<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=162.158.158.235</id>
		<title>explain xkcd - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=162.158.158.235"/>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php/Special:Contributions/162.158.158.235"/>
		<updated>2026-04-16T23:23:18Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.30.0</generator>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2968:_University_Age&amp;diff=348214</id>
		<title>2968: University Age</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2968:_University_Age&amp;diff=348214"/>
				<updated>2024-08-06T22:00:54Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.158.235: /* Explanation */  Fix typos and stuff&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2968&lt;br /&gt;
| date      = August 5, 2024&lt;br /&gt;
| title     = University Age&lt;br /&gt;
| image     = university_age_2x.png&lt;br /&gt;
| imagesize = 317x388px&lt;br /&gt;
| noexpand  = true&lt;br /&gt;
| titletext = This only makes it more urgent that we adopt my roadmap for the next 10 years, which should put us solidly in the lead.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by the HR HEAD OF THE OLDEST UNIVERSITY DESTRUCTION DEPARTMENT - Please change this comment when editing this page. Do delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
[[Cueball]] has been the leader of a university for the last five years. In a speech, he declares that his goal during those five years has been to make his university overtake the age of the oldest university in his state, which was then two years older than his own (215 years vs 213 years old). He declares that he has funded an intensive program to make his university five years older, making it three years older than the other university was when he took the role. Due to the laws of time, this would have happened anyway, whatever he had done, or if he'd done nothing at all (barring his leadership being so catastrophic that the university ceased operating).&lt;br /&gt;
&lt;br /&gt;
The final line of Cueball's speech, &amp;quot;Unfortunately, I have terrible news&amp;quot;, presumably precedes the announcement that the rival university has also aged 5 years and is therefore just as far ahead as they were before.&lt;br /&gt;
&lt;br /&gt;
In the title text, the &amp;quot;roadmap for the next 10 years&amp;quot; implies more of the same ineffective efforts, possibly strategies to undermine the rival university, or an even more ambitious and incredibly unlikely plan to place the rival university in a spacecraft on a near-light speed journey, slowing the apparent age of the rival university with relativistic time dilation.&lt;br /&gt;
&lt;br /&gt;
Universities often plan ambitious initiatives to boost prestige. However, true success often depends on factors outside administrative control, such as student quality, alumni achievements, faculty research, historical reputation, and external economic and social factors. While administrative efforts are important for operations and gradual improvements, a university's overall prestige cannot be engineered quickly through planning alone.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Cueball is standing behind a lectern on a stage. He has raised a finger in the air while addressing an unseen audience.]&lt;br /&gt;
:Cueball: When I took the helm five years ago, our university was 213 years old – the second oldest in the state, just behind our 215 year old rival.&lt;br /&gt;
:Cueball: Under my leadership, we've funded an intensive program to increase our age to 218, overtaking our rival by 3.&lt;br /&gt;
:Cueball: Unfortunately, I have terrible news.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Public speaking]]&lt;br /&gt;
[[Category:Time]]&lt;/div&gt;</summary>
		<author><name>162.158.158.235</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2902:_Ice_Core&amp;diff=336572</id>
		<title>2902: Ice Core</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2902:_Ice_Core&amp;diff=336572"/>
				<updated>2024-03-05T00:47:35Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.158.235: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2902&lt;br /&gt;
| date      = March 4, 2024&lt;br /&gt;
| title     = Ice Core&lt;br /&gt;
| image     = ice_core_2x.png&lt;br /&gt;
| imagesize = 318x333px&lt;br /&gt;
| noexpand  = true&lt;br /&gt;
| titletext = If you find an ash deposition layer from a year in which an eruption destroyed an island that had Camellia sinensis growing on it, you can make a Gone Island Ice_τ.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a PALEOCLIMATOLOGIST CELEBRATING THEIR 21st BIRTHDAY - Please change this comment when editing this page. Do NOT delete this tag too soon.}}&lt;br /&gt;
On one's 21st birthday (in the United States), it is traditional to taste a wine dated to the year they were born. This comic jokes that paleoclimatologists, who study the climate, use ice instead of wine, drilling into the ground to find the layer matching the birth year of the recipient.&lt;br /&gt;
&lt;br /&gt;
[[Megan]], a {{w|paleoclimatologist}}, decides to make a cocktail with the ice from the icesheets (present in the Arctic and Antarctic, for example). Normally, scientists would try to date the ice and then try to find the state of the climate when these icesheets formed. Here, Megan tries to find the ice layer corresponding to [[Knit Cap]]'s birth year and asks if Knit Cap has the shaker ready. Cocktail shakers are used in the preparation of many mixed drinks, which often contain ice (usually sourced locally).&lt;br /&gt;
&lt;br /&gt;
The title text says that if they manage to find some ash coming from an eruption which destroyed an island with {{w|Camellia sinensis}} growing on it, they'll be able to get a cocktail with tea infused in it, as camellia sinensis is generally used for making tea.  Gone Island Ice_τ is a punning reference to the cocktail known in the United States as a {{w|Long Island iced tea}}.  It probably also references the IceCube Collaboration's &amp;quot;reported two candidate events for the final unobserved Standard Model cosmic messenger: astrophysical tau neutrinos&amp;quot;.  Who knew that the rapper and actor was also an astrophysics stud? &lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:[Knit Cap and Megan both wearing knit caps and scarves in a snowy environment taking a look at an ice drill. There is a helicopter on the ground in the background, with their footprints between them and the helicopter. Knit Cap is holding a small container between her hands while Megan is holding the middle of the drill.]&lt;br /&gt;
:Megan: Next, we'll identify the ice core layer matching your birth year. Do you have the shaker ready?&lt;br /&gt;
&lt;br /&gt;
:[Caption below the panel:]&lt;br /&gt;
:Making the traditional paleoclimatologist cocktail&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Knit Cap]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Characters with hats]]&lt;br /&gt;
[[Category:Geology]]&lt;br /&gt;
[[Category:Food]]&lt;/div&gt;</summary>
		<author><name>162.158.158.235</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1301:_File_Extensions&amp;diff=191766</id>
		<title>1301: File Extensions</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1301:_File_Extensions&amp;diff=191766"/>
				<updated>2020-05-09T02:01:47Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.158.235: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1301&lt;br /&gt;
| date      = December 9, 2013&lt;br /&gt;
| title     = File Extensions&lt;br /&gt;
| image     = file_extensions.png&lt;br /&gt;
| titletext = I have never been lied to by data in a .txt file which has been hand-aligned.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
Computer file names often end in {{w|file extension}}s like &amp;quot;.ppt&amp;quot; or &amp;quot;.exe&amp;quot;. These extensions are a holdover from early operating systems like {{W|DOS}} in which filenames had a maximum eight characters followed by a period and the three-character extension. The extension was used by the operating system to determine filetype so that the system would know how to handle the file (e.g. which program could open the file). Newer operating systems and file systems now accept longer-than eight-character filenames, and extensions of greater than three characters; although most extensions remain three characters.&lt;br /&gt;
&lt;br /&gt;
Most extensions are created as proprietary to certain pieces of software, although software by other developers may later be designed to be able to read the format. For example, .doc is a Microsoft Word document, although because of that software's popularity, many word processors include the ability to open .doc files. Some common file extensions are not proprietary to a piece of software and may be handled by various programs; .jpg or .gif images are examples. In either case, a file's extension is generally a good indicator of what type of data the file contains.&lt;br /&gt;
&lt;br /&gt;
Certain file types are more prevalent for certain uses, with some being almost exclusive to one use, while other are in general use and might contain almost anything. Here, [[Randall]] presents a series of file extensions which often contain information, and he is rating the reliability of the information they generally contain from most reliable to least.&lt;br /&gt;
&lt;br /&gt;
*{{w|.tex}} files are source files for the programs {{w|TeX}} and {{w|LaTeX}}, which are used often and almost exclusively by academics, especially in mathematics and the hard sciences. .tex pretty much means serious business, and Randall does not anticipate that anyone would use such a format other than for reliable information.&lt;br /&gt;
*{{w|.pdf}} files are a '''p'''ortable (as in over the web) '''d'''ocument '''f'''ormat by Adobe, frequently used for publication. Companies use them for official documentation. Thus, a .pdf file is likely to be some type of final product or polished work. Further, .tex files are generally compiled into .pdf files in order to make them readable. It would be strange to trust a .tex file without trusting the .pdf to which it compiles. For example, when submitting to academic journals in math and the hard sciences, the journal accepts the .tex file, but then compiles it and publishes the resulting .pdf. On the other hand, software which can produce a .doc/.xls(x), as described below, these days tends to have an inbuilt or addable ability to &amp;quot;Export to PDF&amp;quot;, with the promise of slightly more read-onlyness and localisation-immunity than the .doc, so it might arise - in good faith or otherwise - from a less professional editor ''trying'' to look a little more serious about the copy they distribute in this document format.&lt;br /&gt;
*{{w|.csv}} are '''c'''omma-'''s'''eparated '''v'''alues: tables of information delimited by commas, and often consist of computer-generated raw data (from, say, a scientific experiment or a database).&lt;br /&gt;
*{{w|.txt}} files contain only plain text, no &amp;quot;rich text&amp;quot; or anything fancy. Programmers often use them for README files. The txt format indicates that the creator prioritizes recording the information over making the information visually appealing, although {{w|ASCII art}} images or multiline 'bannering' of text might be included by some authors.&lt;br /&gt;
*{{w|.svg}} files are a ('''s'''calable) '''v'''ector '''g'''raphics format used a lot for diagrams, such as on Wikipedia.&lt;br /&gt;
*{{w|.xls}} and {{w|.xlsx}} files are spreadsheets used and created by the program Microsoft Excel, part of a bundle of applications known as Microsoft Office (also supported by compatible free software such as LibreOffice). These applications are very commonly used, especially for business, finance and data analysis tasks. {{w|.xls}} is a binary format used for Excel versions up to 2003, while {{w|.xlsx}} is a ZIPped XML-based format used for Excel versions 2007 and later.&lt;br /&gt;
*{{w|.doc}} files are a rich-text document format used and created by the program {{w|Microsoft Word}}, another application in the Microsoft Office bundle. As with .xls, almost anyone with access to Microsoft Office could easily make one of these. While Excel is generally used for creating tables and presenting data, Word could be used for any text-based document. Thus, Word documents tend to be far more prevalent and casually created than Excel documents, which is presumably why Randall doesn't trust them as much.&lt;br /&gt;
*{{w|.png}} files are a bitmap image format designed for the Internet. They enjoy wide popularity for providing crisp, full-color images with lossless (reversible) compression. Almost all xkcd comics, this diagram included, use PNG. But since he rates the format so low, is Randall saying we shouldn't trust this chart?&lt;br /&gt;
*{{w|.ppt}} files are used and created by the program {{w|Microsoft PowerPoint}}; as with the other two Office applications, almost anyone could easily make one of these. As they are usually used for presentations rather than documents, the information in them may be arranged differently, possibly to &amp;quot;dumb down&amp;quot; the content, or in marketing materials or talks in which the author may not be very objective. Further, several years ago, PowerPoint presentations were sometimes included instead of plain images as attachments in e-mail forwards containing inaccurate information. These emails still occasionally circulate, and may be the source of Randall's distrust.&lt;br /&gt;
*{{w|.jpg}} files are another image format with high compression capabilities, good for storing photos and not so good for many other things. Photographs in general are prone to image manipulation, hence Randall's low score for this file format.&lt;br /&gt;
*{{w|.jpeg}} files are the same thing as .jpg files, but these are more likely to have been created manually rather than automatically, making them even less reliable.&lt;br /&gt;
*{{w|.gif}} files are yet another bitmap image format, notable for supporting short animations. GIF was once ''the'' Internet image file format until PNG gradually replaced it. Since GIF is the only common image format capable of animation, it is often used to contain things like silly clips of cats falling into boxes, or annoying, blinking advertisements claiming that you're the '''[[570|100,000,000]]th VISITOR!'''. GIFs are also created by Internet trolls, such as on 4chan.org, to feed misinformation to gullible gamers and computer users. For example, a recent [http://mashable.com/2013/12/09/xbox-one-hoax-4chan-backward-compatible/ Xbox One Hoax GIF] contained supposed instructions for making the Xbox One backwards compatible. The instructions instead make the console inoperable.&lt;br /&gt;
&lt;br /&gt;
Note that while the extensions .xls/.xlsx, .doc, and .ppt were originally exclusive only to Microsoft Office and users of Windows, there now exist a number of open source programs such as Open Office, Libre Office, and some Android apps that are capable of editing such files. These programs can run on systems other than just Windows, such as Linux, perhaps contributing to making them even more widespread and easy to make than before.&lt;br /&gt;
&lt;br /&gt;
The title text refers to how .txt files contain only plain text and nothing else, meaning that any alignment (such as for indentation, tables, or {{w|Justification (typesetting)|justification}}) would have to be performed manually by adding in spaces or tabs. Anyone who would go through such an effort to improve their text's readability is likely to be trustworthy, and almost by definition, the opinion presented would be justified.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Caption above the bar chart:]&lt;br /&gt;
:Trustworthiness of Information by File Extension&lt;br /&gt;
&lt;br /&gt;
:[A line is going down and from that gray bars charting the trustworthiness in a bar graph that goes both left and right of the line. No units or figures are given. For ease of comprehension this transcript will arbitrarily designate the highest score as [+100]; subsequent scores are estimates based on the size of their bars.]&lt;br /&gt;
:[+100]: .tex&lt;br /&gt;
:[+89]: .pdf&lt;br /&gt;
:[+85]: .csv&lt;br /&gt;
:[+67]: .txt&lt;br /&gt;
:[+65]: .svg&lt;br /&gt;
:[+49]: .xls/.xlsx&lt;br /&gt;
:[+21]: .doc&lt;br /&gt;
:[+15]: .png&lt;br /&gt;
:[+14]: .ppt&lt;br /&gt;
:[+3]: .jpg&lt;br /&gt;
:[-8]: .jpeg&lt;br /&gt;
:[-36]: .gif&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
The various extensions are, for the most part, abbreviations of the file type. &lt;br /&gt;
*.tex isn't short for anything, {{w|TeX}} (that lowercase e is very important) is in fact the full name of the program&lt;br /&gt;
*.pdf is an acronym for Portable Document Format&lt;br /&gt;
*.csv is an acronym for Comma-Separated Values&lt;br /&gt;
*.txt is short for &amp;quot;text&amp;quot; - the 8.3 format meant the vowel was dropped&lt;br /&gt;
*.svg is an acronym for Scalable Vector Graphics&lt;br /&gt;
*.xls is short for eXceL Sheet (it's also why Microsoft Excel has an &amp;quot;X&amp;quot; on its icon rather than an &amp;quot;E&amp;quot;)&lt;br /&gt;
*The extra x in .xlsx (.docx and .pptx) refers to the upgrade from binary to ZIPped '''X'''ML for those formats&lt;br /&gt;
*.doc is short for DOCument&lt;br /&gt;
*.ppt is short of PowerPoinT presentation&lt;br /&gt;
*.png is an acronym for Portable Network Graphics&lt;br /&gt;
*.jpg is short for .jpeg - the 8.3 format again removed the vowel&lt;br /&gt;
*.jpeg is an acronym for Joint Photographic Experts Group, the organization that created the standard&lt;br /&gt;
*.gif is an acronym for Graphics Interchange Format&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Bar chart]]&lt;br /&gt;
[[Category:Computers]]&lt;/div&gt;</summary>
		<author><name>162.158.158.235</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2298:_Coronavirus_Genome&amp;diff=191208</id>
		<title>2298: Coronavirus Genome</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2298:_Coronavirus_Genome&amp;diff=191208"/>
				<updated>2020-04-25T01:29:11Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.158.235: /* Explanation */ When my typo was sorted (&amp;quot;genetists&amp;quot; was 'corrected' prior to saving, but wrongly) it wiped out another edit. Redoing. (Not redoing other change, doubtless https://en.wiktionary.org/wiki/among#Usage_notes applied there, re &amp;quot;amongst&amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2298&lt;br /&gt;
| date      = April 24, 2020&lt;br /&gt;
| title     = Coronavirus Genome&lt;br /&gt;
| image     = coronavirus_genome.png&lt;br /&gt;
| titletext = Spellcheck has been great, but whoever figures out how to get grammar check to work is guaranteed a Nobel.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by SPELLCHECK. Frankly I still don't get it. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.&lt;br /&gt;
&lt;br /&gt;
[[Megan]] is a {{w|Genetics|geneticist}} doing research on the SARS-CoV-2 virus. She is analyzing the virus's {{w|genome}}, its genetic material composed of {{w|DNA}} or {{w|RNA}}. The genomic sequence of an organism can be listed out as a list of {{w|nucleotide}} bases ({{w|guanine}}, {{w|adenine}}, {{w|cytosine}}, {{w|thymine}} and {{w|uracil}} - denotated as G, A, C, T, and U).&lt;br /&gt;
&lt;br /&gt;
[[Cueball]] is surprised that she and her colleagues actually use {{w|Microsoft Notepad}}, a simple {{w|text editor}}, to look at the genome, instead of more modern technology.  She explains that better research institutions use {{w|Microsoft Word}}, a more advanced editor, to allow additional formatting (such as '''bolding''' and ''italics''), and humorously calls this &amp;quot;{{w|epigenetics}}&amp;quot;.  In the real world, epigenetics is the study of changes in organisms that are not caused by direct changes to the genome itself, but in patterns of gene expression and activation.  This might be considered analogous to altering the meaning of a text by changing its formatting rather than the content; for example, content can be moved into parentheses or footnotes to be de-emphasized, or placed in bold and made large to attract attention and emphasize key points.  Much as text can be wrapped in HTML tags or similar markup to change its formatting, nucleotides can be {{w|DNA methylation|methylated}} to prevent transcription, and the {{w|histone}}s around which DNA is wound can also be modified to promote or repress gene expression.&lt;br /&gt;
&lt;br /&gt;
The real punchline comes when Megan uses {{w|Spell checker|spellcheck}} to detect mutations in the genome by adding the previous genome to spellcheck and comparing them. Overall, Megan uses ridiculously and humorously crude methods to analyze a major genetic item.  The genome of SARS-CoV-2 is almost 30,000 base-pairs long, which far exceeds the {{w|longest words}} of any natural language and may exceed the capabilities of any available spell-checking program.&lt;br /&gt;
&lt;br /&gt;
The title text mentions {{w|Grammar checker|grammar checking}} and claims that whoever discovers how to use that to compare genomic material should be awarded with a {{w|Nobel Prize}}. Spell-checking could identify (space-delimited) lengths of genetic code that have never been seen before, but grammar checking could be used to identify whether known sequences of bases make no sense as a larger sequence (a gene, or even a whole organism), which is potentially a very big question among geneticists.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:[Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.]&lt;br /&gt;
:Cueball (off-screen): So that's the coronavirus genome, huh?&lt;br /&gt;
:Megan: It is!&lt;br /&gt;
:Laptop: TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA&lt;br /&gt;
&lt;br /&gt;
:[Cueball walks up and stands behind Megan, still working on the laptop.]&lt;br /&gt;
:Cueball: It's weird that you can just look at it in a text editor.&lt;br /&gt;
:Megan: It's essential!&lt;br /&gt;
:Megan: We geneticists do most of our work in Notepad.&lt;br /&gt;
&lt;br /&gt;
:[A frameless panel, Cueball still standing behind Megan.]&lt;br /&gt;
:Cueball: Notepad?&lt;br /&gt;
:Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic.&lt;br /&gt;
:Cueball: Ah, okay.&lt;br /&gt;
:Megan: That extra formatting is called &amp;quot;epigenetics&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
:[A regular panel, Cueball still stands behind Megan. He has his hand on his chin.]&lt;br /&gt;
:Cueball: Hey, why does that one have a red underline?&lt;br /&gt;
:Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations.&lt;br /&gt;
:Cueball: ''Clever!''&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category: Comics featuring Cueball]]&lt;br /&gt;
[[Category: Comics featuring Megan]]&lt;br /&gt;
[[Category: Biology]]&lt;br /&gt;
[[Category:COVID-19]]&lt;/div&gt;</summary>
		<author><name>162.158.158.235</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:892:_Null_Hypothesis&amp;diff=191146</id>
		<title>Talk:892: Null Hypothesis</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:892:_Null_Hypothesis&amp;diff=191146"/>
				<updated>2020-04-23T16:37:05Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.158.235: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;If you get a 50% discount at two shops and buy stuff from both of them, you have a 100% discount. Math. That's how it works, bitches. '''[[User:Davidy22|&amp;lt;u&amp;gt;{{Color|purple|David}}&amp;lt;font color=green size=3px&amp;gt;y&amp;lt;/font&amp;gt;&amp;lt;/u&amp;gt;&amp;lt;font color=indigo size=4px&amp;gt;²²&amp;lt;/font&amp;gt;]]'''[[User talk:Davidy22|&amp;lt;tt&amp;gt;[talk]&amp;lt;/tt&amp;gt;]] 10:05, 9 March 2013 (UTC)&lt;br /&gt;
:I would feel entirely justified punching someone who said that unironically. Pennpenn [[Special:Contributions/108.162.249.205|108.162.249.205]] 00:59, 27 January 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
That's a misleading thing about percentages. Like this:&lt;br /&gt;
Prices of coffee increase by 2% this year, then by 3% next year. That's a 1% increase between years, or a 50% increase between years (from 2 to 3). So which is it? 1 or 50?&lt;br /&gt;
[[Special:Contributions/141.101.98.240|141.101.98.240]] 08:26, 18 December 2013 (UTC)&lt;br /&gt;
:It's a 50% increase and an increase of 1 percentage point. There's a difference between the two. [[Special:Contributions/162.158.158.235|162.158.158.235]] 16:37, 23 April 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
That's why they've invented the &amp;quot;base points&amp;quot; in financials, to denote the percentages of percentages. It's 1% absolute but 50bpp (base point percentage). [[Special:Contributions/108.162.246.11|108.162.246.11]] 18:35, 20 January 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
Oh really. If you say it increased by 2% this year, then by 3% next year. It increased 3%. Unless you mean it will increase by 3% from LAST YEAR to NEXT YEAR. Then it really increased by 2% then .97%. But for this purpose let's throw that out and make it simple. It increased by 2% this year, and will increase by 3% next year. 50% isn't how much it increased, but how much the increase increased. That's called acceleration. The rate of increase per year is always 2 or 3%. So, 1% doesn't factor into this equation at all no matter how you do the math. The answer is 1.02*1.03. It increased by 5.06% over the last two years. [[Special:Contributions/108.162.216.114|108.162.216.114]] 14:59, 18 August 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
Don't these discussion points belong in a different comic?  Or perhaps the garbage?  Except (1), he lol'd me.  [[Special:Contributions/108.162.219.58|108.162.219.58]] 21:23, 5 February 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
:They should be on [[985: Percentage Points]] or [[1102: Fastest-Growing]] --[[User:Pudder|Pudder]] ([[User talk:Pudder|talk]]) 11:35, 23 October 2014 (UTC)&lt;/div&gt;</summary>
		<author><name>162.158.158.235</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2218:_Wardrobe&amp;diff=181584</id>
		<title>2218: Wardrobe</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2218:_Wardrobe&amp;diff=181584"/>
				<updated>2019-10-22T12:49:27Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.158.235: /* Explanation */ Attempting a more NPOV. &amp;quot;For the most part&amp;quot; is debatable, depending on your baseline, but neither determined Brexiteers nor ardent Remainers can't argue against &amp;quot;narrowly&amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2218&lt;br /&gt;
| date      = October 21, 2019&lt;br /&gt;
| title     = Wardrobe&lt;br /&gt;
| image     = wardrobe.png&lt;br /&gt;
| titletext = If you'd just agree to hold your meetings in here, you'd have PLENTY of time to figure things out before the deadline.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a NARNIAN-BRITISH NEUTRAL ZONE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
[[Megan]] leaves [[Cueball]] outside while she goes into a wardrobe to consult with Tumnus on the pressing question, if Narnia is part of the EU. It turns out they have joined after the UK, which makes Megan complain about another border to deal with. And Cueball waiting outside goes looking for a lock for the wardrobe door.&lt;br /&gt;
&lt;br /&gt;
This comic references ''{{w|The Chronicles of Narnia}}'', a series of children's fantasy books by {{w|C.S. Lewis}} (some of which were later {{w|The Chronicles of Narnia (film series)|made into movies}}) about a number of children from England who travel to a magical land called Narnia. In the first book of the series (by publication date), ''{{w|The Lion, the Witch, and the Wardrobe}}'', Narnia is accessible through a wardrobe. {{w|Mr. Tumnus}} is a {{w|faun}} in Narnia and the first character that the first human visitor, {{w|Lucy Pevensie}}, meets on her first trip through the wardrobe portal. Referencing Narnia is a [[:Category:Chronicles of Narnia|recurring theme]] in xkcd. In the first comic to do so, [[665: Prudence]], Lucy sends a probe through the wardrobe and that finds Tumnus under the famous lamppost in the forest.&lt;br /&gt;
&lt;br /&gt;
The question has to do with membership in the {{w|European Union}} (short EU, not E.U. as [[Randall]] writes in the comic). The {{w|United Kingdom}} (UK) is a member of the EU at the time of this comic, but voted (narrowly) in 2016 to exit the EU (a process commonly called {{w|Brexit}}), but working out the details of this separation has proven quite problematic. &lt;br /&gt;
&lt;br /&gt;
One of the major issues has been the border between {{w|Northern Ireland}} and the {{w|Republic of Ireland}}. Both are on (and together comprise in its entirety) the {{w|island of Ireland}}, but Northern Ireland is part of the UK while Ireland is a separate country that will remain part of the EU. If/when the UK exits the EU, it will have different customs regulations than the Republic of Ireland, and there will need to be some kind of customs border, probably either between Northern Ireland and the Republic of Ireland, or between the island of Ireland and the {{w|island of Great Britain}} (which comprises {{w|England}}, {{w|Scotland}}, and {{w|Wales}}). &lt;br /&gt;
&lt;br /&gt;
However, in 1998, the UK and Ireland entered into a treaty, known as the {{w|Good Friday Agreement}} (overwhelmingly approved by referendums in both parts of Ireland). The agreement hoped to resolve some of the issues which had led to {{w|The Troubles}} in Northern Ireland, and over 3000 deaths since 1969. &lt;br /&gt;
&lt;br /&gt;
One of the consequences of the treaty was a totally open border between the two parts of Ireland. As both were in the EU, this was easily done. Over the following two decades, the ease of transit created major trade links between the two areas, and many people lived in one part and worked in the other. As a result, in the UK Brexit referendum, a majority of Northern Ireland voters voted to remain in the EU. &lt;br /&gt;
&lt;br /&gt;
Either border is considered ''extremely'' undesirable to the people of both parts of Ireland. The former would necessitate customs checks on the island of Ireland between the two parts of it, creating a barrier on that island contrary to the intent of the Good Friday Agreement.  The latter would separate Northern Ireland to some extent from the rest of the UK, which is unacceptable to many citizens of both Northern Ireland and Great Britain. &lt;br /&gt;
&lt;br /&gt;
Many fear that building either border would lead to terrorist attacks and the rekindling of hostilities, the troubles mentioned above. The issue was flagged by the Irish government and the EU from the time of the Brexit referendum. Its importance was not understood by the UK government. Resolving this issue has been a major sticking point in the ongoing Brexit negotiations. &lt;br /&gt;
&lt;br /&gt;
The portal in the wardrobe represents ''another'' border of the UK, namely the border between England and Narnia. This 'border', of course, exists only in fiction, but the joke here is that it must be dealt with in the Brexit negotiations, further complicating an already messy situation. Cueball suggests solving the situation by simply locking the wardrobe (which was never very accessible, even in ''The Chronicles of Narnia''), effectively isolating the UK from Narnia and making the border problem moot. Problem is, if the book is taken literally, that new ways to enter Narnia pops up in every book, however, most of them is only accessible to the kids from the first book and their friends.&lt;br /&gt;
&lt;br /&gt;
The title text references the amount of time it has taken to complete the Brexit negotiations, currently three-plus years and counting. The negotiators have set a series of deadlines to complete the negotiations, but have repeatedly had to extend those deadlines because they haven't reached any agreement. The comic was posted roughly one week before the Brexit deadline (Oct. 31, 2019).  However [https://www.cnbc.com/2019/10/19/eu-says-britain-has-requested-an-extension-of-brexit-deadline-after-uk-lawmakers-delay-vote.html it was already expected that that deadline too would probably be extended]. In ''The Chronicles of Narnia'', time moves inconsistently in Narnia, usually passing more rapidly in Narnia than on Earth.  The Pevensie siblings enter the wardrobe as children, have extensive adventures in Narnia lasting many years, and then return to the real world to find that they are children again and that only a few minutes have passed. The suggestion here is that holding the slow Brexit negotiations in Narnia would take relatively little time in the real world, and the whole affair could be completed in time for the deadline.&lt;br /&gt;
&lt;br /&gt;
A punchline similar to the title text, where the slower passing of time was used to take on time-intensive real world problems, was also used for one of the comics in [[821: Five-Minute Comics: Part 3]]. The time difference was also mentioned in the title text of [[1786: Trash]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Megan is entering into an open wardrobe, while Cueball stands outside.]&lt;br /&gt;
:Megan: I'll go ask. &lt;br /&gt;
:Megan: You wait here.&lt;br /&gt;
&lt;br /&gt;
:[Cueball stands outside the now closed wardrobe.]&lt;br /&gt;
&lt;br /&gt;
:[In a frame-less panel Cueball keeps standing outside the closes wardrobe, as voices can be heard from inside the wardrobe, as indicated with two small starburst from which text lines goes up. The characters talking are inferred from the context]&lt;br /&gt;
:Tumnus (from inside wardrobe): Halt! Who goes there?&lt;br /&gt;
:Megan (from inside wardrobe): Hey Tumnus. Quick question.&lt;br /&gt;
:Tumnus (from inside wardrobe):  Yes?&lt;br /&gt;
&lt;br /&gt;
:[Cueball walks away from the closed wardrobe. Voices can still be heard from inside the wardrobe.]&lt;br /&gt;
:Megan (from inside wardrobe):  Is Narnia in the E.U.?&lt;br /&gt;
:Tumnus (from inside wardrobe): Yes, we joined after you did.&lt;br /&gt;
:Megan (from inside wardrobe):  Oh great, ''another'' border to deal with.&lt;br /&gt;
:Cueball: I'll go find a lock for the door.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Chronicles of Narnia]]&lt;br /&gt;
[[Category:Politics]]&lt;/div&gt;</summary>
		<author><name>162.158.158.235</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2217:_53_Cards&amp;diff=181489</id>
		<title>2217: 53 Cards</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2217:_53_Cards&amp;diff=181489"/>
				<updated>2019-10-21T08:12:03Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.158.235: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2217&lt;br /&gt;
| date      = October 18, 2019&lt;br /&gt;
| title     = 53 Cards&lt;br /&gt;
| image     = 53_cards.png&lt;br /&gt;
| titletext = Well, there's one right here at the bottom, where it says &amp;quot;53.&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a 53-CARD DECK. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
In this comic Cueball claims that he has found a way to manipulate a {{w|Standard 52-card deck|52-card deck}} into a 53-card deck with ''only'' shuffling and rearranging. This is absurd, since there is no way for new cards to be incorporated, thus violating the laws of conservation, as well as fundamental rules of logic that would be in place even in a universe that had different conservation rules. He backs up this claim with a diagram containing random mathematical jargon and challenges Ponytail to find an error. However, the given math is sufficiently esoteric that an error cannot easily be found. It's possible that the process involves the [[804:_Pumpkin_Carving|Banach-Tarski paradox]] at some step.&lt;br /&gt;
&lt;br /&gt;
The caption below the comic states that this is how Randall feels when talking to someone who likes the theory of {{w|perpetual motion}}, motion of macroscopic bodies that, barring mechanical damage, continues indefinitely. This is impossible according to currently known laws of physics, since such motion would entail producing energy out of nothing in order to overcome friction, but adherents still believe it is possible. The comic draws comparison between conservation of energy and conservation of cards in a deck.&lt;br /&gt;
&lt;br /&gt;
In the title text, Ponytail responds to Cueball's challenge with snark, claiming that the most obvious error is the fact that the formula's result is &amp;quot;53&amp;quot;. This doesn't actually prove that there is an error in Cueball's math, but Ponytail refuses to entertain the possibility that 52 items can become 53 items without having any items added to the system in the process – similar to how energy can be transferred but never produced.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
:[Cueball and Ponytail are standing next to a flowchart, with Cueball gesturing to it.]:&lt;br /&gt;
:Cueball: I've found a way to turn a 52-card deck into 53 cards by shuffling and rearranging them.&lt;br /&gt;
:Ponytail: No, you haven't.&lt;br /&gt;
:Cueball: How do you know?! I challenge you to find an error in my math!&lt;br /&gt;
&lt;br /&gt;
:[Caption below the panel]:&lt;br /&gt;
:Every conversation between a physicist and a perpetual motion enthusiast.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Ponytail]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Physics]]&lt;/div&gt;</summary>
		<author><name>162.158.158.235</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2216:_Percent_Milkfat&amp;diff=181364</id>
		<title>2216: Percent Milkfat</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2216:_Percent_Milkfat&amp;diff=181364"/>
				<updated>2019-10-17T08:46:41Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.158.235: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2216&lt;br /&gt;
| date      = October 16, 2019&lt;br /&gt;
| title     = Percent Milkfat&lt;br /&gt;
| image     = percent_milkfat.png&lt;br /&gt;
| titletext = &amp;quot;So what's dark energy?&amp;quot; &amp;quot;Cosmologists and the FDA are both trying very hard to find out.&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a DARK MATTER COW. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
[[Ponytail]] is explaining to [[Cueball]] that while 2% milk do contain 2% {{w|Butterfat|milkfat}}, then whole milk, does not contain 100%, but only 3.5% fat. Cueball thinks this is weird and asks what the rest of the milk contains of, but then get a completely nonsense answer from Ponytail about the remaining 96.5% constituting of 27% dark matter and the rest as dark energy.&lt;br /&gt;
&lt;br /&gt;
Whole milk is a dairy product which contains all of its naturally occurring milkfat. Whole milk generally contains about [https://www.washingtonpost.com/news/wonk/wp/2014/10/03/whole-milk-is-actually-3-5-milk-whats-up-with-that/ 3.5% milkfat] by weight, according to the comic and some sources; [https://milklife.com/articles/nutrition/types-of-dairy-milk other sources] list similar but not identical numbers such as 3.25%.  &lt;br /&gt;
&lt;br /&gt;
Dairies commonly sell whole milk as well as products with less fat produced by removing milkfat.  {{w|Fat_content_of_milk#United_States|In the United States}}, there are three common products with less fat: 2% or &amp;quot;reduced fat&amp;quot; milk, 1% or &amp;quot;lowfat&amp;quot; milk, and &amp;quot;fat-free&amp;quot; or &amp;quot;skim&amp;quot; milk with 0 to 0.5% milkfat.&lt;br /&gt;
&lt;br /&gt;
Since whole milk is labeled as &amp;quot;whole&amp;quot; (or &amp;quot;Vitamin D&amp;quot;) milk and not as &amp;quot;3.5% milk,&amp;quot; one might naively assume that whole milk is 100% milkfat, though this is not the case; 100% would be a product which is entirely milkfat (also known as butterfat), such as {{w|clarified butter}} or ghee. In milk, {{w|Milk#Nutrition and health|the remainder}} is mainly water along with proteins, lactose (a sugar), and other substances.&lt;br /&gt;
&lt;br /&gt;
The comic analogizes this difference to the fact that physicists believe &amp;quot;ordinary&amp;quot; matter only constitutes 5% of the actual mass-energy of the universe. Scientists predict the existence of another kind of matter known as &amp;quot;{{w|dark matter}},&amp;quot; invisible to our current instruments but exerting gravitational force on ordinary matter, which would constitute 85% of total matter and 27% of the universe's mass-energy, with the remainder an even less detectable and more mysterious &amp;quot;{{w|dark energy}}&amp;quot; accounting for the increasing speed of {{w|expansion of the universe}}.&lt;br /&gt;
&lt;br /&gt;
Ponytail uses these quantities to &amp;quot;explain&amp;quot; the &amp;quot;missing&amp;quot; percentage in whole milk between the actual 3.5% and a potential 100% &amp;quot;whole.&amp;quot; She actually uses the 27% as mentioned above for dark matter. She thus indicate that dark energy takes op the remaining 69.5% of the whole milk.&lt;br /&gt;
&lt;br /&gt;
{{w|Physical cosmology|Cosmologists}} are working to better understand dark energy or another reason for the universe's accelerating expansion. The title text supposes that both cosmologists and the {{w|Food and Drug Administration}} (FDA), which regulates milk and other food items in the United States, are trying to understand the dark energy of the whole milk. In real life, the work of cosmologists and FDA scientists does not overlap at all{{Citation needed}}.&lt;br /&gt;
&lt;br /&gt;
Dark energy was recently mentioned in [[2113: Physics Suppression]], but before that milk fat and dark energy was actually mentioned in the same sentence in [[2063: Carnot Cycle]] from almost a year before this comic, so the idea behind this comic is not new for Randall. Dark matter was mentioned back in [[1758: Astrophysics]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Ponytail, raising her palm, and Cueball are talking.]&lt;br /&gt;
:Ponytail: &amp;quot;2% milk&amp;quot; is 2% milkfat. But &amp;quot;whole milk&amp;quot; isn't 100% milkfat&amp;amp;ndash;it's 3.5%.&lt;br /&gt;
:Cueball: Weird. What's the rest of it?&lt;br /&gt;
:Ponytail: About 27% is dark matter. The remainder is dark energy.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Ponytail]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Astronomy]]&lt;br /&gt;
[[Category:Food]]&lt;/div&gt;</summary>
		<author><name>162.158.158.235</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2215:_Faculty:Student_Ratio&amp;diff=181307</id>
		<title>Talk:2215: Faculty:Student Ratio</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2215:_Faculty:Student_Ratio&amp;diff=181307"/>
				<updated>2019-10-16T08:58:01Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.158.235: gah&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
Hi&lt;br /&gt;
&lt;br /&gt;
That student from the title text would have just barely made a cent, two if they were generous and rounded up. [[Special:Contributions/172.68.65.18|172.68.65.18]] 00:21, 15 October 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Really? My calculations have him at about 16 cents ((5 trillion x 100) divided by (10^6 x 3600 x 24 x 365.25))&lt;br /&gt;
&lt;br /&gt;
Regarding above average students not getting in, the scenario described is oversimplified.  I used to work in admissions for a “highly selective” university and while applicants with perfect SATs and higher than 4.0 GPAs were routinely put on the wait list (not rejected) because we assumed that they viewed us as merely a “safety school”, if the applicant showed any interest at all in actually attending, such as having come on campus for an in person interview, campus tour, or had an alumni connection, or letter(s) of recommendation, or athletic scholarship, then of course we would make an offer, and similarly if they showed any interest as cited above after being put on the wait list then they would be top of the list to get an offer from the wait list.  [[Special:Contributions/162.158.63.48|162.158.63.48]] 03:39, 15 October 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
I'm pretty sure it should be [https://www.wolframalpha.com/input/?i=50+trillion+dollars%2Fyear+*+10+microseconds $15.85] and [https://www.wolframalpha.com/input/?i=50+trillion+dollars+%2F+%2850*40+hours%29+*+10+microseconds $69.44]. Although I'm not so sure now that there's 3 other answers on this page. If someone can confirm one of these and find inaccuracies in the others, go ahead and update the page. --[[User:Seaish|Seaish]] ([[User talk:Seaish|talk]]) 07:49, 15 October 2019 (UTC)&lt;br /&gt;
:For a constant salary across the whole year, I got $15.85 as well. For paid working time it depends on the assumptions of working days per year and working hours per working day. I got 220 working days(250 official in my state-30 days of holiday, even though technically it is considered payed holiday....) and 39hours per week (8 per day, and 7 on friday), I get to $80.94. But, as stated that depends on the assumptions. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 09:48, 15 October 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
;&amp;quot;Hi!&amp;quot; x 5'000'000'000&lt;br /&gt;
&lt;br /&gt;
Hi!&lt;br /&gt;
&lt;br /&gt;
I think it's a reference to &amp;quot;Hello, World!&amp;quot; test program.&lt;br /&gt;
&lt;br /&gt;
It is also possible to print 5 billions of unique &amp;quot;Hi!&amp;quot; using different color (provided you have 32 bit color map for CMYK and maybe 2 differend colors of paper) {{unsigned ip|172.68.10.172}}&lt;br /&gt;
&lt;br /&gt;
;Unsigned Comment from Community Portal moved here:&lt;br /&gt;
HI, &lt;br /&gt;
&lt;br /&gt;
I disagree with the calculation for the amount of 50 trillion over 10 microseconds, its a lot more than the amount give,.&lt;br /&gt;
&lt;br /&gt;
Wage = 50000000000000000000&lt;br /&gt;
&lt;br /&gt;
Divide by 260 days for an average work year is a daily rate of = 192307692307692000.00&lt;br /&gt;
&lt;br /&gt;
Divide that by 7.5, the average working day is an hourly rate of = 25641025641025600.00&lt;br /&gt;
&lt;br /&gt;
Divide that by 60 for minutes in the hour to give a minutes rate of = 427350427350427.00&lt;br /&gt;
&lt;br /&gt;
Divide that by 60 for seconds in the minute to give a seconds rate of = 7122507122507.12&lt;br /&gt;
&lt;br /&gt;
Divide that by 1000 to give a millisecond rate of = 7122507122.51&lt;br /&gt;
&lt;br /&gt;
Divide that by 1000 to give a microsecond rate of = 7122507.12&lt;br /&gt;
&lt;br /&gt;
Times that by 10 = 71,225,071.23 for 10 microseconds of work, not bad.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
From an ADP Payroll Specialist {{unsigned ip|162.158.234.82}}&lt;br /&gt;
:50 trillion (in english use of the word trillion) is 5E13, not 5E19 (as you used it), so instead of $71,225,071.23 it is only $71.22 for the 10 microseconds, using your assumptions on average work days and working time. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 09:35, 15 October 2019 (UTC)&lt;br /&gt;
::Trillion could be 1E18 in long scale, commonly referred to as Brittish, or in short scale, commonly referred to as American, it is 1E12.  So the &amp;quot;english&amp;quot; use of the word trillion is ambiguous (but adding the English modifier suggests British, i.e., long scale.)  I added a note to article to mention the different possible interpretations. [[Special:Contributions/172.69.33.113|172.69.33.113]] 19:58, 15 October 2019 (UTC)&lt;br /&gt;
:::According to your wikipedia link, nearly all English speaking countries (including the UK and therefore England) use the short scale. Therefore, in contrast to my native language (German), which uses the short scale, the long scale is the &amp;quot;English&amp;quot; meaning, even though the term (English) is not scientifically correct in this context, it helps when trying to make it clear to the many people on this wiki who natively speak a language in which the long scale is the usual one. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 06:08, 16 October 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Is the date incorrect? The archive on xkcd says it was released on 10/14, but here it says it was released on the 15th, which would make it a tuesday comic. [[User:Landfind|Landfind]] ([[User talk:Landfind|talk]]) 14:17, 15 October 2019 (UTC)&lt;br /&gt;
:The date was set incorrectly by the BOT that generated this page - not sure why but likely because the time of release was just past midnight GMT.  I fixed it though because it is clearly the Monday comic for 10/14. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 15:47, 15 October 2019 (UTC)&lt;br /&gt;
:Here, a Monday the 14th seven or eight pm refresh did the trick. [[Special:Contributions/172.68.38.64|172.68.38.64]] 17:37, 15 October 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
*um, &amp;quot;10e-6 / 3600 / 24 / 365 * 50e12)&amp;quot; does not mean what you think it means. are we geeks here or not? --[[Special:Contributions/162.158.158.235|162.158.158.235]] 08:58, 16 October 2019 (UTC)&lt;/div&gt;</summary>
		<author><name>162.158.158.235</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2212:_Cell_Phone_Functions&amp;diff=180967</id>
		<title>Talk:2212: Cell Phone Functions</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2212:_Cell_Phone_Functions&amp;diff=180967"/>
				<updated>2019-10-07T16:06:45Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.158.235: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
&lt;br /&gt;
I know of someone who DID build a taser into a phone... (but that's all it is now, was no space for the phone's electronics anymore) [[Special:Contributions/172.69.54.39|172.69.54.39]] 08:05, 7 October 2019 (UTC)&lt;br /&gt;
: Well, there are actual commercial taser phone cases available for purchase today - [https://youtu.be/XaJSYxit1qI here's one example]. Not necessarily a good idea and not legal everywhere, but it exists. --[[User:NeatNit|NeatNit]] ([[User talk:NeatNit|talk]]) 12:03, 7 October 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
It seems a bit peculiar that one of the move &amp;quot;obvious&amp;quot; devices a cellphone can replace is missing: the watch. [[User:JohnHawkinson|JohnHawkinson]] ([[User talk:JohnHawkinson|talk]]) 08:18, 7 October 2019 (UTC)&lt;br /&gt;
: That's because no one sane would do that ;) Some may use a Smart Watch instead of a classic watch but except of the case when you were used to pocket watches anyways a replacement of a wacth by a phone would be a downgrade usability wise. /edit: That being said: My personal &amp;quot;Now&amp;quot; bar is at the first quarter (more or less at the web browser's bar end) [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 08:29, 7 October 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
:: I realize it's unlikely you're being entirely serious here, but the same argument applies to almost all of the devices listed in this comic. So…no, that's not the reason for its omission. [[User:JohnHawkinson|JohnHawkinson]] ([[User talk:JohnHawkinson|talk]]) 08:33, 7 October 2019 (UTC)&lt;br /&gt;
::: Actually I was dead serious. Well except of the &amp;quot;no one sane&amp;quot; part. I don't want to offend anyone :) In the time you take your phone out of the pocket to check the time I've looked thrice at my wrist watch [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 08:54, 7 October 2019 (UTC)&lt;br /&gt;
:::: The time taken isn't awfully relevant, unless you're checking the time awfully frequently. For the number of times a day I need to check the time when I'm not at a computer or already looking at my phone, the convenience of a wristwatch could easily be outweighed by the inconvenience of taking it off and putting in on each day. [[Special:Contributions/162.158.178.69|162.158.178.69]] 09:34, 7 October 2019 (UTC)&lt;br /&gt;
::::: Assuming you'd put it off. ;) (Despite the emoticon I'm serious again. I only put my watch off to change the battery) And even if I would put it off it would be more likely I forgot my phone on my desk than forgetting to put the watch on. I'm wearing a wrist watch since I was 8 or 9. But granted, the time is not as relevant as the fact that you have to put a device from out of somewhere and push a button to activate the screen just to check time. But in the end it's just a matter of personal taste and habit, I guess. [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 10:02, 7 October 2019 (UTC)&lt;br /&gt;
::::::Yeah, whether it's as convenient or even as good is irrelevant: Cell phones are not as good at photos as a dedicated camera but they are used for that because they can do it without the need for a separate device, which is the point of this comic. Most people do not wear watches anymore &amp;amp; just use their phones instead. Watches really would belong on this list, except it might be more difficult to pin down a transitional point! Some of us stopped needing watches when we realized our Nokia 3390 had a clock in the corner. Other people may have whattimeisitrightnow dot com on their smartphone's home screen... [[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 14:44, 7 October 2019 (UTC)&lt;br /&gt;
:::: A phone in the pocket is infinitely better for me than a watch because watches make the skin underneath the wristband itch from the continuous contact. (I have atopic dermatitis.) -- [[Special:Contributions/162.158.93.135|162.158.93.135]] 13:35, 7 October 2019 (UTC)&lt;br /&gt;
: there was a brief period between ubiquitous cell/mobile phone use and the advent of the smartwatch where experts predicted the demise of the watch other than as a piece of jewellery [[User:Boatster|Boatster]] ([[User talk:Boatster|talk]]) 08:46, 7 October 2019 (UTC)&lt;br /&gt;
: I always hated wearing a watch - I do sometimes use my phone for finding the time - but &amp;quot;Hey Google - what time is it?&amp;quot; works without taking it out of my pocket.  The thing is though - watches were obsolete before the smartphone existed.  When just about 100% of electronic devices have clock display - my cooker, microwave, toaster, car, TV, computer, etc, etc ALL tell me the time.  Why would I need a watch?  SmartWatches seem like a retrograde step. [[User:SteveBaker|SteveBaker]] ([[User talk:SteveBaker|talk]]) 13:17, 7 October 2019 (UTC)&lt;br /&gt;
:: Well, with a watch you always know, where to look, especially when not in your own home. So just looking at your own wrist is much faster, then scanning your enviroment for the nearest screen. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 13:29, 7 October 2019 (UTC)&lt;br /&gt;
::&amp;quot;Smart Watches&amp;quot; that don't do much without a smartphone to connect to seem especially backwards to me. A smart watch with cellular radio would be useful on its own. Side note: So _you're_ that one person who leaves voice activation on all the time!?! Setting the very real privacy &amp;amp; safety issues aside for a moment... Doesn't it trigger from random conversations on an almost daily basis? I don't even know anyone who was able to leave Siri or Alexa on touchless, much less Google. [[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 15:21, 7 October 2019 (UTC)&lt;br /&gt;
 &lt;br /&gt;
Try to translate &amp;quot;die eierlegende Wollmilchsau&amp;quot; &lt;br /&gt;
[[Special:Contributions/162.158.89.97|162.158.89.97]] 09:52, 7 October 2019 (UTC)&lt;br /&gt;
:Sounds a lot like a schmoo from _Lil Abner_ by Al Capp! I wonder if the egg-legend woolmillsow is where he got the idea? [[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 15:21, 7 October 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
There is a terrible movie - [[Wikipedia:Shorts: The Adventures of the Wishing Rock|Shorts: The Adventures of the Wishing Rock]] - where everyone has a device called The Black Box that can do all of that, as well as pretty much anything. Its function changes kind of like a Rubik's Cube. It's an obvious parody of smartphones, except that it came out right around the time they were getting popular so I'm not sure if smartphones are the true inspiration. I can't recommend that movie (really, it's awful) but this comic reminded me of it and I wanted to share. --[[User:NeatNit|NeatNit]] ([[User talk:NeatNit|talk]]) 10:11, 7 October 2019 (UTC)&lt;br /&gt;
:Also see the Guide 2.0 as depicted in the later _Hitchhiker's Guide To The Galaxy_ novels. It would do anything its user asked, including removing all Earths from all timelines (which is what it was built for). There's an old SciFi story about a man with a hypnotic paisley tie who accidentally leaves behind a futuristic universal remote &amp;amp; the contemporary guy who finds it gets in trouble. Overall, the &amp;quot;one device that does everything&amp;quot; has been an idea for at least a hundred years; but I think it's not just dismissed as whimsy so easily these days. [[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 15:21, 7 October 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Re: steering wheel, there was a James Bond movie (Pierce Brosnan era I think) where he could control a car from a phone (they were not yet called smartphones at the time). I wouldn't be surprised that the technology has already been implemented, even though I don't want to think of the legal consequences if this became mainstream: &amp;quot;Honestly officer, I wasn't LOOKING at my phone, I was DRIVING my car!&amp;quot;[[Special:Contributions/162.158.155.110|162.158.155.110]] 11:30, 7 October 2019 (UTC)&lt;br /&gt;
: sure it's *technically* possible: all you need is to pair the gyro/accelerometer of your phone with your car's servo steering. any vehicle with a parking assistant can be controlled that way (and security researchers have demonstrated that in impressive talks back in 2015: https://www.youtube.com/watch?v=OobLb1McxnI). [[User:Gir|-- //gir.st/]] ([[User talk:Gir|talk]]) 11:37, 7 October 2019 (UTC)&lt;br /&gt;
:It was in ''Tomorrow Never Dies'' (https://youtu.be/BxTvfVZjR_Q) with a 'slightly' non-standard phone (pre-smartphone) and a 'slightly' non-standard car... Hardly the most unbelievable feature, though. ;) [[Special:Contributions/162.158.158.235|162.158.158.235]] 16:06, 7 October 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
I've written a first draft of the explanation and transcript, but I don't have time for anything else today. It turned out more high-flown than I intended, so feel free to reword as necessary. Also, because I'm sure it'll come up eventually, regarding the transcript: since Randall has not given any time scale, we should refrain from over-interpreting when something happened. For the joke to get through, knowing which elements happened in the past and which (might) happen in the future is enough. [[User:Gir|-- //gir.st/]] ([[User talk:Gir|talk]]) 11:33, 7 October 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Hmmm - so let's fact check this:&lt;br /&gt;
* My phone is indeed being used as a car key (I own a Tesla and my phone unlocks the car and lets me drive it), phone, camera, newspaper, credit card and flashlight - so short bars for all of these is good.&lt;br /&gt;
* As a TV remote, that could be true - but we're actually edging into a &amp;quot;post-phone&amp;quot; era on that one.  I can (and occasionally do) use my phone to control the Roku - but it's easier to use voice commands through Google Home for that...although I suppose I could use the phone to run Google Home instead of the Google Mini in my living room...so 50/50 on being &amp;quot;post-phone&amp;quot; on this one.&lt;br /&gt;
* As a Web Browser, I could use the phone - but only rarely actually do that.  Mostly I use my ChromeBook for that, and also the screen on my Tesla - the piddly little cellphone screen guarantees it won't take over that role for more than 10% of the time.&lt;br /&gt;
* He missed out &amp;quot;Text messaging&amp;quot; - but I'm using the phone less and less for that because having a decent keyboard is good - so the ChromeBook is stealing that capability.&lt;br /&gt;
* Steering wheel...well, the Tesla already steers itself about 80% of the time that I drive. I predict that the steering wheel will cease to exist (at least for me) before I use my phone for that...although it certainly is capable of it in theory...and I'm pretty sure Tesla demonstrated the car being used as a radio controlled toy from a phone a few years ago...although it never made it into production (mercifully!).&lt;br /&gt;
* You probably could use a phone as a bird feeder (for smaller birds - draping a dead rabbit over it to attract vultures might be a bad idea).&lt;br /&gt;
* All of the others are well into the future...so I agree with him on those.&lt;br /&gt;
[[User:SteveBaker|SteveBaker]] ([[User talk:SteveBaker|talk]]) 13:13, 7 October 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
I feel like we could/should be reading this more literally.  If we assume that Randall lives on the fairly early edge of technology, then the time from the left side of the chart to now is ~25 years.  If we also assume that the time axis is linear, then we should be driving our cars with our phones in 7-8 years (though I can now drive my car through a parking lot at least using my phone, it's still doing the steering for me).  Sadly brushing our teeth is still about 20 years out according to this prediction, however maybe by then our phones will be able to do some sort of ultrasonic cleaning. [[User:Jasonk|Jasonk]] ([[User talk:Jasonk|talk]]) 13:58, 7 October 2019 (UTC)&lt;br /&gt;
:I'm continually surprised that nobody is known to have fallen for a joke digital toilet-tissue app called iWipe. [[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 15:21, 7 October 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
It seems like it would be good to reference Randall's [[:Category:xkcd Phones|rather unusual phone function proposals]] in the explanation. Perhaps he's suggesting that these phones will become commonly used (or at least used by him) in the future. [[User:Dry Paratroopa|Dry Paratroopa]] ([[User talk:Dry Paratroopa|talk]]) 14:38, 7 October 2019 (UTC)&lt;/div&gt;</summary>
		<author><name>162.158.158.235</name></author>	</entry>

	</feed>