explain xkcd - User contributions [en]

2316: Hair Growth Rate

2023-02-18T00:39:50Z

162.158.186.96: Correction

{{comic
| number = 2316
| date = June 5, 2020
| title = Hair Growth Rate
| image = hair_growth_rate.png
| titletext = Hourly haircuts would be annoying, but they'd be easier to do yourself, since you'd have adjacent hairs as a guide. Growing it out would be a huge pain, though.
}}

==Explanation==
This strip is one of the simpler jokes that xkcd has done, being an observation on mathematics, biology, and human expectation. White Hat starts by sharing various facts about hair with Ponytail; hair count, individual hair growth rate, and finally total hair growth rate. Ponytail proceeds to snark about how unpleasant it would be if, rather than 100,000 hairs growing at a gross total of five feet (1.524m) per hour, humans grew a single new five-foot-long hair once per hour. The comic then delves into the absurdity of gradual versus spontaneous growth, and then the sound effects involved therein.

The comic touches on what information can be obscured by just looking at aggregate values. A person whose 100,000 hairs grow a half-inch (1.27cm) per month experiences the same total new hair growth as a person with one hair growing five feet in an hour, but their grooming experiences would be very different. Likewise, a person with one hair growing steadily for an hour has the same average rate of hair growth as a person experiencing sudden hair growth on the hour, but the profile of instantaneous energy conversion and protein production would be very different. One of Ponytail's suggestions for what five feet of instantaneous hair growth might sound like is a sound effect generally used for directed-energy weapons (''Pew!'').

We never see what sort of hairstyle White Hat has under his hat, but Ponytail's hair is fairly long. If she had to grow it out by one hair per hour, as in the title text, then it would take over eleven years before all 100,000 hairs had grown out.

==Transcript==
:[White Hat and Ponytail are walking to the right.]
:White Hat: The average head has about 100,000 hairs.
:White Hat: And hair grows at about ½" per month.
:White Hat: Plus or minus.
:Ponytail: Okay...

:[They continue to walk while White Hat lift a hand up palm up.]
:White Hat: So our heads are producing an inch of hair every minute.
:Ponytail: I see.

:[They continue to walk.]
:Ponytail: I'm just glad it's evenly distributed. It would suck if we grew a single new five-foot-long hair every hour.

:[White Hat and Ponytail are seen in silhouette from a distance. White Hat has lifted a finger up and while Ponytail has thrown both her arms out to the sides.]
:White Hat: Hmm, would the hair grow steadily, or would it suddenly shoot out 5 feet on the hour?
:Ponytail: If the latter, what noise would it make?
:Ponytail: ''Ziiip? Pwiff?''
:White Hat: ''Fwip?''
:Ponytail: Blip.
:White Hat: ''Zhooop.''
:Ponytail: Pew!

{{comic discussion}}

[[Category:Comics featuring White Hat]]
[[Category:Comics featuring Ponytail]]

1985: Meteorologist

2023-02-17T22:38:24Z

162.158.186.96: /* Answering the meteorologists’ questions */

{{comic
| number = 1985
| date = April 25, 2018
| title = Meteorologist
| image = meteorologist.png
| titletext = Hi, I'm your new meteorologist and a former software developer. Hey, when we say 12pm, does that mean the hour from 12pm to 1pm, or the hour centered on 12pm? Or is it a snapshot at 12:00 exactly? Because our 24-hour forecast has midnight at both ends, and I'm worried we have an off-by-one error.
}}

==Explanation==
Although we’re constantly exposed to them, many (most?) people don’t understand the details of how to properly interpret weather forecasts. But even beyond the normal questions, there can be much more complex issues hiding beyond those (though most people will not care for those). This comic takes this to the ridiculous extreme of the weather reporters coming from some other profession where you look into those questions. It shows questions asked by three different people with different backgrounds: {{w|mathematics}}, {{w|linguistics}}, and (in the title text) {{w|software development}}. While some of those questions have actual answers (which you'd expect someone working in that job to know, such as the definition of "scattered showers" and how it's determined, what a "chance of rain" means, and so on), each professional finally ends up with questions that are almost disturbing in how they cannot be answered. (So management ends up calling security to remove those announcers.)

It should be pointed out that hiring someone without any meteorological training to read the weather does not make them an actual meteorologist, no more than say hiring a bricklayer as a doctor would actually make them a real doctor.

===Questions from the pure math meteorologist===

The first meteorologist, [[Cueball]], has a background in pure math. His forecast states that each of the next five hours has a 20% chance of rain. As a mathematician he sees how limited that information is. There is no information about whether or how those {{w|Probability|probabilities}} are {{w|Correlation|correlated}}. This becomes obvious if you ask the question "How likely is it to rain this afternoon" (a question even some non-mathematicians might be interested in). [[Cueball]] states that he does not know (as no one only getting the information about 20% rain in each hour can know). And then lists some scenarios that all fit the the description, but have totally different results for "How likely is it to rain this afternoon?"

The first thing a mathematician would ask (and [[Cueball]] does here) is asking if those 5 events are {{w|Independence (probability theory)|independent}}. Events are independent if the outcome of one of them is unrelated to the outcome out of the others, i.e. knowing whether it rained at 3 pm has no effect on whether it rains at 4 pm, in which case the probability of any rain over the 5 hours is 1 − (1 − 0.2)<sup>5</sup> = 67.2%. (Rain is very seldom independent, as usually having rain in one hour increases the chance to rain in another hour, as systems of rainy weather usually persist for many hours). Another common extreme in probability theory is a set of {{w|Mutual exclusivity|mutually exclusive}} events. In this example that would be the scenario that the chance of rain is 5 × 20% = 100%, but it will only rain in exactly one hour and not rain at all for the other four. (Also possible but quite unlikely). This is what the mathematician was referring to by, "Is rain guaranteed and we're just unsure of the timing?"

In the second panel he continues to discuss what scattered showers means. Like most of the other weather terms in this comic, the term "scattered showers" is one whose technical definition is largely unknown but appears simple enough that most people would assume they understand what it means. "Scattered" refers to when the rain covers roughly 30–50% of the area at a given moment. To somebody who doesn't know this, like the first meteorologist, there's still the very valid question of how likely it is to rain in a specific spot (is it 30–50% of the total probability, or is it more than that because showers move and sweep out a larger area?), and how this is affected by the previous chance of rain. Not to mention, the percentage that defines "scattered showers" implicitly assumes a surface area that is accounted into the percent. Cueball rightly asks clarification on how large the location used to determine "scattered showers" is.

While the all but the last question of the first part of the second panel can be answered by looking up their definitions, the last one is "What if you have two locations you are worried about?" This is an extremely complex question. Because there is no chance at all to answer this question from the answers of the previous questions or even from most other data a forecast might usually produce. To answer this you'd need the raw data from the ensemble forecast in order to specifically look at the correlation between weather at those two locations. Simply looking at the averaged result won't help.

Finally in that panel Cueball begins to explain that he has asked the management about these things, but that they have stopped replying to his e-mails. At this point he spots the security guy coming over, and the screen goes black in to a technical difficulty screen that excuses this behavior to the viewers. It is implied that the security guy came over to force Cueball to leave the set, because he has been fired for confusing the viewers.

Questioning these things on air is likely confusing to the viewers, although they are all valid questions. But this may lose viewers and the news network is afraid of this. The technical difficulty panel further cements this, apologizing for hiring a person with a pure math background. Often seen as one that do not understand how to talk to regular people.

===Questions from the linguist meteorologist===

When they get back on air again a new meteorologist, [[Blondie]], steps in. The management enquires (on air) to make sure she is not also a mathematician. She states no, but tells that she has a linguistics degree, which the management thinks is fine, and thus believes they have prevented the problem with Cueball. However, this proves to be in vain, as Blondie goes into a tangent once more but from a linguistics standpoint, rather than a mathematical one, detailing the true meaning of the word "it" as referring to the weather. After one panel of this the management calls for security again.

While, at the most basic level, human speech is broken into subject, object, and verb; for some reason we are capable of producing and comprehending speech without both objects or verbs, but in English there is a certain "resistance" to speech without a subject. Thus if you are in the passenger seat of a car going down the highway and happened to see some deer in the trees nearby, you could simply say "Deer.", rather than "there is a deer over there", deer being the subject of the sentence. However, if you noticed that it had begun to rain, you could not simply say "Raining." on its own. Feel how that sentence just seems weird? Hence we have developed the tendency to use the filler word "it" despite the fact that when we say "It's raining." the "it" is not a reference to the clouds producing the rain, but the general state of the rainfall around us. (McWhorter, John. Understanding Linguistics: The Science of Language. https://www.thegreatcourses.com/courses/understanding-linguistics-the-science-of-language.html )

The first question is again quite harmless, and both possible answers ("it" being a {{w|dummy pronoun}} or referring to the weather) are valid answers, but the second question is much more disturbing.
In "It's hot out, and getting bigger" the first part of the sentence might be a dummy pronoun or it might reference the weather. But the second part breaks it: With a dummy pronoun "getting bigger" would be the impersonal action, which is not what is meant. It is referencing something (the hotness, that is getting bigger). But if the it references this entity in the second part, by grammatical rules it would also have to reference that in the first part. But "The hotness is hot out" makes no sense at all. (An alternative explanation is that the sentence is referring to the fact that if a dark (so as to absorb light energy from sunlight and convert it to thermal energy) object is placed outside in sunlight, it will heat up and undergo thermal expansion.)
This is again a common occurrence with informal speech: From a grammatical point of view, it is pure non-sense. But it still has meaning people understand. So if you want a proper descriptive grammar, it needs to cope with those cases. But then most such informal sentences would be special cases. (Case in point: What is the grammatical function of the "out" in that sentence?)

===Questions from the software developer meteorologist===

In the title text, the news station has made the same error again, this time by hiring a software developer as the third meteorologist. This last person is stating concerns about the feasibility of the time system used to correlate to the weather patterns. Because it appears simple, many people would simply assume they understand what is being said when a meteorologist talks about "12pm" or "1pm". This is a common mistake because [https://www.nist.gov/pml/time-and-frequency-division/times-day-faqs#noon noon is neither post meridiem (pm) nor ante meridiem], and should be stated as "noon" or "12 noon" instead of "12 pm.". However, because software developers frequently have to deal with things such as specifying exactly what time-label means what, the new meteorologist begins to wonder what time period is actually meant on a per-hour forecast. On such an hour forecast does 12pm refer to the hour from 12 to 1pm, from 11:30 to 12:30 or is it actually only to the weather precisely at 12:00 that is referred to? The software developer also worries about an {{w|off-by-one error}}, which is a common error in software development occurring when boundary conditions include one element too few or too many: when counting by 24 once every set period (for example), it is common to forget whether the count should stop at 23 or at 24, especially if the number 0 (midnight) is included. In the 24-hour forecast, that means there's 25 hours represented every day, and the software developer worries that these 25 hours might add up and, every progressive day, the forecast is one more hour off. (If the news station's meteorology department had been around for a while, worrying about this would be absurd because if the new station tried to predict the weather one hour further into the future each day, it would eventually ask for the weather further into the future than the forecast models could supply, resulting in an error that someone would definitely notice (and it would likely be the case that long before that happened, someone would perceive the weather forecasts as being inaccurate or early). However, based on how quickly the linguist was fired, this was likely either the mathematician's first day or second day on the job, so if we assume that the mathematician was the first meteorologist (or that all previous meteorologists were fired quickly enough that the mathematician started within a few days of when the meteorology department started), there wouldn't have been enough time for the effects of an off-by-one error to stack up enough to be noticed, so the software developer's concern about an off-by-one error would not have been ruled out yet.) In theory these are valid concerns and notably less inane than his predecessors, but they are all things he should have asked ''before'' he went on the air.

===Answering the meteorologists’ questions===

Management would certainly answer the mathematician's questions! The questions themselves have been asked of meteorologists before. The National Weather Service (NWS), a unit of the United States National Oceanic and Atmospheric Administration (NOAA), has published relevant answers for [https://www.weather.gov/ffc/pop probability of precipitation], as well as [https://www.weather.gov/bgm/forecast_terms timing and the meanings of particular forecast words]. The naming is also addressed [https://www.weather.gov/media/ajk/brochures/ConvectivevsStratiform.pdf here].

Regarding probability of precipitation, NOAA forecasts give the probability that it will rain at all at any given point in an area. To rephrase it, it is the probability of rain occurring '''at all''' within a forecast area multiplied by the percentage of area affected by the rain. The "forecast area" is a clearly defined area of land and can be seen in the map of any official NWS forecast. [https://forecast.weather.gov/MapClick.php?lat=34.0732&lon=-118.3963 Here is an example].

Regarding the timing of the forecast, an hourly forecast gives the probability for each particular hour, stretching from the time listed to right before the next hour listed. So, the forecast for noon describes the time period from noon to 1pm. The forecasts for individual hours can be correlated; for this reason, the NOAA generates forecasts that stretch over longer time periods, giving a useful estimate for that time range. Thus, the chance of rain for "Today" specifically means: what is the chance of it raining at any given location during any time between 6am and 6pm?

Regarding phrases like "scattered showers", this specifically means a 25-54% probability of precipitation from convective cloud sources. Other phrases, and when they are used, are detailed in [https://www.weather.gov/media/ajk/brochures/ConvectivevsStratiform.pdf the chart at the end of this PDF].

So, to conclude:

* "How likely is it to rain this afternoon?" We don't know; you need to show the hourly forecast, not the 12 noon to 4pm forecast.
* "Is each hour independent? Correlated?" Hourly values are given for that hour only. They can be correlated, hence why they can't be used to calculate the answer to "How likely is it to rain this afternoon?"
* "Is rain guaranteed and we're just unsure of the timing?" You cannot tell from the data given. It's possible (though unlikely), that this is the case.
* "It says 'scattered showers.' Is this the chance of rain '''somewhere''' in your area?" Yes, it is, and it means the the rain will come from convective cloud sources with a probability of precipitation somewhere between 25 and 54%.
* "How big is your area?" It's detailed in the forecast the mathematician would be reading from.
* "What if you have two locations you're worried about?" Then all chances are off. While the other open questions like "How likely is it to rain this afternoon?" might have an answer management could supply, for this they do not really have any chance at all.
* "Hey, when we say 12pm, does that mean the hour from 12pm to 1pm, or the hour centered on 12pm? Or is it a snapshot at 12:00 exactly?" It means the hour from noon to 12:59pm.
* We have been effectively [[356|nerd-sniped]].

==Transcript==
:[Cueball is presenting a weather forecast while seated with his folded hands resting on a table. A graphic to the left of Cueball shows the weather for five consecutive hours from 12pm to 4pm, each with a rainy cloud icon and the same percentage of 20% written below the icon. The TV channel's logo is shown on the bottom left, with the 4 in a white font inside a black circle.]
:Cueball: Our forecast says there's a 20% chance of rain for each of the next five hours.
:Cueball: How likely is it to rain this afternoon? It's a simple question, but I don't know the answer. Is each hour independent? Correlated? Or is rain guaranteed and we're just unsure of the timing?

:12pm  1pm  2pm  3pm  4pm
:  20%  20%  20%  20%  20% 
:<small>News</small>
:  4
:<small>''Weather''</small>

:[Cueball still sits at the table, but the weather graphic is gone and he looks to the right.]
:Cueball: It says "scattered showers." Is this the chance of rain '''''somewhere''''' in your area? How big is your area? What if you have two locations you're worried about?
:Cueball: I've asked management, but they've stopped answering my emails, so—Hang on, the security guy is coming over.

:[A black screen is shown with white text and two short white lines between each of the three segments of text. The TV logo is shown below the last text, with the white 4 inside a gray circle with a white border.]
:''Technical Difficulties''
:—
:''We apologize for hiring a meteorologist with a pure math background.''
:—
:''We'll be back on the air shortly.''
:
:<big>News</big>
:  <big><big>4</big></big>

:[Blondie now sits at the desk, in the same position as Cueball, but without the graphic. She looks to the right towards a person who speaks to her from outside the panel. This voice is indicated with two square speech bubbles, connected with a double line and with a small arrow pointing to the right off-panel from the top bubble.]
:Blondie: Sorry about that. Hi, I'm your new meteorologist.
:Person off-panel: And you're not a mathematician, right?
:Blondie: No. I do have a linguistics degree.
:Person off-panel: That's fine.

:[Blondie continues in the same position but now looks into the camera at the viewers. The off-panel person only speaks one word, which again is inside a square speech bubble with a small arrow pointing to the right off-panel.]
:Blondie: It might rain this afternoon.
:Blondie: But what is "it" here? Is it a true dummy pronoun, as in the phrase "It's too bad?" Or is the weather an entity?
:Blondie: Also, what if I say, "It's hot out, and getting bigger?"
:Person off-panel: Security!

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Blondie]]
[[Category:News anchor]]
[[Category:Weather]]
[[Category:Statistics]]
[[Category:Language]]
[[Category:Programming]]

1985: Meteorologist

2023-02-17T22:37:33Z

162.158.186.96: Correction

{{comic
| number = 1985
| date = April 25, 2018
| title = Meteorologist
| image = meteorologist.png
| titletext = Hi, I'm your new meteorologist and a former software developer. Hey, when we say 12pm, does that mean the hour from 12pm to 1pm, or the hour centered on 12pm? Or is it a snapshot at 12:00 exactly? Because our 24-hour forecast has midnight at both ends, and I'm worried we have an off-by-one error.
}}

==Explanation==
Although we’re constantly exposed to them, many (most?) people don’t understand the details of how to properly interpret weather forecasts. But even beyond the normal questions, there can be much more complex issues hiding beyond those (though most people will not care for those). This comic takes this to the ridiculous extreme of the weather reporters coming from some other profession where you look into those questions. It shows questions asked by three different people with different backgrounds: {{w|mathematics}}, {{w|linguistics}}, and (in the title text) {{w|software development}}. While some of those questions have actual answers (which you'd expect someone working in that job to know, such as the definition of "scattered showers" and how it's determined, what a "chance of rain" means, and so on), each professional finally ends up with questions that are almost disturbing in how they cannot be answered. (So management ends up calling security to remove those announcers.)

It should be pointed out that hiring someone without any meteorological training to read the weather does not make them an actual meteorologist, no more than say hiring a bricklayer as a doctor would actually make them a real doctor.

===Questions from the pure math meteorologist===

The first meteorologist, [[Cueball]], has a background in pure math. His forecast states that each of the next five hours has a 20% chance of rain. As a mathematician he sees how limited that information is. There is no information about whether or how those {{w|Probability|probabilities}} are {{w|Correlation|correlated}}. This becomes obvious if you ask the question "How likely is it to rain this afternoon" (a question even some non-mathematicians might be interested in). [[Cueball]] states that he does not know (as no one only getting the information about 20% rain in each hour can know). And then lists some scenarios that all fit the the description, but have totally different results for "How likely is it to rain this afternoon?"

The first thing a mathematician would ask (and [[Cueball]] does here) is asking if those 5 events are {{w|Independence (probability theory)|independent}}. Events are independent if the outcome of one of them is unrelated to the outcome out of the others, i.e. knowing whether it rained at 3 pm has no effect on whether it rains at 4 pm, in which case the probability of any rain over the 5 hours is 1 − (1 − 0.2)<sup>5</sup> = 67.2%. (Rain is very seldom independent, as usually having rain in one hour increases the chance to rain in another hour, as systems of rainy weather usually persist for many hours). Another common extreme in probability theory is a set of {{w|Mutual exclusivity|mutually exclusive}} events. In this example that would be the scenario that the chance of rain is 5 × 20% = 100%, but it will only rain in exactly one hour and not rain at all for the other four. (Also possible but quite unlikely). This is what the mathematician was referring to by, "Is rain guaranteed and we're just unsure of the timing?"

In the second panel he continues to discuss what scattered showers means. Like most of the other weather terms in this comic, the term "scattered showers" is one whose technical definition is largely unknown but appears simple enough that most people would assume they understand what it means. "Scattered" refers to when the rain covers roughly 30–50% of the area at a given moment. To somebody who doesn't know this, like the first meteorologist, there's still the very valid question of how likely it is to rain in a specific spot (is it 30–50% of the total probability, or is it more than that because showers move and sweep out a larger area?), and how this is affected by the previous chance of rain. Not to mention, the percentage that defines "scattered showers" implicitly assumes a surface area that is accounted into the percent. Cueball rightly asks clarification on how large the location used to determine "scattered showers" is.

While the all but the last question of the first part of the second panel can be answered by looking up their definitions, the last one is "What if you have two locations you are worried about?" This is an extremely complex question. Because there is no chance at all to answer this question from the answers of the previous questions or even from most other data a forecast might usually produce. To answer this you'd need the raw data from the ensemble forecast in order to specifically look at the correlation between weather at those two locations. Simply looking at the averaged result won't help.

Finally in that panel Cueball begins to explain that he has asked the management about these things, but that they have stopped replying to his e-mails. At this point he spots the security guy coming over, and the screen goes black in to a technical difficulty screen that excuses this behavior to the viewers. It is implied that the security guy came over to force Cueball to leave the set, because he has been fired for confusing the viewers.

Questioning these things on air is likely confusing to the viewers, although they are all valid questions. But this may lose viewers and the news network is afraid of this. The technical difficulty panel further cements this, apologizing for hiring a person with a pure math background. Often seen as one that do not understand how to talk to regular people.

===Questions from the linguist meteorologist===

When they get back on air again a new meteorologist, [[Blondie]], steps in. The management enquires (on air) to make sure she is not also a mathematician. She states no, but tells that she has a linguistics degree, which the management thinks is fine, and thus believes they have prevented the problem with Cueball. However, this proves to be in vain, as Blondie goes into a tangent once more but from a linguistics standpoint, rather than a mathematical one, detailing the true meaning of the word "it" as referring to the weather. After one panel of this the management calls for security again.

While, at the most basic level, human speech is broken into subject, object, and verb; for some reason we are capable of producing and comprehending speech without both objects or verbs, but in English there is a certain "resistance" to speech without a subject. Thus if you are in the passenger seat of a car going down the highway and happened to see some deer in the trees nearby, you could simply say "Deer.", rather than "there is a deer over there", deer being the subject of the sentence. However, if you noticed that it had begun to rain, you could not simply say "Raining." on its own. Feel how that sentence just seems weird? Hence we have developed the tendency to use the filler word "it" despite the fact that when we say "It's raining." the "it" is not a reference to the clouds producing the rain, but the general state of the rainfall around us. (McWhorter, John. Understanding Linguistics: The Science of Language. https://www.thegreatcourses.com/courses/understanding-linguistics-the-science-of-language.html )

The first question is again quite harmless, and both possible answers ("it" being a {{w|dummy pronoun}} or referring to the weather) are valid answers, but the second question is much more disturbing.
In "It's hot out, and getting bigger" the first part of the sentence might be a dummy pronoun or it might reference the weather. But the second part breaks it: With a dummy pronoun "getting bigger" would be the impersonal action, which is not what is meant. It is referencing something (the hotness, that is getting bigger). But if the it references this entity in the second part, by grammatical rules it would also have to reference that in the first part. But "The hotness is hot out" makes no sense at all. (An alternative explanation is that the sentence is referring to the fact that if a dark (so as to absorb light energy from sunlight and convert it to thermal energy) object is placed outside in sunlight, it will heat up and undergo thermal expansion.)
This is again a common occurrence with informal speech: From a grammatical point of view, it is pure non-sense. But it still has meaning people understand. So if you want a proper descriptive grammar, it needs to cope with those cases. But then most such informal sentences would be special cases. (Case in point: What is the grammatical function of the "out" in that sentence?)

===Questions from the software developer meteorologist===

In the title text, the news station has made the same error again, this time by hiring a software developer as the third meteorologist. This last person is stating concerns about the feasibility of the time system used to correlate to the weather patterns. Because it appears simple, many people would simply assume they understand what is being said when a meteorologist talks about "12pm" or "1pm". This is a common mistake because [https://www.nist.gov/pml/time-and-frequency-division/times-day-faqs#noon noon is neither post meridiem (pm) nor ante meridiem], and should be stated as "noon" or "12 noon" instead of "12 pm.". However, because software developers frequently have to deal with things such as specifying exactly what time-label means what, the new meteorologist begins to wonder what time period is actually meant on a per-hour forecast. On such an hour forecast does 12pm refer to the hour from 12 to 1pm, from 11:30 to 12:30 or is it actually only to the weather precisely at 12:00 that is referred to? The software developer also worries about an {{w|off-by-one error}}, which is a common error in software development occurring when boundary conditions include one element too few or too many: when counting by 24 once every set period (for example), it is common to forget whether the count should stop at 23 or at 24, especially if the number 0 (midnight) is included. In the 24-hour forecast, that means there's 25 hours represented every day, and the software developer worries that these 25 hours might add up and, every progressive day, the forecast is one more hour off. (If the news station's meteorology department had been around for a while, worrying about this would be absurd because if the new station tried to predict the weather one hour further into the future each day, it would eventually ask for the weather further into the future than the forecast models could supply, resulting in an error that someone would definitely notice (and it would likely be the case that long before that happened, someone would perceive the weather forecasts as being inaccurate or early). However, based on how quickly the linguist was fired, this was likely either the mathematician's first day or second day on the job, so if we assume that the mathematician was the first meteorologist (or that all previous meteorologists were fired quickly enough that the mathematician started within a few days of when the meteorology department started), there wouldn't have been enough time for the effects of an off-by-one error to stack up enough to be noticed, so the software developer's concern about an off-by-one error would not have been ruled out yet.) In theory these are valid concerns and notably less inane than his predecessors, but they are all things he should have asked ''before'' he went on the air.

===Answering the meteorologists’ questions===

Management would certainly answer the mathematician's questions! The questions themselves have been asked of meteorologists before. The National Weather Service (NWS), a unit of the United States National Oceanic and Atmospheric Administration (NOAA), has published relevant answers for [https://www.weather.gov/ffc/pop probability of precipitation], as well as [https://www.weather.gov/bgm/forecast_terms timing and the meanings of particular forecast words]. The naming is also addressed [https://www.weather.gov/media/ajk/brochures/ConvectivevsStratiform.pdf here].

Regarding probability of precipitation, NOAA forecasts give the probability that it will rain at all at any given point in an area. To rephrase it, it is the probability of rain occurring '''at all''' within a forecast area multiplied by the percentage of area affected by the rain. The "forecast area" is a clearly defined area of land and can be seen in the map of any official NWS forecast. [https://forecast.weather.gov/MapClick.php?lat=34.0732&lon=-118.3963 Here is an example].

Regarding the timing of the forecast, an hourly forecast gives the probability for each particular hour, stretching from the time listed to right before the next hour listed. So, the forecast for noon describes the time period from noon to 1pm. The forecasts for individual hours can be correlated; for this reason, the NOAA generates forecasts that stretch over longer time periods, giving a useful estimate for that time range. Thus, the chance of rain for "Today" specifically means: what is the chance of it raining at any given location during any time between 6am and 6pm?

Regarding phrases like "scattered showers", this specifically means a 25-54% probability of precipitation from convective cloud sources. Other phrases, and when they are used, are detailed in [https://www.weather.gov/media/ajk/brochures/ConvectivevsStratiform.pdf the chart at the end of this PDF].

So, to conclude:

* "How likely is it to rain this afternoon?" We don't know, you need to show the hourly forecast, not the 12 noon to 4pm forecast.
* "Is each hour independent? Correlated?" Hourly values are given for that hour only. They can be correlated, hence why they can't be used to calculate the answer to "How likely is it to rain this afternoon?"
* "Is rain guaranteed and we're just unsure of the timing?" You cannot tell from the data given. It's possible (though unlikely), that this is the case.
* "It says 'scattered showers.' Is this the chance of rain '''somewhere''' in your area?" Yes, it is, and it means the the rain will come from convective cloud sources with a probability of precipitation somewhere between 25 and 54%.
* "How big is your area?" It's detailed in the forecast the mathematician would be reading from.
* "What if you have two locations you're worried about?" Then all chances are off. While the other open questions like "How likely is it to rain this afternoon?" might have an answer management could supply, for this they do not really have any chance at all.
* "Hey, when we say 12pm, does that mean the hour from 12pm to 1pm, or the hour centered on 12pm? Or is it a snapshot at 12:00 exactly?" It means the hour from noon to 12:59pm.
* We have been effectively [[356|nerd-sniped]].

==Transcript==
:[Cueball is presenting a weather forecast while seated with his folded hands resting on a table. A graphic to the left of Cueball shows the weather for five consecutive hours from 12pm to 4pm, each with a rainy cloud icon and the same percentage of 20% written below the icon. The TV channel's logo is shown on the bottom left, with the 4 in a white font inside a black circle.]
:Cueball: Our forecast says there's a 20% chance of rain for each of the next five hours.
:Cueball: How likely is it to rain this afternoon? It's a simple question, but I don't know the answer. Is each hour independent? Correlated? Or is rain guaranteed and we're just unsure of the timing?

:12pm  1pm  2pm  3pm  4pm
:  20%  20%  20%  20%  20% 
:<small>News</small>
:  4
:<small>''Weather''</small>

:[Cueball still sits at the table, but the weather graphic is gone and he looks to the right.]
:Cueball: It says "scattered showers." Is this the chance of rain '''''somewhere''''' in your area? How big is your area? What if you have two locations you're worried about?
:Cueball: I've asked management, but they've stopped answering my emails, so—Hang on, the security guy is coming over.

:[A black screen is shown with white text and two short white lines between each of the three segments of text. The TV logo is shown below the last text, with the white 4 inside a gray circle with a white border.]
:''Technical Difficulties''
:—
:''We apologize for hiring a meteorologist with a pure math background.''
:—
:''We'll be back on the air shortly.''
:
:<big>News</big>
:  <big><big>4</big></big>

:[Blondie now sits at the desk, in the same position as Cueball, but without the graphic. She looks to the right towards a person who speaks to her from outside the panel. This voice is indicated with two square speech bubbles, connected with a double line and with a small arrow pointing to the right off-panel from the top bubble.]
:Blondie: Sorry about that. Hi, I'm your new meteorologist.
:Person off-panel: And you're not a mathematician, right?
:Blondie: No. I do have a linguistics degree.
:Person off-panel: That's fine.

:[Blondie continues in the same position but now looks into the camera at the viewers. The off-panel person only speaks one word, which again is inside a square speech bubble with a small arrow pointing to the right off-panel.]
:Blondie: It might rain this afternoon.
:Blondie: But what is "it" here? Is it a true dummy pronoun, as in the phrase "It's too bad?" Or is the weather an entity?
:Blondie: Also, what if I say, "It's hot out, and getting bigger?"
:Person off-panel: Security!

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Blondie]]
[[Category:News anchor]]
[[Category:Weather]]
[[Category:Statistics]]
[[Category:Language]]
[[Category:Programming]]

2734: Electron Color

2023-02-06T23:37:47Z

162.158.186.96: /* Explanation */ brief explanation of title text

{{comic
| number = 2734
| date = February 6, 2023
| title = Electron Color
| image = electron_color_2x.png
| imagesize = 568x256px
| noexpand = true
| titletext = There's quark color, but that's not really color--it's just an admission by 20th century physicists that numbers are boring.
}}

==Explanation==

{{incomplete|Created by A SUPERINTELLIGENT SHADE OF THE COLOUR BLUE - Do NOT delete this tag too soon.}}

On many scientific diagrams of atoms, the subatomic particles have assigned colours. Neutrons are generally red, green, or gray; protons red or green; and electrons yellow. Miss Lenhart, in Panel 2, states that, unlike the diagrams, which are coloured for convenience, the particles are not coloured. However, in Panel 3, she jokingly (or genuinely, the people have no facial expressions) says that electrons are yellow. Protons and neutrons are red or gray, so when, in Panel 3, Offpanel Voice 2 says that protons are red, O.V. 3 says they are gray, prompting an argument. In the mouseover text, Randall is referring to quark names; namely, Red, Blue, Green, Antired, Antiblue, and Antigreen. These are, as he says, not colours, but charges of quarks, which were coined by 20th century physicists, along with the 'flavours', to identify quarks. These names were more convenient than referring to quarks by their charges and spins, or, as Randall puts it, 'an admission [...] that numbers are boring'.

The title text refers to the {{w|Color charge}} property of quarks, a property which is part of {{w|quantum chromodynamics}}. As mentioned by Randall, these have nothing to do with color as we know it, but is just a way to represent interactions between quarks.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[Miss Lenhart teaching a class. Science Girl and Hairy sit at their desks.]
:Miss Lenhart: You have a question?
:Hairy: Yeah - what color are electrons and protons? Are they yellow? Red? Blue?

:[Zoom in on Miss Lenhart.]
:Miss Lenhart: Subatomic particles don't have a color.
:Miss Lenhart: They're too small to interact with visible light, so "color" isn't even defined for them.

:[Panel of just Miss Lenhart.]
:Miss Lenhart: That said, electrons are ''definitely'' yellow.
:Offpanel voice 1: I knew it!
:Offpanel voice 2: And protons are red, right?
:Offpanel voice 3: ''What?'' No! They're gray!

{{comic discussion}}

[[Category:Comics featuring Miss Lenhart]]
[[Category:Comics featuring Science Girl]]
[[Category:Comics featuring Hairy]]
[[Category:Chemistry]]
[[Category:Physics]]

2734: Electron Color

2023-02-06T23:33:57Z

162.158.186.96: /* Transcript */ chemistrry

2299: Coronavirus Genome 2

2020-04-28T19:03:53Z

162.158.186.96: /* Explanation */

{{comic
| number = 2299
| date = April 27, 2020
| title = Coronavirus Genome 2
| image = coronavirus_genome_2.png
| titletext = [moments later, checking phone] Okay, I agree my posting it was weird, but it's somehow even more unnerving that you immediately liked the post.
}}

==Explanation==
{{incomplete|Created by a SANITIZED PHONE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.

It is also a direct continuation of the previous comic, [[2298: Coronavirus Genome]], making this a [[:Category:Coronavirus Genome|new series]].

[[Megan]] sent her copy of the coronavirus genome to [[Cueball]], who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the Internet, though not in a form that can actually make people sick with COVID-19 (which may seem obvious, but then some people [https://www.forbes.com/sites/brucelee/2020/04/09/5g-networks-and-covid-19-coronavirus-here-are-the-latest-conspiracy-theories/ believe 5G causes coronavirus].) If his post catches on and is widely shared, it might be described as "going viral".

In continuation of the previous strip, Cueball appears to be fascinated by the fact that the entire genome of this very consequential virus can be fully detailed in a text file, using only 30,000 characters. He he realizes that he can't fit this much information in a single tweet (Twitter has a 280 character limit), but it able to fit the entire genome in a Facebook post (Facebook allows up to 63,206 characters in a post).

This strip draws humor from the contrast between the costly physical precautions that are being taken to prevent the spread of coronavirus between people and the blitheness with which Cueball attempts to share (the genome of) the coronavirus electronically. Cueball's response (that it's okay, because he sanitized his phone before posting) could be taken as a sarcastic rebuttal, given that Megan sent the genome to him without knowing why he wanted it, or a commentary on the useless or counterproductive behaviors of clueless people (e.g. people who wear gloves before touching potentially-contaminated surfaces, but then scratch their noses while still wearing the possibly-contaminated gloves).

The title text deals with the almost inevitable outcome of the resulting message being 'liked' by some other party. In this case Megan, although she just told Cueball it was weird that he shared it. This may be a commentary on the common reflex to "like" your friend's posts, even if you think they're strange. Alternately, the "like" button on Facebook was historically the only way to signal a reaction to a post (other than actually commenting). When someone posted about a bad event, such as an injustice, a tragedy, or a difficult personal event, people might "like" the post to indicate their support of the person posting it, but it could read as having positive feelings toward the incident itself. (Facebook has since added multiple reaction buttons so express such emotions as surprise, sadness or anger). In this case, Megan "like"ing the coronavirus genome could be taken to mean that she likes the virus itself, which would be quite odd.

==Transcript==
:[Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.]
:Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?
:Megan: Sure.
:Megan: ...Why?

:[Megan has turned to her her laptop typing on it, Cueball is off-panel.]
:Cueball (off-panel): Nothing.
:Megan: I ... see.
:Megan: Well, here you go.
:Laptop: Click

:[In "two" frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square "speech bubble" with a "speech line" going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.]
:Phone:
::GAAAGGTAAGATGGAGAGGCCTTGTC
:<div style="background-color:red; padding:5px; width:fit-content; margin-left: 2em">CCTGGTTCAACGAGAA</div>
::<font color="red">-29,602</font> <font color="cyan">(+)</font>
:<div style="background-color:cyan; padding:5px; width:fit-content; margin-left: 2em"><font color="white">Tweet</font></div>

:[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]
:Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post.
:Megan: Unsettling that your first instinct is "share it online."
:Cueball: It's cool, I sanitized my phone before posting.

{{comic discussion}}

[[Category:Comics with color]]
[[Category:Coronavirus Genome]]
[[Category:Comics sharing name|Coronavirus Genome]]
[[Category:COVID-19]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Biology]]
[[Category:Social networking]]

Syndication

2020-02-05T13:45:43Z

162.158.186.96: /* Explanation */

{{comic
| date = April 1, 2007
| title = Syndication
| image = syndication.jpg
| ldomain = imgs
| lappend = comics/xkcd_ufs.jpg
| titletext = Complaints should be directed to the xkcd writing staff.
| before = Now that xkcd is carried by United Features Syndicate, there are going to be a few changes to the comic. Obviously, with the rights signed over, it will no longer be published under Creative Commons, and all previous strips will be retroactively un-CC'd and relicensed under UFS terms. All online content will be protected via proprietary DRM. I also recieved a letter outlining topics and content that would be off-limits in the new xkcd. Prohibited content includes:

- Cultural references that would be lost on the average newspaper reader

- Mathematics above the high-school level

- Obscure scientific subjects

- Overt sexual material

- Objectionable words such as fuck, shit, cunt, ass, tits, cock, scrotum, bitch, Belgium, pussy, or twat

- Same-sex relationships

- Star Wars

- Star Trek (Original Series and Enterprise)

- The home phone numbers of White House employees

- Bacon-based currencies

- Erotic use of flywheels

- ExposÃ©s regarding other United Features syndicated characters

- ExposÃ©s regarding the personal lives of United Features Syndicate executives, specifically including CEO Kenneth Lowe

- Teledildonics

- Portrayals of Johnny Cash as an Amway distributor

- Any story that ends with "and that's how my penis got the nickname 'grappling hook'."

- Computer-computer cybersex

- Swordfights between white people

- Bitch & Animal

- Sexualization of Mt. Rushmore

- Staplers as mÃ©lÃ©e weapons

- Road trip buddy comedies starring Tank Girl and William Howard Taft

- Eric S. Raymond performing in Cirque du Soleil

- Hats with buckles

- Licking of nipples atop a moving train

The internet is the past. Newspapers are the future! See you in the funny papers.
}}

==Explanation==
{{incomplete|Created by an EROTIC FLYWHEEL. Needs a list explaining all the changes required. Do NOT delete this tag too soon.}}

This is a non-numbered [[:Category:April fools' comics|April fools' comic]], and is the first April fools' joke preformed on xkcd. This comic, formatted similarly to other posts such as [[Blue Eyes]]. The post describes xkcd becoming syndicated into a newspaper, changing from a webcomic. Newspapers are notorious for censorship of content, and Randal describes all the changes that would be required of the comic, the humor coming from their progressive absurdity.

==List of Changes proposed by Randell==

{| border =1 width=100% cellpadding=5 class="wikitable"
! # !! Change !! Explanation !!
|-
! 1
| '''Cultural References that would be lost on the average newspaper reader'''
|This proposal was made because the average newspaper reader is not likely to know obscure or niche references to certain works of art or media.
|-
! 2
| '''Mathematics above the high-school level'''
|This proposal was made because to the average reader, they are likely to not remember much about Collage level mathematics.
|-
! 3
| '''Obscure scientific subjects'''
|It is not likely for most people who read a newspaper to understand {{w|Quantum Mechanics}}, or {{w|Particle Physics}}.
|-
! 4
| '''Overt sexual material'''
|Such content is not likely to be received well by newspaper readers, especially if they are looking at the paper with others around.
|-
! 5
| '''Objectionable words such as {{w|fuck}}, {{w|shit}}, {{w|cunt}}, {{w|ass}}, {{w|tits}}, {{w|cock}}, {{w|scrotum}}, {{w|bitch}}, {{w|Belgium}}, {{w|pussy}}, or {{w|twat}}'''
|{{w|Profanity}}'s, as they are known, are a group of words that are meant as either a form of insult, or as a response to certain situations like pain. The word doesn't necessarily have to be part of the profanity group, but can still be offensive if used out of context. It is noted that Belgium ended up in this list for unknown reasons, though it is likely that it was done out of humor.

==Transcript==
:[A Cueball and his Cueball-like friend are standing in some sort of grassy area.]
:Cueball: Why did the computer cross the road?
:Friend: I don't know.

:Cueball: I don't know either! Computers are so complicated!
:Friend: LOL!

:Editor's note: "LOL" is an online acronym for "laughing out loud." It alerts you to something funny, so keep an eye out!

{{comic discussion}}

[[Category:April fools' comics]]
[[Category:Comics featuring Cueball]]
[[Category:Comics_with_color]]
[[Category:Extra_comics]]
[[Category:Multiple Cueballs]]

2245: Edible Arrangements

2020-01-29T20:41:23Z

162.158.186.96: /* Explanation */

{{comic
| number = 2245
| date = December 23, 2019
| title = Edible Arrangements
| image = edible_arrangements.png
| titletext = Any arrangement is an edible arrangement if you're hungry enough.
}}

==Explanation==
This is the first of two comics in a row about presents, and it is also the last comic released before {{w|Christmas Day}}. This is the first [[:Category:Christmas|Christmas comic]] of 2019, with [[2246: Christmas Presents]] being the second Christmas comic, released on Christmas Day.

{{w|Edible Arrangements}} is a company that sells fruit, and other edible items that have been cut and arranged to look like flower bouquets. They can be ordered and sent to a given recipient for a variety of purposes. Flower arrangements are typically not eaten, as showy flowers are so economically inefficient to mass produce that modern culture has forgotten they are edible.{{fact}}

In the first panel, [[Cueball]] seems to find the concept incongruous, and wonders how it came about. [[Megan]] points out the easy answer: picking out a gift for someone can be difficult, but a tasteful meal is always welcome so long as it's something the recipient can eat safely, and the visual appearance of an edible arrangement offers further appeal.

Shortly afterwards, Megan uses the same incongruity of eating a floral arrangement to make puns. '''Vore of the Roses''' is a play on the '''War of the Roses''', either the {{w|Wars of the Roses|English civil war}} or the 1989 [[imdb:tt0098621|movie]] of the same name. 'Vore' is a word part referring to eating, as in carnivore (meat eater), herbivore (plant eater), voracious (hungry or eating a lot), etc.

Cueball is probably in pain because of the bad pun and says he will cancel the edible arrangement that he had bought for Megan. She tries to convince him otherwise by providing alternative names, which are evidently not any more to his liking, since he has left Megan before she finishing all her suggestions.

Mouth Blossoms, Juicy Bouquet, and Oral Floral are all combinations referencing the eating of a floral arrangement. In theory, these combinations could be good names for a band, [[1025: Tumblr|or possibly a tumblr blog.]]

The title text also makes reference to the fact that many flowers that are often found in floral arrangements, such as roses, violets, tulips, daisies, lavender and many more, are items that a human can eat. Such flowers are safe to consume but usually unappetizing; Randall makes the point that if a person is sufficiently hungry and thus doesn't care how appetizing their meal is, any floral arrangement can be eaten. Since he doesn't use flower in the title text, he actually says that if you are hungry enough anything can be eaten. The title text may also be an allusion to a Mitch Hedberg joke: "Any book is a children's book if the kid can read!"

==Transcript==
:[Cueball and Megan are sitting on opposite sides of a leafless tree. They are silhouetted.]
:Cueball: I don't get how Edible Arrangements is a thing.

:[Zoomed in on Cueball and Megan leaning against the tree]
:Megan: That's easy — picking out presents is hard and fruit is delicious.
:Cueball: Yeah, true.

:[Megan gestures with an open hand]
:Megan: But my question is, why did they call it "Edible Arrangements" and not "Vore of the Roses"?

:[Pan to just Megan. Megan turns to face Cueball]
:Cueball: Just for that, I'm going to cancel the one I got you.
:Megan: Nooo! I want my Mouth Blossoms!
:Megan: My Juicy Bouquet! My Oral Floral!
:Megan: Hey, come back!

{{comic discussion}}

[[Category:Christmas]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Food]]
[[Category:Sex]]
[[Category:Furries]]

2253: Star Wars Voyager 1

2020-01-10T05:51:09Z

162.158.186.96: Remove ridiculous vandalization. Mildly humorous, but mostly you're a troll.

{{comic
| number = 2253
| date = January 10, 2020
| title = Star Wars Voyager 1
| image = star_wars_voyager_1.png
| titletext = There's some flexibility depending on your standards for measuring runtime and the various special editions. If you still want to have a party, I'm sure you can find some combination that works.
}}

==Explanation==
{{incomplete|Created by a BOT. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

{{comic discussion}}

2209: Fresh Pears

2019-09-30T20:21:51Z

162.158.186.96: /* Transcript */

{{comic
| number = 2209
| date = September 30, 2019
| title = Fresh Pears
| image = fresh_pears.png
| titletext = I want to sell apples but I'm still working on getting the machine to do the cutting and grafting.
}}

==Explanation==
{{incomplete|Created by a VENDING MACHINE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}
Megan tries to purchase fresh pears from a vending machine. She asks Beret guy, presumably the creator of said machine why it's not working. He explains that it just takes a while to work. To the left we see the machine dispensing a seed into the dirt. Above it is a robotic arm and a hopper for collecting and dispensing the ripened pears. The term "a while" is ambiguous, but in the context of waiting for a vending machine to dispense food, it's usually assumed to be a matter of seconds. Beret Guy, in his usually surrealist approach, seems to consider it reasonable to wait at a machine years for a tree to sprout, grow to maturity and begin bearing fruit. While such a pear would indeed be "fresh", it's implausible that anyone would accept that kind of lag time in buying a pear, particularly considering that any number of factors could interfere with the production of pears in the meantime.

The title text refers to the increased difficult in cultivating desirable apples, as compared to other fruits. Apples cannot be reliably produced from seeds, seedlings often don't survive, and even when they do, they don't generally reflect the characteristics of the parent plant. As a result, apple orchards are created by grafting tissue from desirable trees onto suitable rootstock. This process is more complex and labor-intensive than simply planting seeds. The joke, then, is that the next planned version of the machine would not only require the user to wait years, but would also involve as-yet unavailable technology to automatically perform the grafting process as to create an apple tree that produces desirable fruit.

==Transcript==
[Megan rattles a machine that is supposed to dispense fresh pears]
:Machine: [Plants a pear seed]
:Megan: I put in my quarters. Is the machine broken?
:Beret Guy: It just takes a while to work.

{{comic discussion}}
[[Category:Comics featuring Beret Guy]]
[[Category:Comics featuring Megan]]
[[Category:Beret Guy's Business]]
[[Category: Food]]

Talk:1451: Background Screens

2019-09-24T03:01:09Z

162.158.186.96:

"contain irrelevant or irreverent jokes" [[Special:Contributions/108.162.249.231|108.162.249.231]] 06:30, 24 November 2014 (UTC)

This sounds like it could be a reference to ''Independence Day'' specifically, but I'm not sure if a map is shown with Greenland specifically in that film. Anyone feel like skimming through it? [[Special:Contributions/108.162.215.169|108.162.215.169]] 09:10, 24 November 2014 (UTC)

Probably worth pointing out that this relies on being at home where you can pause the film to study the image, which doesn't often happen in a cinema. --[[Special:Contributions/141.101.99.50|141.101.99.50]] 11:02, 24 November 2014 (UTC)

It sometimes happens in a cinema, though! :p - fixed the "irrelevent or irrelevent" line. This does seem like common practice, though: I too pay attention to what is shown on screens in the background of movies, just to catch odd things. I'm sure plenty of people do this?? [[User:Maplestrip|Maplestrip]] ([[User talk:Maplestrip|talk]]) 12:12, 24 November 2014 (UTC)

lol I look at the screens and try to actually read the texts. Mostly won't success but it's really fun to do [[Special:Contributions/173.245.48.134|173.245.48.134]]

See also: [http://moviecode.tumblr.com/ Source Code in TV and Films]. --[[Special:Contributions/141.101.104.45|141.101.104.45]] 18:06, 24 November 2014 (UTC)

What memes? [[User:Smperron|Smperron]] ([[User talk:Smperron|talk]]) 19:33, 24 November 2014 (UTC)

Sometimes, of course, background screens show something that's a {{w|Chekhov's gun}}. (If you really have nothing to do for a few hours, after reading the Wiki article wander over to TVTropes and also enquire about Chekhov's Gunsmith, etc...) Although as an inveterate "ha! that's just DOS DEBUG scrolling away, feigning being an Enemy Code Transmission'"-person, myself, I think I might visit that Source Code in TV and Films link myself, when I've got more time... ;) [[Special:Contributions/141.101.98.247|141.101.98.247]] 21:41, 24 November 2014 (UTC)

You guys sure it isn't a reference to "The edge of tomorrow" scene where the general has a map of europe behind him? That map had some innacuracies (like brazilians instead of portuguese), though i'm not sure if the aliens were shown in greenland... {{unsigned ip|108.162.254.42}}

Star Trek during the Okuda era had all kinds of throwaway jokes and continuity references in its background screens (e.g., the two-plane periodic table that's used to explain dilithium has a bunch of Three Stooges references).

Doctor Who in the past few years has sometimes put carefully tailored continuity nods into its background screens specifically to troll the fans. As soon as someone discovers something, Moffat tweets that it means nothing and was just created by the graphics team at the last second. Since the last part is clearly not being true, everyone assumes the first part isn't true either, so that scene proves that one of the things that a 1991 novel claims was covered up is actually known to mainstream news organizations, and therefore that other novel that implies another layer of disinformation within UNIT has been confirmed on TV. [[Special:Contributions/162.158.255.52|162.158.255.52]] 11:54, 25 September 2015 (UTC)

It may be worthy of note that the 2016 film "Arrival" (released 2 years after this comic) does, in fact, feature one of the alien ships landing in Greenland for no apparent reason, and we first find this out by way of a (fairly prominent) background map. I can't find anything suggesting it's a deliberate xkcd reference, but... [[Special:Contributions/162.158.154.157|162.158.154.157]] 07:09, 4 September 2017 (UTC)

I think it's at least a partial reference to how many common map projections grossly exaggerate the size of Greenland. [[Special:Contributions/162.158.186.96|162.158.186.96]] 03:01, 24 September 2019 (UTC)