[User talk:TobyBartels|talk]]) 00:46, 29 September 2020 (UTC)

My DynaTAC doesn't get SMS. --[[Special:Contributions/172.69.22.150|172.69.22.150]] 00:56, 29 September 2020 (UTC)

Okay, got a basic explanation up; The comic is missing a bunch of different messaging services I feel. Also, I knew that somebody would say that their phone doesn't support SMS, I guess that habit of hedging writing with mostly is paying off.
[[Special:Contributions/172.69.63.143|172.69.63.143]] 01:01, 29 September 2020 (UTC)

"It [Whatsapp] is popular in multiple countries, namely Latin America and India." I have no idea what this means: should "namely" be "mainly"? But is the fixed version even true? [[Special:Contributions/162.158.158.225|162.158.158.225]] 11:28, 29 September 2020 (UTC)

Talk:2365: Messaging Systems

2020-09-29T11:28:53Z

162.158.158.225: re mangled sentence

I guess ordinary email should be in the same section as SMS as well. [[Special:Contributions/162.158.158.171|162.158.158.171]] 00:20, 29 September 2020 (UTC)

The comic should mention MMS, which is well integrated into SMS, so that it's supported by not quite as much as SMS but still by almost everybody, and counts as vaguely modern in that you can attach images and have no length limit. ―[[User:TobyBartels|TobyBartels]] ([[User talk:TobyBartels|talk]]) 00:46, 29 September 2020 (UTC)

My DynaTAC doesn't get SMS. --[[Special:Contributions/172.69.22.150|172.69.22.150]] 00:56, 29 September 2020 (UTC)

Okay, got a basic explanation up; The comic is missing a bunch of different messaging services I feel. Also, I knew that somebody would say that their phone doesn't support SMS, I guess that habit of hedging writing with mostly is paying off.
[[Special:Contributions/172.69.63.143|172.69.63.143]] 01:01, 29 September 2020 (UTC)

"It is popular in multiple countries, namely Latin America and India." I have no idea what this means: should "namely" be "mainly"? But is the fixed version even true? [[Special:Contributions/162.158.158.225|162.158.158.225]] 11:28, 29 September 2020 (UTC)

Talk:2303: Error Types

2020-05-08T01:26:00Z

162.158.158.225: I agree that this comic could have appeared any time without COVID-19 involved. Robert Carnegie

As of the time of this post, the title text is "Type IIII error: Mistaking tally marks for Roman neumerals". Is "neumerals" a typo, or is there a joke in there that I'm missing? [[User:Cosmogoblin|Cosmogoblin]] ([[User talk:Cosmogoblin|talk]]) 22:52, 6 May 2020 (UTC)
:Looks like a typo to me. Randall's patrons should have caught this for him!
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 23:07, 6 May 2020 (UTC)

::That particular mistake is actually just called a type error.
::[[Special:Contributions/162.158.62.221|162.158.62.221]] 23:12, 6 May 2020 (UTC)
:::Or, surely, a Type-0. [[Special:Contributions/162.158.159.82|162.158.159.82]] 01:09, 7 May 2020 (UTC)
::::I am Type-O and as a Type-O Negative, I'm VERY popular at the blood bank! (Universal Donor) [[Special:Contributions/108.162.216.48|108.162.216.48]] 01:25, 7 May 2020 (UTC)
::::: Actually, that's an over-simplification. Type-O-neg is only universal for whole blood donations, and only truly universal for whole blood if you are also CMV-negative. For plasma donations, Type-AB (both -pos and -neg) are universal donors. For platelets, only Type-AB-pos is universal donor. [[Special:Contributions/162.158.74.81|162.158.74.81]] 16:11, 7 May 2020 (UTC)
::I was hoping it could be bent to be a tribute to John von Neumann. [[Special:Contributions/172.68.189.223|172.68.189.223]] 05:00, 7 May 2020 (UTC)
::Looks like same type of typo he made at word "blag": [[https://explainxkcd.com/148/ Intentional.]] [[Special:Contributions/172.69.54.189|172.69.54.189]] 08:04, 7 May 2020 (UTC)
:: Perhaps a reference to {{w|Neume|Neumes}}? [[Special:Contributions/162.158.158.211|162.158.158.211]] 09:47, 7 May 2020 (UTC)

[[Special:Contributions/108.162.216.48|108.162.216.48]] 01:24, 7 May 2020 (UTC)
The explanation builds on definitions of terms in statistics. That's fine, but there are also non-statistical usages, just for example whether someone has now (or had before) the COVID-19 virus. A false positive is a test result which incorrectly indicates that a particular condition or attribute is present, and a false negative is a test result which incorrectly indicates that a particular condition or attribute is absent. A particular test is useful when its incidence of Type I and II errors is low. Types III and IV in that context would be given by poorly designed tests which, even if they give correct results, do it for unsupportable reasons and are therefore unreliable for future results. Types V, VI, VII, and VIII are necessary fillers in the sequence, once you decide that calling The Rise of Skywalker a mistake has to be error type IX simply because it's the ninth film in the series. [[User:JohnB|JohnB]] ([[User talk:JohnB|talk]]) 00:54, 7 May 2020 (UTC)

I could convince myself that the errors are a reference to each Star Wars movie. Definitely a stretch but I'd believe it. [[Special:Contributions/162.158.106.24|162.158.106.24]] 02:00, 7 May 2020 (UTC)

Surely an Error of the Third Kind is when an Alien gets lost and lands on Earth. [[User:Arachrah|Arachrah]] ([[User talk:Arachrah|talk]]) 11:28, 7 May 2020 (UTC)

Can we please stop categorizing every comic about scientific research and methods as COVID-19 related? This is getting quite silly.[[Special:Contributions/162.158.187.201|162.158.187.201]] 14:31, 7 May 2020 (UTC)
:While some members of the public this year are hearing about false positive and false negative for the first time in connection with SARS-COV2 and swab testing, usually in some counterfactual argument that getting tested now increases the probability that you got infected last week or something - I don't see that coronavirus needs to be mentioned in an explanation of the comic, given that it's xkcd and science happens here all the time. If this script ran in Arlo & Janis then a justification like that would be required... although today (May 7th) they're discussing Pavlov's dogs... is there a web page that explains Arlo & Janis? Robert Carnegie rja.carnegie@gmail.com [[Special:Contributions/162.158.158.225|162.158.158.225]] 01:26, 8 May 2020 (UTC)

I spent some time musing about whether the Skywalker saga could be taken as an exemplar of each of the types (e.g. the hypothesis for #1 is that Anakin Skywalker could bring balance to the Force, and the experiment was assigning him a tutor), but it's a stretch. I do like the idea that #9 is the epitome of errordom.16:07, 7 May 2020 (UTC)
:I suspect that people who like Episode IX would disagree, but I haven't found evidence that they even exist, so I can't say for sure. [[User:GreatWyrmGold|GreatWyrmGold]] ([[User talk:GreatWyrmGold|talk]]) 22:02, 7 May 2020 (UTC)

I'm not sure where this would fit in, but a correct answer that is viewed by the experimenter as being incorrect because of a misunderstanding, so that he changes the recording of the measurement, resulting in an incorrect measurement that he view as correct. This happened in a college classroom exercise involving Reynolds numbers. Above a certain value of Reynold's number, laminar flow will change to turbulent flow. However, that number is not where the change occurs but where laminar flow becomes unstable. One student changed all the measurements to indicate that the flow changed to turbulent almost immediately. I wondered what could have sped up the transition, thinking of things like loud noises and vibrations affecting the apparatus. The student immediately and loudly yelled that he "hadn't changed the numbers", with the vehemence indicating that he had actually changed the numbers. One problem with analog meters was that some people staring at the meters actually thought that the needle moved when it actually hadn't. Digital meters with automatic logging tended to get rid of this problem. 17:17, 7 May 2020 (UTC)
: Everyone knows that of all the Reynolds numbers, only two actually matter. Burt and Debbie. (You're gonna say Ryan as well, I suppose...) [[Special:Contributions/162.158.159.82|162.158.159.82]] 00:12, 8 May 2020 (UTC)

2300: Everyone's an Epidemiologist

2020-05-01T23:55:29Z

162.158.158.225: /* Trivia */ Or some similar conclusion.

{{comic
| number = 2300
| date = April 30, 2020
| title = Everyone's an Epidemiologist
| image = everyones_an_epidemiologist.png
| titletext = If enough people uphill decide to try the rolling strategy, they can make the decision for you.
}}

==Explanation==
{{incomplete|Created by a ROLLING HUMAN AVALANCHE. Explanation is not made yet. Do NOT delete this tag too soon.}}
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.

[[Megan]] complains that the sudden rise in awareness of COVID-19 has led to many people that act as if they are {{w|epidemiologist}}s; i.e. experts on the issue of global policy and the virus's traits, while in fact most are just repeating what they have heard from various news outlets, which [https://thebulletin.org/2020/03/coronavirus-coverage-where-the-media-have-gone-wrong/ do not always get everything right]. She compares the situation to people who are suddenly expert on mountain climbing safety every time a mountaineering disaster hits the news.

[[Cueball]] notes that her analogy fails to account that everyone is directly affected by the virus, meaning that everyone should be educating themselves on the topic as much as possible. Just like if everyone was stranded in mountains all at once, lots of people would try to become experts as fast as possible.

Megan acknowledges this fact. But then she continues to use the mountaineer analogy to the virus, saying that she would still wish those that now think they are experts would not go out on TV saying they found out that everyone would come down fast if they just curl up in to balls and roll down. Because their "research on gravity" says they will get to the bottom quickly.

Cueball however agrees with her that the people who may be saying such things are not helping.

In corona pandemic terms, this is probably a reference to those that claim we need to get out of lockdown as fast as possible, to save the economy (the closure of which has its own costs, potentially including losses of life through e.g. depression, homelessness, displacement, and so on), and maybe to induce {{w|herd immunity}} (SARS-CoV-2 does not mutate as rapidly as e.g. the influenza family of viruses, so it is hoped that individuals who are infected and survive will develop long-term immunity, and that a single vaccine will be very broadly effective, but this is still not known for certain as of this writing). But those are not considering all the lives at stake, which is what frustrates Megan. Who should decide that those with weak immune systems should be placed in such grave risk, for the better of the economy? Maybe not the every-man who has read something on the internet... which could be wrong, see [[386: Duty Calls]].

The title text explains how the decision may not even be yours; if those who were in more precarious positions above you now start to hit you on the way down and cause you to tumble as well, you will also end up as one of those rolling downhill. And in pandemic terms - if enough people ignore the precautions, then it will be much harder for the rest to avoid getting the disease, which will cause more deaths.

The rolling-down-hill strategy is reminiscent of [[1217: Cells]] in that it solves the immediate problem (whether being stuck on a mountain, or having some disease) while also likely killing the patient. It may therefore be in reference to Trump's [https://www.theguardian.com/world/2020/apr/23/trump-coronavirus-treatment-disinfectant widely reported comments] that an injection of a disinfectant could cure coronavirus; such an injection would "kill" (inactivate) any virus particles it contacted, but it would also kill so many of the patient's cells as to risk the patient's life.

The {{w|Cooper's Hill Cheese-Rolling and Wake}} is an annual event in which people intentionally roll down a steep hill (chasing after a wheel of cheese, or a foam replica since 2013), and they do indeed reach the bottom very quickly (the cheese was known to reach speeds in excess of 70 mph) and are often injured enough to require hospitalization, although because all participants are volunteers in good health, there have been no fatalities. The May 2020 event has been canceled due to COVID-19.

Alternately, it may be a reference to the "just succumb to the problem" solution of ignoring the dangers involved in letting what happens happen. Just quickly get everyone into the valley bottom and they all (who survive) subsequently have a {{w|herd immunity}} where none of them now needs to be scared of falling any more, and can jostle against anyone else without any such issues.

==Transcript==
:[Megan and Cueball are walking with makeshift medical masks covering their lower faces. Megan has thrown her arms in the air, and a star burst at her forehead where her speech line emanates, indicate she is agitated.]
:Megan: Ugh, everyone's an epidemiologist.
:Megan: It's like when there's a mountaineering disaster in the news, and suddenly everyone is an expert on mountain climbing safety.

:[In a frame-less panel they walk on together.]
:Cueball: I mean, it's not '''''exactly''''' like that.
:Cueball: If the entire world's population were suddenly stranded on mountaintops together, a lot of people would understandably be trying to become mountaineering experts really fast.
:Megan: Okay, that's fair.

:[Megan stops and lift both hands palm up while Cueball walks past her.]
:Megan: But I do wish they wouldn't keep going on TV and saying "According to my research on gravity, if everyone curls into a ball and rolls, we'll get to the bottom quickly!"
:Cueball: Yes, that's definitely not helping.

==Trivia==
*This is a rare Thursday comic, published on Thursday, April 30.
**It is unclear whether [[Randall]] forgot to release this on the regular Monday, Wednesday, Friday schedule or if there were other reasons for the delay.
**A Friday comic was released normally, within 24 hours, thus it is likely just a problem with the release or problem with getting it finished on time.

{{comic discussion}}

[[Category:COVID-19]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Cueball]]

2298: Coronavirus Genome

2020-04-25T17:27:17Z

162.158.158.225: /* Explanation */

{{comic
| number = 2298
| date = April 24, 2020
| title = Coronavirus Genome
| image = coronavirus_genome.png
| titletext = Spellcheck has been great, but whoever figures out how to get grammar check to work is guaranteed a Nobel.
}}

==Explanation==
{{incomplete|Created by a NOBEL IN SPELLCHECKING. Do NOT delete this tag too soon.}}
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.

[[Megan]] is a {{w|Genetics|geneticist}} doing research on the SARS-CoV-2 virus. She is analyzing the virus's {{w|genome}}, its genetic material composed of {{w|RNA}}. The genomic sequence can be represented as a list of {{w|nucleotide}} bases ({{w|guanine}}, {{w|adenine}}, {{w|cytosine}}, {{w|thymine}} and {{w|uracil}} - often abbreviated as G, A, C, T, and U).

The nucleotide sequence displayed is a 100% match to six SARS-CoV-2 sequences in public databases, all of them originating from the East Coast of the United States. The sequence is from nucleotides 26202-26280 of the virus genome and overlaps an unknown open reading frame/gene named ORF3a. One of the matching sequences is [https://www.ebi.ac.uk/ena/data/view/MT344963]. However, SARS-CoV-2 is an RNA-virus, and so its genetic material (not containing any DNA) would not include thymine (T) but would use uracil (U) instead. The sequence has been altered to resemble the more familiar codes of DNA.

[[Cueball]] is surprised that Megan and her colleagues actually use {{w|Microsoft Notepad}}, a simple {{w|text editor}}, to look at the genome, instead of more modern technology. She explains that better research institutions use {{w|Microsoft Word}}, a more advanced editor, to allow additional formatting (such as '''bolding''' and ''italics''), and humorously calls this "{{w|epigenetics}}". In the real world, epigenetics is the study of changes that are not caused by changes in nucleotides, but by other chemical modifications to DNA and chromosomes that cause changes in patterns of gene expression and activation, often many generations down. This might be considered analogous to altering the meaning of a text by changing its formatting rather than the content; for example, content can be moved into parentheses or footnotes to be de-emphasized, or rendered in boldface or enlarged to attract attention and emphasize key points. Much as text can be wrapped in HTML tags or similar markup to change its formatting, nucleotides can be {{w|DNA methylation|methylated}} to prevent transcription, and the {{w|histone}}s around which DNA is wound can also be modified to promote or repress gene expression.

The real punchline comes when Megan uses {{w|Spell checker|spellcheck}} to detect mutations in the genome by adding the previous genome to spellcheck and comparing them. Overall, Megan uses ridiculously and humorously crude methods to analyze a major genetic item. The genome of SARS-CoV-2 is almost 30,000 base-pairs long, which exceeds the {{w|longest words}} of any natural language by two orders of magnitude, and may exceed the capabilities of any available spell-checking program. Furthermore, a spellcheck program underlines the whole word if a single letter is wrong and not just the letter itself. Thus, it would not be able to highlight individual mutated base pairs.

The title text mentions {{w|Grammar checker|grammar checking}} and claims that whoever discovers how to use that to compare genomic material should be awarded a {{w|Nobel Prize}}. Spell-checking is analogous to comparing sequences to see their differences and similarities, an activity which is the bread and butter of bioinformatics nowadays. Grammar checking would be analogous to being able to understand the chemical and biological function of a sequence straight from its nucleotides, something we are unable to do at the moment except in very limited ways and only in a few simple cases.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.]
:Cueball (off-screen): So that's the coronavirus genome, huh?
:Megan: It is!
:Laptop: TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA

:[Cueball walks up and stands behind Megan, still working on the laptop.]
:Cueball: It's weird that you can just look at it in a text editor.
:Megan: It's essential!
:Megan: We geneticists do most of our work in Notepad.

:[A frameless panel, Cueball still standing behind Megan.]
:Cueball: Notepad?
:Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic.
:Cueball: Ah, okay.
:Megan: That extra formatting is called "epigenetics".

:[A regular panel, Cueball still stands behind Megan. He has his hand on his chin.]
:Cueball: Hey, why does that one have a red underline?
:Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations.
:Cueball: ''Clever!''

{{comic discussion}}
[[Category: Comics featuring Cueball]]
[[Category: Comics featuring Megan]]
[[Category: Biology]]
[[Category:COVID-19]]

Talk:2289: Scenario 4

2020-04-04T23:54:22Z

162.158.158.225:

Should definitely make a note re: this officially-Friday comic releasing late Saturday afternoon (EDT). [[User:TPS|TPS]] ([[User talk:TPS|talk]]) 22:06, 4 April 2020 (UTC)
Or is this actually the april fool comic, except it fooled us by being on a Saturday? [[Special:Contributions/162.158.74.81|162.158.74.81]] 22:12, 4 April 2020 (UTC) Sam
Perhaps more likely because the actual April Fool's comic (due Wednesday) delayed 'til Friday. [[User:TPS|TPS]] ([[User talk:TPS|talk]]) 22:19, 4 April 2020 (UTC)

The title should probably be changed, the xkcd site uses the numeral "4" whereas we're using the word "four."--[[User:GoldNinja|GoldNinja]] ([[User talk:GoldNinja|talk]]) 22:50, 4 April 2020 (UTC)
I accidentaly originally put it under Sequence Four. It shows in the image name.

Another instance of a graph with poor labels ("bad stuff"), even without the time travel. [[Special:Contributions/162.158.158.225|162.158.158.225]] 23:54, 4 April 2020 (UTC)