explain xkcd - User contributions [en]

2298: Coronavirus Genome

2020-04-26T18:37:43Z

162.158.74.29: /* Explanation */

{{comic
| number = 2298
| date = April 24, 2020
| title = Coronavirus Genome
| image = coronavirus_genome.png
| titletext = Spellcheck has been great, but whoever figures out how to get grammar check to work is guaranteed a Nobel.
}}

==Explanation==
{{incomplete|Created by a NOBEL IN SPELLCHECKING. Do NOT delete this tag too soon.}}
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.

[[Megan]] is a {{w|Genetics|geneticist}} doing research on the SARS-CoV-2 virus. She is analyzing the virus's {{w|genome}}, its genetic material composed of {{w|RNA}}. The genomic sequence can be represented as a list of {{w|nucleotide}} bases ({{w|guanine}}, {{w|adenine}}, {{w|cytosine}}, {{w|thymine}} and {{w|uracil}} - often abbreviated as G, A, C, T, and U).

The nucleotide sequence displayed is a 100% match to six SARS-CoV-2 sequences in public databases, all of them originating from the East Coast of the United States. The sequence is from nucleotides 26202-26280 of the virus genome and overlaps an unknown open reading frame/gene named ORF3a. One of the matching sequences is [https://www.ebi.ac.uk/ena/data/view/MT344963]. However, SARS-CoV-2 is an RNA-virus, and so its genetic material (not containing any DNA) would not include thymine (T) but would use uracil (U) instead. The sequence has been altered to resemble the more familiar codes of DNA.

[[Cueball]] is surprised that Megan and her colleagues actually use {{w|Microsoft Notepad}}, a simple {{w|text editor}}, to look at the genome, instead of more modern technology. She explains that better research institutions use {{w|Microsoft Word}}, a more advanced editor, to allow additional formatting (such as '''bolding''' and ''italics''), and humorously calls this "{{w|epigenetics}}". In the real world, epigenetics is the study of changes that are not caused by changes in nucleotides, but by other chemical modifications to DNA and chromosomes that cause changes in patterns of gene expression and activation, often many generations down. This might be considered analogous to altering the meaning of a text by changing its formatting rather than the content; for example, content can be moved into parentheses or footnotes to be de-emphasized, or rendered in boldface or enlarged to attract attention and emphasize key points. Much as text can be wrapped in HTML tags or similar markup to change its formatting, nucleotides can be {{w|DNA methylation|methylated}} to prevent transcription, and the {{w|histone}}s around which DNA is wound can also be modified to promote or repress gene expression.

The real punchline comes when Megan uses {{w|Spell checker|spellcheck}} to detect mutations in the genome by adding the previous genome to spellcheck and comparing them. Overall, Megan uses ridiculously and humorously crude methods to analyze a major genetic item. The genome of SARS-CoV-2 is almost 30,000 base-pairs long, which exceeds the {{w|longest words}} of any natural language by two orders of magnitude (the longest words ever used in literature -- i.e. not constructed in isolation simply for the purpose of being a long word, or chemical formulas -- approach 200 letters), and may exceed the capabilities of any available spell-checking program. Furthermore, a spellcheck program underlines the whole word if a single letter is wrong and not just the letter itself. Thus, it would not be able to highlight individual mutated base pairs. Megan might be better served by using a {{w|diff}} tool, but most scientists are generally not experienced computer programmers or system administrators, and often do use mainstream tools to do tasks that could be done much more efficiently in a more esoteric way.

The title text mentions {{w|Grammar checker|grammar checking}} and claims that whoever discovers how to use that to compare genomic material should be awarded a {{w|Nobel Prize}}. Spell-checking is analogous to comparing sequences against ones previously known, an activity which is the bread and butter of bioinformatics nowadays. Grammar checking would be analogous to having some sort of sense as to how well all the sequences generally cooperate and interact to create possibly viable functionality in an organism, something we are unable to do at the moment except in very limited ways and only in a few simple cases. It may also be a snarky commentary on the untrustworthy nature of grammar-check programs in general, which often follow grammatical rules far more strictly than is practical, especially in English (whose grammatical rules are numerous and often contradictory); it's not uncommon for an author to follow a grammar-check recommended correction only to find the corrected portion is now part of a longer portion that the checker deems "incorrect".

The comic might also be a reference to {{w|Luc Montagnier}}, who share Nobel prize for the identification of the HIV with {{w|Françoise Barré-Sinoussi}}. Since the award he has been busy doing realy bad sience.
He recently produce a study about finding similar realy small chain of amino acids, from 6 to 8 amino acids, in both HIV-1 and 2019-nCoV. Then conclude that 2019-nCoV have been modify by human hand. Multiple studies have been produce to deny that claim.[https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1.full.pdf]

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.]
:Cueball (off-screen): So that's the coronavirus genome, huh?
:Megan: It is!
:Laptop: TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA

:[Cueball walks up and stands behind Megan, still working on the laptop.]
:Cueball: It's weird that you can just look at it in a text editor.
:Megan: It's essential!
:Megan: We geneticists do most of our work in Notepad.

:[A frameless panel, Cueball still standing behind Megan.]
:Cueball: Notepad?
:Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic.
:Cueball: Ah, okay.
:Megan: That extra formatting is called "epigenetics".

:[A regular panel, Cueball still stands behind Megan. He has his hand on his chin.]
:Cueball: Hey, why does that one have a red underline?
:Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations.
:Cueball: ''Clever!''

{{comic discussion}}
[[Category: Comics featuring Cueball]]
[[Category: Comics featuring Megan]]
[[Category: Biology]]
[[Category:COVID-19]]

1762: Moving Boxes

2016-11-22T03:38:49Z

162.158.74.29: /* Explanation of boxes */ Added possible label puns for containers of the listed items.

{{comic
| number = 1762
| date = November 21, 2016
| title = Moving Boxes
| image = moving_boxes.png
| titletext = Later, when I remember that I'm calling movers, I frantically scribble over the labels and write 'NORMAL HOUSE STUFF' on all of them, which actually makes things worse.
}}

==Explanation==
{{incomplete|Fill table}}
[[Randall]] talks about moving boxes and not labeling them until he forgets what's in them. Since he doesn't know what's in them, he writes silly things on the boxes as a joke. Some things are unusual/unlikely (e.g. sand, hydrants, peat) and some are abstract/impossible (e.g. elves, taupe, dark matter). Several of the categories overlap confusingly; for instance, "sand" and "silt" and "dark matter" are all generally considered as "particles"; "membranes", "edges", and "shawls" are all kinds of "manifolds"; "hooves" are part of "bison"; "fog" contains "water"; and "triangles" consist of three "edges". Another way to interpret this comic is that Randall actually has these items (or at least some of them) in the boxes and has simply forgotten which boxes contain what.

===Explanation of boxes===
{| class="wikitable" width="100%"
!Label
!Explanation
|-
!Box 1
|-
|Grids|| [https://en.wiktionary.org/wiki/grid Grids] are mathematical drawings; they would be constructed by drawing them, not stored in a box (though {{w|graph paper}} might be). May refer to a classic {{w|snipe hunt}} where a hazing victim is tasked with finding "a box of grid squares".
|-
|Bison||{{w|Bison}}, sometimes mistakenly called buffalo, are large animals{{Citation needed}} that would probably not fit in the box{{Citation needed}}.
|-
|Checkerboards||The tabletop gaming boards on which one plays {{w|English draughts|Checkers}}.
|-
|Fog||{{w|Fog}} is essentially low-lying clouds which, being gaseous, are hard to box using only cardboard.
|-
!Box 2
|-
|Beacons||A device designed to draw attention to itself, for various reasons. From the generic term "beacon" this could mean anything from electronic GPS locator beacons to miniature replicas of naval lighthouses.
|-
|Elves||A fictional race (or rather, [http://tvtropes.org/pmwiki/pmwiki.php/Main/OurElvesAreBetter many, many fictional races]) of human-like magical creatures.
|-
|Sand||Fine particles of rock. While it's not unheard of for people to need to store sand, it's usually not stored along with your personal belongings on moving day.
|-
!Box 3 - Blood
|-
|Hemoglobin||{{w|Hemoglobin}} is the protein found in red blood cells that carries oxygen around the body. This may be a solution of hemoglobin protein, but one human generally would not need a full box of it{{Citation needed}}.
|-
!Box 4
|-
|Water||As with sand, it's not unheard of for, say, a laboratory to store water samples for testing. But again, these wouldn't be stored along with your personal belongings on moving day. And if this is meant to be drinking water, it would be a waste of effort; it's taken as read that any house you're moving into has its own plumbing.
|-
|Hooves||{{w|Hooves}} are possibly best-known as horse and cow 'feet'. This could also be read as a compound word, Water-Hooves akin to water-wings.
|-
!Box 5 - {{w|Charadriiformes|Charadriiformes}}
|-
|Shorebirds|| Also known as {{w|Wader|Waders}}, an order of birds that wade in littoral waters.
|-
!Box 6 - Vector Space?
|-
|Oil|| This could mean anything from cooking oil to petroleum; either way, having a third of a box full of oil bottles is unusual, but for different reasons.
|-
|Vectors||{{w|Vector}}s are points on geometric shapes, not physical objects, so they cannot be put in boxes.
|-
|Silt|| Material between sand and clay size-wise. A sediment. See sand and water above for why this is unusual. Randall has a special place in his heart for rock particles of various sizes; see https://what-if.xkcd.com/83/.
|-
!Box 7
|-
|Membranes||Delicate thin pliable sheet or skin of various kinds. Usually fragile or cut easily. Not something you would expect to be packed with something sharp, which shards are likely to be, although these labels are incorrect.
|-
|Shards||Broken pieces of smooth and hard objects, e.g. ceramic, glass, crystal. Something you would normally expect to be thrown out, rather than packed up for moving house.
|-
!Box 8
|-
|Shawls||{{w|Shawls}} are a simple item of clothing, worn loosely over one's shoulders. Also being of rectangular shape, they are supposed to be worn in colder weather.
|-
|Glucose||{{w|Glucose}} is possibly best-known as the sugar plants produce for energy, but can be manufactured.
|-
|Kits||A {{w|kit}} is any set of tools, supplies, and/or instructions for a specific purpose. These could be first aid kits, software development kits, bomb-making kits, sewing kits... Alternatively, this may be a compound word "Glucose Kits", diabetic assay tools to help the patient regulate their blood sugar.
|-
!Box 9
|-
|Hydrants||{{w|Fire hydrant}}s are likely too big to fit in boxes, and are also simply odd objects to be packing into a box.
|-
|Particles||As almost all matter is composed of {{w|particles}}, it is hard to find exceptions. Thus, this is very vague.
|-
|Knots||{{w|Knot}}s are things tied in ropes; they can hold things or just be there. This would be hard to put in a box without rope{{Citation needed}}.
|-
!Box 10 - Palette
|-
|Graphite||{{w|Graphite}} is a material made of carbon that is found in sheets.
|-
|Taupe|| {{w|Taupe}} is a dark tan color in between brown and gray, again, not an object.
|-
!Box 11 - Gaussian surface?
|-
|Field Lines||This could refer to {{w|field line}}s as used to depict electromagnetic fields, or possibly to the lines painted on an athletic field to mark the boundaries of play. The former are a visualization tool rather than physical objects; the latter consist of streaks of paint on grass or artificial turf, and thus neither kind of field line is the kind of physical object that could be packed into a box.
|-
!Box 12
|-
|Traps||May be a reference to 'My house is full of traps' from [https://what-if.xkcd.com/34// What-If #34]
|-
!Box 13
|-
|Edges||{{w|Edge_(geometry)|Edge}} is a line segment joining two vertices. Even though physical objects do have edges, you cannot store edges themselves as they are just mathematical constructs.
|-
|Tribes||{{w|Tribe}} is a social group of people, tribes existed before states were formed. It is impossible to store a group of people in the box{{Citation needed}}.
|-
|Dough||{{w|Dough}} is a thick, malleable, sometimes elastic, paste made out of any grains, leguminous or chestnut crops. It is used in the process of cooking, but it doesn't make sense to pack it while moving.
|-
!Box 14
|-
|Dark Matter||{{w|Dark matter}} is what scientist believe to be a big part of the mass of galaxies, but we have never observed it, so it is not possible to pack it.
|-
!Box 15
|-
|Manifolds||Manifolds are akin to {{w|topological}} {{w|universe}}s. Yet another mathematical construct which is impossible to pack into a box.
|-
!Box 16
|-
|Triangles||Within the context of this comic, the reference is likely to the shape. On the other hand, it would not be unusual to pack one or more {{w|Triangle (musical instrument)}}s into a box.
|-
|Peat|| {{w|Peat}}is an accumulation of partially decayed vegetation that forms in wetland bogs, moors, mires, and swamps.
|-
|Crowns|| May be royal crowns, or may be the coin worth five shillings in UK pre-decimal currency.
|-
!Box 17
|-
|Scrolls||A {{w|scroll}} is a roll of papyrus, paper, or parchment that contains writing.
|}

According to the title text, when Randall remembers that he is calling movers, he frantically scribbles "Normal House Stuff" on all the boxes. He says this makes the situation worse, possibly because the movers see the scribble and become suspicious. Alternatively, labeling every box with the exact same phrase will make it even harder to figure out what they contain and where they should go in the new dwelling.

==Transcript==
[A bunch of cardboard boxes stacked up, each labeled]
{| class="wikitable"
| style="visibility:hidden" |
| colspan="2" height="80px" width="80px" |
Grids 
Bison 
Checkerboards 
Fog
| colspan="2" width="80px" height="80px"|
Beacons 
Elves 
Sand
| colspan="2" width="80px" height="80px" |
Hemoglobin
| colspan="2" width="80px" height="80px" |
Water 
Hooves
| style="visibility:hidden" |
|-|
| style="visibility:hidden" |
| colspan="2" width="80px" height="80px" |
Shorebirds
| colspan="2" width="80px" height="80px" |
Oil 
Vectors 
Silt
| colspan="2" width="80px" height="80px" |
Membranes 
Shards
| colspan="2" width="80px" height="80px" |
Shawls 
Glucose 
Kits
| style="visibility:hidden" |
|-|
| style="visibility:hidden" |
| colspan="2" width="80px" height="80px" |
Hydrants 
Particles 
Knots
| colspan="2" width="80px" height="80px" |
Graphite 
Taupe
| colspan="2" width="80px" height="80px" |
Field Lines
| colspan="2" width="80px" height="80px" |
Traps
| style="visibility:hidden" |
|-|
| colspan="2" width="80px" height="80px" |
Edges 
Tribes 
Dough
| colspan="2" width="80px" height="80px" |
Dark Matter
| colspan="2" width="80px" height="80px" |
Manifolds
| colspan="2" width="80px" height="80px" |
Triangles 
Peat 
Crowns
| colspan="2" width="80px" height="80px" |
Scrolls
|}
[A caption:]
I always forget to label my moving boxes until they're sealed up and I've forgotten what's in them.
{{comic discussion}}

[[Category:Comics with color]]

Talk:1762: Moving Boxes

2016-11-22T03:17:10Z

162.158.74.29:

I think I've got some Dark Matter in a box left in my basement. Anyone knows how long you can keep this stuff until it expires? [[Special:Contributions/162.158.22.72|162.158.22.72]] 13:36, 21 November 2016 (UTC)
: Mine is about 13.8 billion years old and still OK. But shouldn't about 3/4 of the boxes be filled with dark matter? --[[Special:Contributions/162.158.91.172|162.158.91.172]] 14:21, 21 November 2016 (UTC)
:: You probably mean 1/4 (and dark energy is the other 3/4). But we don't know how dark matter is distributed. In the extreme and unlikely case that dark matter consists entirely of MACHOs, there are no boxes with it. --[[Special:Contributions/172.68.54.123|172.68.54.123]] 01:25, 22 November 2016 (UTC)
: Hah! Mine's 13.8'''1''' years old.
: It should be good for another 10^100 years or so. Give or take a few duotrigintillion years. {{unsigned ip|172.68.35.83}}
--[[User:Thejohnfan|Thejohnfan]] ([[User talk:Thejohnfan|talk]]) 14:28, 21 November 2016 (UTC)Thejohnfan
::Yeah - you've really gotta be careful about labelling that stuff - since it neither absorbs nor emits electromagnetic radiation, you're going to have to use gravitational lensing techniques to figure out which box it's in - and we all know how much of a pain THAT can be on moving day! [[User:SteveBaker|SteveBaker]] ([[User talk:SteveBaker|talk]]) 14:59, 21 November 2016 (UTC)
: Make sure to keep it all individually wrapped. It may become unstable if allowed to mingle. --[[Special:Contributions/162.158.74.29|162.158.74.29]] 03:17, 22 November 2016 (UTC)

:When I last moved house, I methodically labelled every single box with it's exact contents. Several meticulously itemized boxes contained (amongst other things) stuff like "Acrylic art paint", "Rodent poison" and "Adhesives" - and the movers saw this and refused to move about a dozen boxes because they contained things that are liquids or hazardous materials. This was more than I could fit in my car - so this became a huge deal. So next time, I'm going with "Normal House Stuff". Seriously - just label them with the room you want them dumped in at your new home and a number...write the actual contents in a MySQL database...preferably with a photo of the box before you taped it up. [[User:SteveBaker|SteveBaker]] ([[User talk:SteveBaker|talk]]) 14:59, 21 November 2016 (UTC)
::Label the boxes with "Normal house stuff'); DROP TABLE Boxes; --" if you're doing that. [[Special:Contributions/162.158.34.137|162.158.34.137]] 15:16, 21 November 2016 (UTC)
:::How do you access the MySQL database when your computer is still packed away in a box? [[User:B jonas|B jonas]] ([[User talk:B jonas|talk]]) 16:08, 21 November 2016 (UTC)

Note that there is a similar use of "Normal" in [https://xkcd.com/1530/ https://xkcd.com/1530/] [[Special:Contributions/141.101.98.151|141.101.98.151]] 16:54, 21 November 2016 (UTC)

Protip: Label boxes you don't want the movers to know about with "Party Favors." [[Special:Contributions/172.68.79.83|172.68.79.83]] 16:22, 21 November 2016 (UTC)

The explanation for Bison says they're "also known as buffalo". Not sure if that's technically accurate. https://en.wikipedia.org/wiki/Bison Excerpt: "Although sometimes referred to historically as a "buffalo", it is only distantly related to the true buffalo." {{unsigned ip|108.162.215.192}}
:Yes, but colloquially, this is acceptable. For another example, see "Indian vs. Native American."[[Special:Contributions/162.158.75.100|162.158.75.100]] 18:08, 21 November 2016 (UTC)

The "shards" could also be a reference to "sharding", as in "MongoDB is web scale"[http://www.mongodb-is-web-scale.com/]
[[User:CrazyVaccine|CrazyVaccine]] ([[User talk:CrazyVaccine|talk]]) 17:30, 21 November 2016 (UTC)

membranes shards may also refer to sponges {{unsigned ip|172.68.78.133}}

I read the "shawls glucose kits" as "shawls, glucose [testing] kits", not as "shawls, glucose, kits" {{unsigned ip|108.162.215.191}}

>>Vectors ARE physical objects in the wonderful world of epidemiology... also, I believe that it's incorrect to say that you can not put the 'physics' kind of vector into a box... just not, uh, physically, more theoretically? Also the same for field lines (unless it is full of dug up painted clods from the lines from an actual soccer field or something), but you could absolutely place a magnet next to a box, and now there are field lines in it, ammirght? -(unsigned, embarrassed, pedantic, etc) {{unsigned ip|173.245.48.84}}

Come on people this is funny! While Randal may not remember which box things are in, we must assume he KNOWS what stuff he has - ergo he really has all this stuff or at least these are keywords that represent real stuff (like "triangles" could be drafting set-squares) The joke is trying to figure out what on earth these keywords might actually represent! It being xkcd and Randal, we should not assume these are all "normal" items found in typical housholds but may be computer and tech linked. [[Special:Contributions/108.162.242.118|108.162.242.118]] 22:17, 21 November 2016 (UTC)

I'm glad he's keeping the shorebirds and oil separate. Not everyone is so considerate. [[User:Jkshapiro|Jkshapiro]] ([[User talk:Jkshapiro|talk]]) 01:49, 22 November 2016 (UTC)

Some of the boxes could be considered mathematical constructs, i.e., one box contains all the vectors, and is thus a vector space. Another contains edges, 12 of them to be precise. One box appears to be either a Gaussian surface or a magnetic yoke, containing field lines. --[[Special:Contributions/162.158.74.29|162.158.74.29]] 03:14, 22 November 2016 (UTC)

Talk:1762: Moving Boxes

2016-11-22T03:14:47Z

162.158.74.29:

I think I've got some Dark Matter in a box left in my basement. Anyone knows how long you can keep this stuff until it expires? [[Special:Contributions/162.158.22.72|162.158.22.72]] 13:36, 21 November 2016 (UTC)
: Mine is about 13.8 billion years old and still OK. But shouldn't about 3/4 of the boxes be filled with dark matter? --[[Special:Contributions/162.158.91.172|162.158.91.172]] 14:21, 21 November 2016 (UTC)
:: You probably mean 1/4 (and dark energy is the other 3/4). But we don't know how dark matter is distributed. In the extreme and unlikely case that dark matter consists entirely of MACHOs, there are no boxes with it. --[[Special:Contributions/172.68.54.123|172.68.54.123]] 01:25, 22 November 2016 (UTC)
: Hah! Mine's 13.8'''1''' years old.
: It should be good for another 10^100 years or so. Give or take a few duotrigintillion years. {{unsigned ip|172.68.35.83}}
--[[User:Thejohnfan|Thejohnfan]] ([[User talk:Thejohnfan|talk]]) 14:28, 21 November 2016 (UTC)Thejohnfan
::Yeah - you've really gotta be careful about labelling that stuff - since it neither absorbs nor emits electromagnetic radiation, you're going to have to use gravitational lensing techniques to figure out which box it's in - and we all know how much of a pain THAT can be on moving day! [[User:SteveBaker|SteveBaker]] ([[User talk:SteveBaker|talk]]) 14:59, 21 November 2016 (UTC)

:When I last moved house, I methodically labelled every single box with it's exact contents. Several meticulously itemized boxes contained (amongst other things) stuff like "Acrylic art paint", "Rodent poison" and "Adhesives" - and the movers saw this and refused to move about a dozen boxes because they contained things that are liquids or hazardous materials. This was more than I could fit in my car - so this became a huge deal. So next time, I'm going with "Normal House Stuff". Seriously - just label them with the room you want them dumped in at your new home and a number...write the actual contents in a MySQL database...preferably with a photo of the box before you taped it up. [[User:SteveBaker|SteveBaker]] ([[User talk:SteveBaker|talk]]) 14:59, 21 November 2016 (UTC)
::Label the boxes with "Normal house stuff'); DROP TABLE Boxes; --" if you're doing that. [[Special:Contributions/162.158.34.137|162.158.34.137]] 15:16, 21 November 2016 (UTC)
:::How do you access the MySQL database when your computer is still packed away in a box? [[User:B jonas|B jonas]] ([[User talk:B jonas|talk]]) 16:08, 21 November 2016 (UTC)

Note that there is a similar use of "Normal" in [https://xkcd.com/1530/ https://xkcd.com/1530/] [[Special:Contributions/141.101.98.151|141.101.98.151]] 16:54, 21 November 2016 (UTC)

Protip: Label boxes you don't want the movers to know about with "Party Favors." [[Special:Contributions/172.68.79.83|172.68.79.83]] 16:22, 21 November 2016 (UTC)

The explanation for Bison says they're "also known as buffalo". Not sure if that's technically accurate. https://en.wikipedia.org/wiki/Bison Excerpt: "Although sometimes referred to historically as a "buffalo", it is only distantly related to the true buffalo." {{unsigned ip|108.162.215.192}}
:Yes, but colloquially, this is acceptable. For another example, see "Indian vs. Native American."[[Special:Contributions/162.158.75.100|162.158.75.100]] 18:08, 21 November 2016 (UTC)

The "shards" could also be a reference to "sharding", as in "MongoDB is web scale"[http://www.mongodb-is-web-scale.com/]
[[User:CrazyVaccine|CrazyVaccine]] ([[User talk:CrazyVaccine|talk]]) 17:30, 21 November 2016 (UTC)

membranes shards may also refer to sponges {{unsigned ip|172.68.78.133}}

I read the "shawls glucose kits" as "shawls, glucose [testing] kits", not as "shawls, glucose, kits" {{unsigned ip|108.162.215.191}}

>>Vectors ARE physical objects in the wonderful world of epidemiology... also, I believe that it's incorrect to say that you can not put the 'physics' kind of vector into a box... just not, uh, physically, more theoretically? Also the same for field lines (unless it is full of dug up painted clods from the lines from an actual soccer field or something), but you could absolutely place a magnet next to a box, and now there are field lines in it, ammirght? -(unsigned, embarrassed, pedantic, etc) {{unsigned ip|173.245.48.84}}

Come on people this is funny! While Randal may not remember which box things are in, we must assume he KNOWS what stuff he has - ergo he really has all this stuff or at least these are keywords that represent real stuff (like "triangles" could be drafting set-squares) The joke is trying to figure out what on earth these keywords might actually represent! It being xkcd and Randal, we should not assume these are all "normal" items found in typical housholds but may be computer and tech linked. [[Special:Contributions/108.162.242.118|108.162.242.118]] 22:17, 21 November 2016 (UTC)

I'm glad he's keeping the shorebirds and oil separate. Not everyone is so considerate. [[User:Jkshapiro|Jkshapiro]] ([[User talk:Jkshapiro|talk]]) 01:49, 22 November 2016 (UTC)

Some of the boxes could be considered mathematical constructs, i.e., one box contains all the vectors, and is thus a vector space. Another contains edges, 12 of them to be precise. One box appears to be either a Gaussian surface or a magnetic yoke, containing field lines. --[[Special:Contributions/162.158.74.29|162.158.74.29]] 03:14, 22 November 2016 (UTC)

1756: I'm With Her

2016-11-09T03:55:36Z

162.158.74.29:

{{comic
| number = 1756
| date = November 7, 2016
| title = I'm With Her
| image = im_with_her.png
| titletext = We can do this.
}}

==Explanation==
In this serious, ''no joke'', comic released the day before the {{w|2016 United States presidential election}}, [[Randall]] urges his American viewership to vote, and shows his {{w|Political endorsement|endorsement}} for {{w|Hillary Clinton}}, the {{w|US Democratic Party|Democratic}} nominee in the election. She is up against the {{w|US Republican Party|Republican}} nominee {{w|Donald Trump}}. There are also nominees from other parties, most prominently {{w|Green Party of the United States|Green Party}} nominee {{w|Jill Stein}}, and {{w|Libertarian Party (United States)|Libertarian}} nominee {{w|Gary Johnson}}. Neither is likely to become president, but {{w|spoiler candidate|they may affect the result in some states}} (no third-party candidate has ''won'' a state since {{w|United_States_presidential_election,_1968|1968}}, but some polls show independent candidate {{w|Evan McMullin}} with a chance in Utah.)

The "H" with an arrow is {{w|Hillary Clinton presidential campaign, 2016|Clinton's campaign}} logo, and '''I'm with her''' is an official slogan of the campaign and it is thus widely used by her supporters, and explains the title and the caption below the H. Randall then lists tips to help you cast your vote, [[#How to help|see table below]]. This suggests he is invested in the election. Clinton herself may be represented by [[Blondie]] sitting on top of the H looking out at the reader as the only of the 11 characters (see [[#Character gallery|character gallery]] below).

It is the second time Randall refers to this election, the first being [[1748: Future Archaeology]] three weeks before the election, but here it was just a wish to know the result using time travel (of course he did not learn the result…).

This is the first time Randall has used a comic to directly support a presidential campaign, although he did [https://blog.xkcd.com/2008/01/28/obama/ endorse] {{w|Barack Obama}} in 2008 on his [[Blag]]. He wrote himself later that it was very controversial when he endorsed Obama, but that it was not the most [[388:_Fuck_Grapefruit#Controversy|controversial comic he had published]] at that time. This comic might take that prize now, given that this is likely one of the most discussed elections up to its time, especially outside the US, where for instance some of European leaders have made it clear that they are against Trump while other endorse him.

Randall's support for Hillary Clinton may be to do with Donald Trump {{w|Donald_Trump#Healthcare.2C_education_and_environment|being a prominent}} {{w|climate change denier}}. Randall has published comics opposing climate change denial such as this: [[1732: Earth Temperature Timeline]], published less than two month before the election, as well as several other [[:Category:Climate change|comics on climate change]].

All the information on the bottom half of the comic includes sites, numbers, info, etc. that will help US voters to vote, regardless of whom they vote for. Including this information helps voters because every election many voters don't vote because they feel they don't know how or that it isn't worth it. It seems like Randall wants to boost voter turnout.

The title text, which states that "We can do this" refers to Randall's wish that the democratic voters united can put Hillary in the White House rather than Trump. It is possible to [https://www.lookhuman.com/design/86542-hillary-clinton-we-can-do-it/tshirt buy t-shirts] with the famed {{w|We Can Do It!}} logo from the war time poster, but with Hillary Clinton in the famed position. However this is not quite the same "We can do this" sentence that Randall uses. "We can do this" (or in German, "[https://www.dict.cc/?s=Wir+schaffen+das+%5BAngela+Merkel%5D Wir schaffen das]") was also the catchphrase of the German Chancellor {{w|Angela Merkel}} during the recent influx of refugees from the Syrian War—like Clinton, Merkel was fighting against {{w|Pegida|a populist nativist movement}} that wanted to close the country's borders.

===How to help===
The list of things that can help is all about getting people to vote. This could be interpreted as if Randall just wished for people to support the democracy and exercise their right to vote. But with the endorsement of Clinton in the main comic, there can be no doubt that he means that this advice should help Clinton. Generally there is evidence that certain more heavily Democratic-leaning demographics are less likely to vote, so increasing turnout is likely to help Clinton. In general, however, it is likely that Randall would in any case wish for more voters to support the democracy by actually voting.

Here is Randall's lists of suggestion for how to help Hillary Clinton win the election:
{|class="wikitable"
!What to do
!How to do it
!Explanation
|-
|Vote
|[https://iwillvote.com/ iwillvote.com]
|A site to look up polling location, ID requirements, etc.
|-
|Get a ride to the polls:
|[http://www.drive2vote.org/ drive2vote.org]
|For voters in Douglas or Sarpy County, Nebraska, who need a ride to the polls from {{w|Warren Buffett}} or his friends.
|-
|If you're having problems voting
|[http://www.866ourvote.org/ 866-OUR-VOTE]
|In many states, racism or other biases on the part of people running polling places is a real issue for minorities. Though it is illegal in theory, people may lie or deny rights to would-be-voters who they believe will not vote for the candidate they agree with. In some instances, these people may require backup from someone with legal understanding to get to vote, which is a service this phone number provides. Since Donald Trump has suggested that unofficial {{w|poll watchers}} should patrol voting stations - which has been described as potential [https://www.theguardian.com/us-news/2016/nov/05/election-day-violence-donald-trump-poll-watchers voter intimidation] - this has been an especially widely discussed topic in this election. The phone number written out as numbers is (866) 687-8683
|-
|Experimental social turnout project
|[http://www.civicinnovation.com/ civicinnovation.com] App Store: VoteWithMe
|An app which "gives you a list of the top 10 highest-impact potential voters in your address book to get in touch with -- based on the likelihood that they support progressive candidates, and that they live in states with the most competitive races". This app is for Android and iOS, with the App Store ID as "VoteWithMe". The "VoteWithMe" app is created by Civic Innovation Works and "uses publicly available voter records to predict which of your contacts are likely to support Democratic candidates, but might not have a plan to vote", as it says on its [https://itunes.apple.com/us/app/votewithme/id1170104517/ App Store Page].
|-
|Reminder:
|If you're in line when the polls close, they have to let you vote.
|This is correct, as is printed on most election pamphlets as part of the ''Voters' Bill of Rights'', as well as being cited on numerous sources online (eg [http://votersedge.kqed.org/en/ca/ballot/election/area/42/section/voting-info?id=statewide-42-ca#section-my-rights-as-a-voter here].) Being turned down for trying to vote after the polling place is officially closed (if you were already in line ''when'' the polls closed) might be an instance where you want to use the phone number mentioned above.
|}

===Character gallery===
The comic show a gallery of 11 xkcd characters including all the main characters from xkcd (except [[Hairy]]), which stand united behind Randall and Clinton despite their lack of agreement in many other comics.

*From left to right on the left side of the H are:
**[[Ponytail]] with a ray gun for melting computers a possible reference to Hillary's email wipe, (the one she also wielded in [[322: Pix Plz]], a comic where she was named Joanna)
**[[Black Hat]] (who was the one introducing Joanna/Ponytail in the mentioned comic)
**[[Danish]] (Black Hat's girlfriend setting up a kite for him, although it could be Megan, but she is also shown later with her regular shorter hair). However it has mainly been Megan in comics with kites, like [[235: Kite]] and [[1614: Kites]]. Kites are a [[:Category:Kites|recurring theme]] on xkcd.
**[[White Hat]] looking at the kite.
*On top of the H are:
**[[Blondie]] (looking out at us, maybe representing Clinton herself)
**[[Megan]] (next to Cueball)
**[[Cueball]] (forming the standard couple in xkcd with Megan)
**[[Hairbun]] with glasses (so specifically not the one from the previous comic [[1755: Old Days]], but rather like in [[1637: Salt Mine]]).
*On the right side of the H are:
**[[Science Girl]] (The adult version of her, is holding her hand out towards a cute squirrel. Of course she could also be the girl from [[635: Locke and Demosthenes]] where the squirrel is poisoned...)
**[[Beret Guy]] is holding a squirrel out towards Science Girl. (The first time squirrels was mentioned was actually when Beret Guy found them in a tree in [[167: Nihilism]] and since then they have become a [[:Category:Squirrels|recurring theme]] on xkcd and a similar squirrel can for instance be seen in [[1503: Squirrel Plan]]. Beret Guy has not been seen together with a squirrel before, but has been shown to care for animals, for instance in [[614: Woodpecker]]).
**[[:Category:Multiple Cueballs|Another Cueball]] is standing on an office chair wielding a sword as he was shown in [[303: Compiling]]. (Interestingly enough the previous comic [[1755: Old Days]] was about Cueball asking Hairbun about {{w|compiling}} in the old days. Seems realistic that Randall has this comic ready for this Monday before the election for some time, and when finding this 9 year old version of Cueball in the old comics, he may have gotten inspired to make a comic about compiling in the old days).

Note that the two characters at either side of the comic wields weapons pointing out defending the other nine. Those next to the characters with weapons are doing recreational things like kiting and admiring adorable squirrels, both are recurring subjects in xkcd.

==Transcript==
:[Eleven characters are drawn left, right and on top of a huge H with an arrow as the horizontal bar connecting the two vertical towers. The arrow breaks the right part of the H. It represents the logo from Hillary Clinton's presidential campaign for 2016. From left to right on the left side of the H are Ponytail with an exotic looking futuristic ray gun like weapon looking to the left away from the H and the others. Behind her is Black Hat who looks at a girl that might be Danish or Megan (but with longer hair than Megan typically has). She is setting up a kite that flies above the first two characters. Behind her and looking up at the kite is White Hat. The H is right behind him, and on top of the left tower of the H sits Blondie looking straight out at the reader with her legs dangling over the edge and her arms resting on her knees. On the arrow between the two H towers sits Megan leaning against the left H tower, also dangling her legs over the edge and arms resting on her knees. Cueball is standing to her right, just left of the right H tower. On top of the right H towers sits Hairbun with glasses looking straight right with her legs dangling over the edge one arm resting on a knee and leaning back on the other arm. On the right side of the H is an adult version of Science Girl holding a hand out towards the squirrel which Beret Guy is holding out in both arms towards her. Behind them is another Cueball standing on an office chair holding a sword high up in front of him to the right away from the others. He keeps his balance by holding his other arm out behind him. Below the H there is a large caption.]
:<big><big><big>H</big></big></big>
: <big><big>I'm with her.</big></big>

:[Below the panel there are several lines of text. The first header line refers to the next four lines with solutions to problems, title/problem on one side then a long dash and the web-link or other information on the right side of that. Below those there is a reminder.]
:<big>How to help</big>
:Vote - iwillvote.com
:Get a ride to the polls - drive2vote.org
:If you're having problems voting - 866-OUR-VOTE
:Experimental social turnout project - civicinnovation.com App Store: VoteWithMe

:<big>Reminder:</big>
:If you're in line when the polls close, they have to let you vote.

{{comic discussion}}

[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring Black Hat]]
[[Category:Comics featuring Danish]]
[[Category:Comics featuring White Hat]]
[[Category:Comics featuring Blondie]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Hairbun]]
[[Category:Comics featuring Science Girl]]
[[Category:Comics featuring Beret Guy]]
[[Category:Comics featuring politicians]] 
[[Category:Multiple Cueballs]]
[[Category:Politics]]
[[Category:Kites]]
[[Category:Squirrels]]