<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=162.158.91.77</id>
		<title>explain xkcd - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=162.158.91.77"/>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php/Special:Contributions/162.158.91.77"/>
		<updated>2026-06-24T07:46:48Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.30.0</generator>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2307:_Alive_Or_Not&amp;diff=192168</id>
		<title>Talk:2307: Alive Or Not</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2307:_Alive_Or_Not&amp;diff=192168"/>
				<updated>2020-05-18T14:53:22Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.91.77: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
&lt;br /&gt;
I'm pretty sure high-pressure fire hoses belong on this scale[[User:60sRefugee|60sRefugee]] ([[User talk:60sRefugee|talk]]) 21:47, 15 May 2020 (UTC)&lt;br /&gt;
:What about wacky waving inflatable tube guy? [[Special:Contributions/172.68.38.124|172.68.38.124]] 00:41, 16 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Funny, for once viruses are said to be alive. That's new... [[Special:Contributions/141.101.107.138|141.101.107.138]] 22:01, 15 May 2020 (UTC)&lt;br /&gt;
:Definitely new, and extremely angering! I could scream... [[Special:Contributions/172.68.143.30|172.68.143.30]] 22:47, 15 May 2020 (UTC)&lt;br /&gt;
::Jup. The nex disgusting piece of antiscience after Wednesday´s nonsense about handwashing helping against respirational diseases. I think Monroe has caught a bug from Potus Donald. --[[Special:Contributions/141.101.69.33|141.101.69.33]] 07:44, 16 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Do we want to bicker over the placement of the line (like &amp;quot;Why is it below viruses&amp;quot;), or the order things are placed in (like &amp;quot;Why are slime molds below plants&amp;quot;)? [[User:GreatWyrmGold|GreatWyrmGold]] ([[User talk:GreatWyrmGold|talk]]) 22:06, 15 May 2020 (UTC)&lt;br /&gt;
: Oh, go on. If you insist. You go first, unless you already have. ;) [[Special:Contributions/162.158.154.31|162.158.154.31]] 22:46, 15 May 2020 (UTC)&lt;br /&gt;
: Seconded, I'm most interested which criterion (even a numeric one, as the diagram is suggestive of) Randall used. [[Special:Contributions/162.158.158.163|162.158.158.163]] 09:43, 16 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
True fossils have remineralised so generally do not have DNA left. They are merely the shadow of a previous life.&lt;br /&gt;
: So fossils are closer to &amp;quot;Rocks with Faces,&amp;quot; well, for the ancient vertebrate fossils anyway?  [[User:Nutster|Nutster]] ([[User talk:Nutster|talk]]) 15:36, 16 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Surprised no one has noticed the typo yet.  It's 'archaea', not 'archea'&lt;br /&gt;
:(Sign yourself(/ves), &amp;quot;True fossils&amp;quot; and &amp;quot;Surprised&amp;quot;?) I disagree. It's 'archæa'... [[Special:Contributions/162.158.154.31|162.158.154.31]] 22:46, 15 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Poor English and a mistake. It should say...&lt;br /&gt;
&amp;quot;...discussion about *whether* virus*es* are alive.&amp;quot; &lt;br /&gt;
Also the (covid for starters) is wrong. Covid19 is the disease caused by the virus (as mentioned in the line above) not the virus itself&lt;br /&gt;
&lt;br /&gt;
I am disappointed that sponges are not mentioned as an example of weird animals. I mean, come on, way weirder than jellyfish. But it is good that viruses get the recognition they deserve.[[User:Jkrstrt|Jkrstrt]] ([[User talk:Jkrstrt|talk]]) 13:34, 16 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
When looking at viruses, I consider them made of the things of life (proteins, lipids, nucleic acids), but are not actually alive as they have no metabolism and can not reproduce on their own; they need to co-opt the protein production facility of truly living cells in order to reproduce.  Without a host, they just sit there (or maybe blow around on the wind).  Also without metabolism, they can not starve to death, like bacteria and other single-cell organisms that get into the wrong environment. [[User:Nutster|Nutster]] ([[User talk:Nutster|talk]]) 15:36, 16 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Well, this raises the question where the sun (or any main sequence star) fall on this list. Is it just a really big thermonuclear fire?&lt;br /&gt;
&lt;br /&gt;
This is not a COVID-19 comic. Just because it is biology-related, doesn't make it a COVID-19 comic. I have removed it from the category and its mention in the explanation.[[Special:Contributions/172.69.34.38|172.69.34.38]] 07:33, 17 May 2020 (UTC)&lt;br /&gt;
:Of course it is. The whole idea about this comic is to spark the discussion if Virus (covid) is alive or not. I put it back. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:59, 17 May 2020 (UTC)&lt;br /&gt;
::I fully disagree, this comic could have been published in previous years. This is only tangentially related to COVID-19, and is a general discussion about &amp;quot;life&amp;quot;. Viruses are only barely mentioned in this comic. [[Special:Contributions/172.69.34.38|172.69.34.38]] 23:26, 17 May 2020 (UTC)&lt;br /&gt;
:::Agree it shouldn't be classified as COVID-19, but then there's a bunch of others that should be removed from the category: 2278, 2283, 2289, 2292, 2293.[[Special:Contributions/141.101.107.78|141.101.107.78]] 08:34, 18 May 2020 (UTC)&lt;br /&gt;
:::I wouldn't consider this comic about COVID-19, either. [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 13:49, 18 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Somewhat disappointed that he didn't include any fictional items such as golems. For that matter, where to place Alexa?  [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 10:51, 18 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
I’m surprised this doesn’t include Schrödinger’s Cat at the origin. [[Special:Contributions/162.158.91.77|162.158.91.77]] 14:53, 18 May 2020 (UTC)&lt;/div&gt;</summary>
		<author><name>162.158.91.77</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:1425:_Tasks&amp;diff=192163</id>
		<title>Talk:1425: Tasks</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:1425:_Tasks&amp;diff=192163"/>
				<updated>2020-05-18T12:16:57Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.91.77: /* GIS being &amp;quot;easy&amp;quot; */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;the source of title text maybe is Szeliski, ''Computer Vision: Algorithms and Applications'' (2010), p. 10. --[[User:Valepert|valepert]] ([[User talk:Valepert|talk]]) 06:59, 24 September 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
[http://www.wired.com/2012/06/google-x-neural-network/ Google’s Artificial Brain Learns to Find Cat Videos] might be useful as a description of the problem [[Special:Contributions/108.162.250.219|108.162.250.219]] 08:34, 24 September 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
:Sorry for editing your comment but external links have different syntax that internal links so it wasn't working. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 11:21, 24 September 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
Nice Superman joke there, Pudder! --[[Special:Contributions/141.101.99.49|141.101.99.49]] 10:26, 24 September 2014 (UTC)&lt;br /&gt;
:It had been removed in an edit, so I shoehorned in back in :P --[[User:Pudder|Pudder]] ([[User talk:Pudder|talk]]) 12:25, 24 September 2014 (UTC)&lt;br /&gt;
Isn't there an xkcd where the estimate of 5 years of work is equivalent to &amp;quot;might take forever?&amp;quot; [[User:Rtanenbaum|Rtanenbaum]] ([[User talk:Rtanenbaum|talk]]) 13:16, 24 September 2014 (UTC)&lt;br /&gt;
:I'm pretty sure you're refering to 678. [[Special:Contributions/173.245.52.132|173.245.52.132]] 15:00, 25 September 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
The link in the description is to a document by {{w|Seymour Papert}} and the [http://books.google.com/books/about/The_Summer_Vision_Project.html?id=qOh7NwAACAAJ book] on the project is also by Papert.  Is there any contemporary evidence that it was actually Minsky who assigned the project?  I think he just got interested in it later. 14:17, 24 September 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
[http://xkcd.com/678/ 678: Researcher Translation] is probably what you're thinking of, Rtanenbaum. [[User:Ndgeek|Ndgeek]] ([[User talk:Ndgeek|talk]]) 17:44, 24 September 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
Is it possible that Randall's selection of bird rather than another naturally occurring object is a subtle reference to the Birdsnap app (http://engineering.columbia.edu/it-crow-or-raven-new-birdsnap-app-will-tell-you-0) which has solved some of the aspects of this problem?  [[Special:Contributions/173.245.48.137|173.245.48.137]] 22:02, 27 September 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
Hopefully I can add that this also seems to make reference to the U.S. Forest Service intention to make everyone have a permit to take pics, etc., in national parks.  https://www.yahoo.com/travel/dont-take-that-picture-the-u-s-forest-service-might-98484656432.html {{unsigned ip|108.162.216.21}}&lt;br /&gt;
&lt;br /&gt;
Post the picture to an online forum, say it's a bird, if it's not everyone will correct you as per http://xkcd.com/386/, so scrape forum and if there's a lot of attention it's not a bird, if there isn't much attention it probably is a bird. [[Special:Contributions/141.101.99.78|141.101.99.78]] 23:06, 3 October 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
A dev team at Flickr took this comic as a challenge, and set up a PoC at http://parkorbird.flickr.com/ (that seems to work fairly well). --[[Special:Contributions/108.162.210.135|108.162.210.135]] 20:08, 20 October 2014 (UTC)&lt;br /&gt;
:I was duly impressed. It doesn't recognize big bird very well, though. ;) [[User:Suspender guy|Suspender guy]] ([[User talk:Suspender guy|talk]]) 20:26, 17 February 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
A 'picture of a bird' from a CS perspective is a reverse engineering problem.  The picture is a 2 dimensional rendering of a 3-dimensional world and a 'bird' is a 3-dimensional object.  It takes years for the mind of a newborn human to be able to recognize a majority of objects based on their 'first look' at a stereoscopic (two-eyes) image presented by their visual cortex.  The software equivalency of this would be to create a 3 dimensional representation of objects and create a linear-algebra algorithm that can define the statistical probability that any given shape is within a certain degree of exclusion a matrix representation of the target shape (area) of the 3 dimensional object (bird) based on distance (using spacial reconstruction).  It's not impossible, it's just really really hard.  - nerd answer {{unsigned ip|173.245.54.166}}&lt;br /&gt;
:To be honest I don't think it is impossible to replicate any function of human intelligence and mental capacity on a computer system. It just requires sufficient processing ability, appropriate hardware, and of course, an understanding of how humans do it in the first place. -Pennpenn [[Special:Contributions/108.162.250.162|108.162.250.162]] 03:29, 17 September 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
Or just give Google a little less than two years, and they'll make [https://cloud.google.com/vision/ Google Cloud Vision API] for you [[User:Gpk|Gpk]] ([[User talk:Gpk|talk]]) 20:39, 13 June 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
I read somewhere that when you ask CS/IT specialist for a probable ETA for solving an interesting problem, you need to multiply the given time to the ETA by 4 and take the next larger unit (a minute becomes 4 hours, an hour becomes 4 days etc.). Can't find the source of that though. [[Special:Contributions/141.101.70.229|141.101.70.229]] 15:47, 12 September 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
== GIS being &amp;quot;easy&amp;quot; ==&lt;br /&gt;
&lt;br /&gt;
All these years later, I still struggle with the classification of &amp;quot;are we in a national park&amp;quot; as &amp;quot;easy&amp;quot;..&lt;br /&gt;
&lt;br /&gt;
It 'only' requires a functioning GPS-system. A military super-project, whose [https://nation.time.com/2012/05/21/how-much-does-gps-cost/ initial setup cost 12 billion], still costs ~2 million a day, and whose principles of operation depend on [https://skeptics.stackexchange.com/questions/20230/does-gps-use-general-relativity both special '''and''' general relativity] for correctness.&lt;br /&gt;
And that's ''before'' we add the record-keeping and (internet?)logistics involved with providing each phone an accurate GIS-database. The OpenStreetMap (most likely free/gratis source of this type of data, for a cheap app) is a massive undertaking!&lt;br /&gt;
&lt;br /&gt;
(sarcasm on) GIS-lookup sure is easy! Only took a minor Manhattan-project, a literal Einstein, and an army of internet volunteers to solve!(sarcasm off)&lt;br /&gt;
&lt;br /&gt;
(I'm leaving out mobile internet access while in said National Parks (Telecom operators are among the wealthiest companies in the world, and those phone-towers-disguised-like-trees don't come cheap...), because the App would probably be shipped with a hardcoded park-database, not do live queries.)&lt;br /&gt;
&lt;br /&gt;
-- Jules @ [[Special:Contributions/162.158.91.77|162.158.91.77]] 08:13, 18 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
:This is about implementation of something existing, not inventing it from scratch. The use of the word &amp;quot;app&amp;quot; implies, that this comic is happening in the smartphone area, so GPS on phones should be a regular thing. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 09:57, 18 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
:: &amp;quot;app&amp;quot; sets the real-world context, but the punchline is about the comparative hardness '''in CS'''.&lt;br /&gt;
:: For the pragmatic app-developer, &amp;quot;previously solved&amp;quot; equals &amp;quot;easy&amp;quot;; for a doctorate in computational theory, it doesn't :-)&lt;br /&gt;
:: -- Jules @ [[Special:Contributions/162.158.91.77|162.158.91.77]] 12:16, 18 May 2020 (UTC)&lt;/div&gt;</summary>
		<author><name>162.158.91.77</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:1425:_Tasks&amp;diff=192155</id>
		<title>Talk:1425: Tasks</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:1425:_Tasks&amp;diff=192155"/>
				<updated>2020-05-18T08:13:22Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.91.77: /* GIS being &amp;quot;easy&amp;quot; */ new section&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;the source of title text maybe is Szeliski, ''Computer Vision: Algorithms and Applications'' (2010), p. 10. --[[User:Valepert|valepert]] ([[User talk:Valepert|talk]]) 06:59, 24 September 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
[http://www.wired.com/2012/06/google-x-neural-network/ Google’s Artificial Brain Learns to Find Cat Videos] might be useful as a description of the problem [[Special:Contributions/108.162.250.219|108.162.250.219]] 08:34, 24 September 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
:Sorry for editing your comment but external links have different syntax that internal links so it wasn't working. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 11:21, 24 September 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
Nice Superman joke there, Pudder! --[[Special:Contributions/141.101.99.49|141.101.99.49]] 10:26, 24 September 2014 (UTC)&lt;br /&gt;
:It had been removed in an edit, so I shoehorned in back in :P --[[User:Pudder|Pudder]] ([[User talk:Pudder|talk]]) 12:25, 24 September 2014 (UTC)&lt;br /&gt;
Isn't there an xkcd where the estimate of 5 years of work is equivalent to &amp;quot;might take forever?&amp;quot; [[User:Rtanenbaum|Rtanenbaum]] ([[User talk:Rtanenbaum|talk]]) 13:16, 24 September 2014 (UTC)&lt;br /&gt;
:I'm pretty sure you're refering to 678. [[Special:Contributions/173.245.52.132|173.245.52.132]] 15:00, 25 September 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
The link in the description is to a document by {{w|Seymour Papert}} and the [http://books.google.com/books/about/The_Summer_Vision_Project.html?id=qOh7NwAACAAJ book] on the project is also by Papert.  Is there any contemporary evidence that it was actually Minsky who assigned the project?  I think he just got interested in it later. 14:17, 24 September 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
[http://xkcd.com/678/ 678: Researcher Translation] is probably what you're thinking of, Rtanenbaum. [[User:Ndgeek|Ndgeek]] ([[User talk:Ndgeek|talk]]) 17:44, 24 September 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
Is it possible that Randall's selection of bird rather than another naturally occurring object is a subtle reference to the Birdsnap app (http://engineering.columbia.edu/it-crow-or-raven-new-birdsnap-app-will-tell-you-0) which has solved some of the aspects of this problem?  [[Special:Contributions/173.245.48.137|173.245.48.137]] 22:02, 27 September 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
Hopefully I can add that this also seems to make reference to the U.S. Forest Service intention to make everyone have a permit to take pics, etc., in national parks.  https://www.yahoo.com/travel/dont-take-that-picture-the-u-s-forest-service-might-98484656432.html {{unsigned ip|108.162.216.21}}&lt;br /&gt;
&lt;br /&gt;
Post the picture to an online forum, say it's a bird, if it's not everyone will correct you as per http://xkcd.com/386/, so scrape forum and if there's a lot of attention it's not a bird, if there isn't much attention it probably is a bird. [[Special:Contributions/141.101.99.78|141.101.99.78]] 23:06, 3 October 2014 (UTC)&lt;br /&gt;
&lt;br /&gt;
A dev team at Flickr took this comic as a challenge, and set up a PoC at http://parkorbird.flickr.com/ (that seems to work fairly well). --[[Special:Contributions/108.162.210.135|108.162.210.135]] 20:08, 20 October 2014 (UTC)&lt;br /&gt;
:I was duly impressed. It doesn't recognize big bird very well, though. ;) [[User:Suspender guy|Suspender guy]] ([[User talk:Suspender guy|talk]]) 20:26, 17 February 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
A 'picture of a bird' from a CS perspective is a reverse engineering problem.  The picture is a 2 dimensional rendering of a 3-dimensional world and a 'bird' is a 3-dimensional object.  It takes years for the mind of a newborn human to be able to recognize a majority of objects based on their 'first look' at a stereoscopic (two-eyes) image presented by their visual cortex.  The software equivalency of this would be to create a 3 dimensional representation of objects and create a linear-algebra algorithm that can define the statistical probability that any given shape is within a certain degree of exclusion a matrix representation of the target shape (area) of the 3 dimensional object (bird) based on distance (using spacial reconstruction).  It's not impossible, it's just really really hard.  - nerd answer {{unsigned ip|173.245.54.166}}&lt;br /&gt;
:To be honest I don't think it is impossible to replicate any function of human intelligence and mental capacity on a computer system. It just requires sufficient processing ability, appropriate hardware, and of course, an understanding of how humans do it in the first place. -Pennpenn [[Special:Contributions/108.162.250.162|108.162.250.162]] 03:29, 17 September 2015 (UTC)&lt;br /&gt;
&lt;br /&gt;
Or just give Google a little less than two years, and they'll make [https://cloud.google.com/vision/ Google Cloud Vision API] for you [[User:Gpk|Gpk]] ([[User talk:Gpk|talk]]) 20:39, 13 June 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
I read somewhere that when you ask CS/IT specialist for a probable ETA for solving an interesting problem, you need to multiply the given time to the ETA by 4 and take the next larger unit (a minute becomes 4 hours, an hour becomes 4 days etc.). Can't find the source of that though. [[Special:Contributions/141.101.70.229|141.101.70.229]] 15:47, 12 September 2016 (UTC)&lt;br /&gt;
&lt;br /&gt;
== GIS being &amp;quot;easy&amp;quot; ==&lt;br /&gt;
&lt;br /&gt;
All these years later, I still struggle with the classification of &amp;quot;are we in a national park&amp;quot; as &amp;quot;easy&amp;quot;..&lt;br /&gt;
&lt;br /&gt;
It 'only' requires a functioning GPS-system. A military super-project, whose [https://nation.time.com/2012/05/21/how-much-does-gps-cost/ initial setup cost 12 billion], still costs ~2 million a day, and whose principles of operation depend on [https://skeptics.stackexchange.com/questions/20230/does-gps-use-general-relativity both special '''and''' general relativity] for correctness.&lt;br /&gt;
And that's ''before'' we add the record-keeping and (internet?)logistics involved with providing each phone an accurate GIS-database. The OpenStreetMap (most likely free/gratis source of this type of data, for a cheap app) is a massive undertaking!&lt;br /&gt;
&lt;br /&gt;
(sarcasm on) GIS-lookup sure is easy! Only took a minor Manhattan-project, a literal Einstein, and an army of internet volunteers to solve!(sarcasm off)&lt;br /&gt;
&lt;br /&gt;
(I'm leaving out mobile internet access while in said National Parks (Telecom operators are among the wealthiest companies in the world, and those phone-towers-disguised-like-trees don't come cheap...), because the App would probably be shipped with a hardcoded park-database, not do live queries.)&lt;br /&gt;
&lt;br /&gt;
-- Jules @ [[Special:Contributions/162.158.91.77|162.158.91.77]] 08:13, 18 May 2020 (UTC)&lt;/div&gt;</summary>
		<author><name>162.158.91.77</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2243:_Star_Wars_Spoiler_Generator&amp;diff=191626</id>
		<title>Talk:2243: Star Wars Spoiler Generator</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2243:_Star_Wars_Spoiler_Generator&amp;diff=191626"/>
				<updated>2020-05-05T07:42:50Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.91.77: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Here is a fully documented R implementation! Enjoy: [https://blog.ephorie.de/learning-r-build-xkcds-star-wars-spoiler-generator Learning R: Build xkcd’s Star Wars Spoiler Generator]&lt;br /&gt;
&lt;br /&gt;
I made this JavaScript implementation of the generator: https://codepen.io/qgustavor/full/gObgBxo [[Special:Contributions/172.68.24.70|172.68.24.70]] 22:33, 18 December 2019 (UTC)&lt;br /&gt;
:there are some words that should be capitalized: First Order, Sith, Force, Jawa... Also ochre is misspelt and colors should NOT be capitalized. Thanks![[Special:Contributions/141.101.98.196|141.101.98.196]] 10:21, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
who said that the rise of skywalker would be released two days before the publishing date after stating that it's going to be released on the twentieth?&lt;br /&gt;
&lt;br /&gt;
Re: Malloc, there was also a Darth Malak, the antagonist of Star Wars Knights of the Old Republic and a recurring character in the Old Republic comics [[Special:Contributions/172.69.69.244|172.69.69.244]] 02:08, 19 December 2019 (UTC)47.221.57.204&lt;br /&gt;
&lt;br /&gt;
Should something be linked to about diectric breakdown, or is that considered obvious in the context of, er, Force lightning?  Also, am I remembering right that Dark Helmet, in Spaceballs, wears a smaller helmet with a really big helmet over it?  Maybe not!  Robert Carnegie rja.carnegie@gmail.com [[Special:Contributions/141.101.98.250|141.101.98.250]] 02:48, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
There are a couple of posts to be found online that refer to &amp;quot;Darth Sebelius&amp;quot; in the context of Obamacare, but they're all on pretty niche forums.  --[[User:NotaBene|NotaBene]] ([[User talk:NotaBene|talk]]) 03:07, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Perchance generator: https://perchance.org/q3wi2jqf0j [[Special:Contributions/173.245.54.59|173.245.54.59]] 03:16, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
For a less US-centric view, the movie was released officially in France and Norway (and probably also other countries) already on the 18.12. (that is December 18). So &amp;quot;On December 20, 2019 [...], the final movie [...] will be released.&amp;quot; should say &amp;quot;[...] will be released in the US.&amp;quot;[[Special:Contributions/162.158.134.220|162.158.134.220]] 12:01, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Another generator: http://xkcd-2243.surge.sh/&lt;br /&gt;
&lt;br /&gt;
I don't know enough to add to the actual page, but the Sith car wash reminded me of this. Perhaps it was also part of the inspiration for it? https://www.cnet.com/roadshow/news/tesla-laser-windshield-wiper-patent/ [[Special:Contributions/141.101.69.35|141.101.69.35]] 15:28, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
&amp;quot;A New Hope&amp;quot; should just be called &amp;quot;Star Wars&amp;quot;. [[Special:Contributions/141.101.76.16|141.101.76.16]] 18:58, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
C#/LINQ: https://dotnetfiddle.net/r0JMJz&lt;br /&gt;
&lt;br /&gt;
The title text just means that there are more lightsaber brushes to hurt the heroes, right? [[Special:Contributions/162.158.106.78|162.158.106.78]] 22:32, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Is the Kyle Ren option a reference to being &amp;quot;A Kyle&amp;quot; (as defined at Urban Dictionary as &amp;quot;A Kyle is a young white man of low socio economic standing with a propensity to drink large quantities of Monster energy drink and do dumb stuff like punch holes in walls.&amp;quot;) After all, Kylo Ren did tend to get angry and break stuff? [[User:Mneimeyer|Mneimeyer]] ([[User talk:Mneimeyer|talk]]) 23:01, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Is darth sebelius a reference to the sibelius composing software?&lt;br /&gt;
:I would think the Sibelous software (1993-present) would instead be a definite reference to the Finnish composer (1865-1957) already part-posited as a possible influence for the Darth.  Although I'd probably defer that suggestion in favour of the politician (1948-present, in direct politics until 2014?) even if I'd actually never heard of them from this side of The Pond. Still, there are weirder connections, so who knows? [[Special:Contributions/162.158.158.93|162.158.158.93]] 20:18, 21 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Please clarify the reference to Rey as a &amp;quot;Mary Sue.&amp;quot;  The linked article says that the only agreed on meaning for the term is that it is derogatory.  Other than that, it appears to mean different things to different people.  So it's inclusion here does not help explain the comic.  What is it about Rey that gave her that label.  Is it that she is not canon?  Is it that she is overpowered?  Probably better to just remove the Mary Sue jargon, and say whatever it is they say about those with other colored light sabers directly.  [[Special:Contributions/108.162.246.77|108.162.246.77]] 01:45, 22 December 2019 (UTC)&lt;br /&gt;
: While I'm not sure about Rey being entirely a Mary-Sue (in my mind an 'author avatar' character - whether or not a prime protagonist or ascending sidekick, they're just too competent for the role and often a Mcguffin baker), she definitely has more than a little plot-armour (and plot-weapon-skill) that I ''hope'', when I see the filmm (within a week, by current plans), bodes for something other than 2xrnd(trader(junk)) as patentage. Or something else that's actually awesome to get round that without being ''deus ex''.  But by dint of Windu's ''actor'' having been asked what colour of weapon he wanted (then him having requested what he did and then being granted it, - which might not have gone that far with less imaginative or influential actors) I'd count that as a very Mary-Sue-like thing, even if the rest of the badassness of that particular Jedi (the tone written prior to the resulting casting of the badass actor to fit) was just standard Major Supporting Character/Lancer fare.  But just my musings, nothing official... [[Special:Contributions/162.158.158.179|162.158.158.179]] 13:07, 22 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
I'm considering going through the table and adding a note for whether each thing is actually in Star Wars. would that be a good idea? [[Special:Contributions/172.68.141.136|172.68.141.136]] 06:48, 22 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Triggering the end credits before the movie is done&amp;quot; is a reference to the &amp;quot;Credits Warp&amp;quot; category in {{w|speedrun|video game speedrunning}}. Where a normal speedrun aims to clear the final level and/or defeat the final boss as fast as possible, a &amp;quot;Credits Warp&amp;quot; aims to gain {{w|arbitrary code execution}} and trigger the end credits without finishing the game. The most famous example is [https://youtu.be/9cBIgCy27JI Super Mario World in 45 seconds]. [[Special:Contributions/141.101.77.62|141.101.77.62]] 14:24, 23 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
I think the mouseover text is a reference to this scene in &amp;quot;Space Balls&amp;quot;: https://www.youtube.com/watch?v=ZXOAc5yt218  (&amp;quot;Space Balls&amp;quot; is a satire of several films, including the original &amp;quot;Star Wars&amp;quot; trilogy.)  In the &amp;quot;Space Balls&amp;quot; scene, the bad guys are using a robot to vacuum all the air out of the atmosphere of the planet.  The bad guys have the upper hand until the good guys are able to flip the switch on the vacuum cleaner.  &amp;quot;She's gone from 'suck' to 'blow'&amp;quot; is a fairly famous line in the movie.  I don't know enough &amp;quot;Star Wars&amp;quot; to understand the reference, but if you flip a car wash from &amp;quot;regular&amp;quot; to &amp;quot;premium&amp;quot; I assume the bristles/lightsaber blades would spin faster. [[User:Mattj256|Mattj256]] ([[User talk:Mattj256|talk]]) 21:07, 23 December 2019 (UTC)&lt;/div&gt;</summary>
		<author><name>162.158.91.77</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2243:_Star_Wars_Spoiler_Generator&amp;diff=191625</id>
		<title>Talk:2243: Star Wars Spoiler Generator</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2243:_Star_Wars_Spoiler_Generator&amp;diff=191625"/>
				<updated>2020-05-05T07:36:12Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.91.77: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Here is an R implementation! Enjoy! https://blog.ephorie.de/learning-r-build-xkcds-star-wars-spoiler-generator&lt;br /&gt;
&lt;br /&gt;
I made this JavaScript implementation of the generator: https://codepen.io/qgustavor/full/gObgBxo [[Special:Contributions/172.68.24.70|172.68.24.70]] 22:33, 18 December 2019 (UTC)&lt;br /&gt;
:there are some words that should be capitalized: First Order, Sith, Force, Jawa... Also ochre is misspelt and colors should NOT be capitalized. Thanks![[Special:Contributions/141.101.98.196|141.101.98.196]] 10:21, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
who said that the rise of skywalker would be released two days before the publishing date after stating that it's going to be released on the twentieth?&lt;br /&gt;
&lt;br /&gt;
Re: Malloc, there was also a Darth Malak, the antagonist of Star Wars Knights of the Old Republic and a recurring character in the Old Republic comics [[Special:Contributions/172.69.69.244|172.69.69.244]] 02:08, 19 December 2019 (UTC)47.221.57.204&lt;br /&gt;
&lt;br /&gt;
Should something be linked to about diectric breakdown, or is that considered obvious in the context of, er, Force lightning?  Also, am I remembering right that Dark Helmet, in Spaceballs, wears a smaller helmet with a really big helmet over it?  Maybe not!  Robert Carnegie rja.carnegie@gmail.com [[Special:Contributions/141.101.98.250|141.101.98.250]] 02:48, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
There are a couple of posts to be found online that refer to &amp;quot;Darth Sebelius&amp;quot; in the context of Obamacare, but they're all on pretty niche forums.  --[[User:NotaBene|NotaBene]] ([[User talk:NotaBene|talk]]) 03:07, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Perchance generator: https://perchance.org/q3wi2jqf0j [[Special:Contributions/173.245.54.59|173.245.54.59]] 03:16, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
For a less US-centric view, the movie was released officially in France and Norway (and probably also other countries) already on the 18.12. (that is December 18). So &amp;quot;On December 20, 2019 [...], the final movie [...] will be released.&amp;quot; should say &amp;quot;[...] will be released in the US.&amp;quot;[[Special:Contributions/162.158.134.220|162.158.134.220]] 12:01, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Another generator: http://xkcd-2243.surge.sh/&lt;br /&gt;
&lt;br /&gt;
I don't know enough to add to the actual page, but the Sith car wash reminded me of this. Perhaps it was also part of the inspiration for it? https://www.cnet.com/roadshow/news/tesla-laser-windshield-wiper-patent/ [[Special:Contributions/141.101.69.35|141.101.69.35]] 15:28, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
&amp;quot;A New Hope&amp;quot; should just be called &amp;quot;Star Wars&amp;quot;. [[Special:Contributions/141.101.76.16|141.101.76.16]] 18:58, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
C#/LINQ: https://dotnetfiddle.net/r0JMJz&lt;br /&gt;
&lt;br /&gt;
The title text just means that there are more lightsaber brushes to hurt the heroes, right? [[Special:Contributions/162.158.106.78|162.158.106.78]] 22:32, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Is the Kyle Ren option a reference to being &amp;quot;A Kyle&amp;quot; (as defined at Urban Dictionary as &amp;quot;A Kyle is a young white man of low socio economic standing with a propensity to drink large quantities of Monster energy drink and do dumb stuff like punch holes in walls.&amp;quot;) After all, Kylo Ren did tend to get angry and break stuff? [[User:Mneimeyer|Mneimeyer]] ([[User talk:Mneimeyer|talk]]) 23:01, 19 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Is darth sebelius a reference to the sibelius composing software?&lt;br /&gt;
:I would think the Sibelous software (1993-present) would instead be a definite reference to the Finnish composer (1865-1957) already part-posited as a possible influence for the Darth.  Although I'd probably defer that suggestion in favour of the politician (1948-present, in direct politics until 2014?) even if I'd actually never heard of them from this side of The Pond. Still, there are weirder connections, so who knows? [[Special:Contributions/162.158.158.93|162.158.158.93]] 20:18, 21 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Please clarify the reference to Rey as a &amp;quot;Mary Sue.&amp;quot;  The linked article says that the only agreed on meaning for the term is that it is derogatory.  Other than that, it appears to mean different things to different people.  So it's inclusion here does not help explain the comic.  What is it about Rey that gave her that label.  Is it that she is not canon?  Is it that she is overpowered?  Probably better to just remove the Mary Sue jargon, and say whatever it is they say about those with other colored light sabers directly.  [[Special:Contributions/108.162.246.77|108.162.246.77]] 01:45, 22 December 2019 (UTC)&lt;br /&gt;
: While I'm not sure about Rey being entirely a Mary-Sue (in my mind an 'author avatar' character - whether or not a prime protagonist or ascending sidekick, they're just too competent for the role and often a Mcguffin baker), she definitely has more than a little plot-armour (and plot-weapon-skill) that I ''hope'', when I see the filmm (within a week, by current plans), bodes for something other than 2xrnd(trader(junk)) as patentage. Or something else that's actually awesome to get round that without being ''deus ex''.  But by dint of Windu's ''actor'' having been asked what colour of weapon he wanted (then him having requested what he did and then being granted it, - which might not have gone that far with less imaginative or influential actors) I'd count that as a very Mary-Sue-like thing, even if the rest of the badassness of that particular Jedi (the tone written prior to the resulting casting of the badass actor to fit) was just standard Major Supporting Character/Lancer fare.  But just my musings, nothing official... [[Special:Contributions/162.158.158.179|162.158.158.179]] 13:07, 22 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
I'm considering going through the table and adding a note for whether each thing is actually in Star Wars. would that be a good idea? [[Special:Contributions/172.68.141.136|172.68.141.136]] 06:48, 22 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
&amp;quot;Triggering the end credits before the movie is done&amp;quot; is a reference to the &amp;quot;Credits Warp&amp;quot; category in {{w|speedrun|video game speedrunning}}. Where a normal speedrun aims to clear the final level and/or defeat the final boss as fast as possible, a &amp;quot;Credits Warp&amp;quot; aims to gain {{w|arbitrary code execution}} and trigger the end credits without finishing the game. The most famous example is [https://youtu.be/9cBIgCy27JI Super Mario World in 45 seconds]. [[Special:Contributions/141.101.77.62|141.101.77.62]] 14:24, 23 December 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
I think the mouseover text is a reference to this scene in &amp;quot;Space Balls&amp;quot;: https://www.youtube.com/watch?v=ZXOAc5yt218  (&amp;quot;Space Balls&amp;quot; is a satire of several films, including the original &amp;quot;Star Wars&amp;quot; trilogy.)  In the &amp;quot;Space Balls&amp;quot; scene, the bad guys are using a robot to vacuum all the air out of the atmosphere of the planet.  The bad guys have the upper hand until the good guys are able to flip the switch on the vacuum cleaner.  &amp;quot;She's gone from 'suck' to 'blow'&amp;quot; is a fairly famous line in the movie.  I don't know enough &amp;quot;Star Wars&amp;quot; to understand the reference, but if you flip a car wash from &amp;quot;regular&amp;quot; to &amp;quot;premium&amp;quot; I assume the bristles/lightsaber blades would spin faster. [[User:Mattj256|Mattj256]] ([[User talk:Mattj256|talk]]) 21:07, 23 December 2019 (UTC)&lt;/div&gt;</summary>
		<author><name>162.158.91.77</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2299:_Coronavirus_Genome_2&amp;diff=191518</id>
		<title>2299: Coronavirus Genome 2</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2299:_Coronavirus_Genome_2&amp;diff=191518"/>
				<updated>2020-05-02T10:31:40Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.91.77: /* Infecting computers with DNA virusses is a thing, too. */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2299&lt;br /&gt;
| date      = April 27, 2020&lt;br /&gt;
| title     = Coronavirus Genome 2&lt;br /&gt;
| image     = coronavirus_genome_2.png&lt;br /&gt;
| titletext = [moments later, checking phone] Okay, I agree my posting it was weird, but it's somehow even more unnerving that you immediately liked the post.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a SANITIZED PHONE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.&lt;br /&gt;
&lt;br /&gt;
It is also a direct continuation of the previous comic, [[2298: Coronavirus Genome]], making this a [[:Category:Coronavirus Genome|new series]].&lt;br /&gt;
&lt;br /&gt;
[[Megan]] sent her copy of the coronavirus genome to [[Cueball]], who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the Internet, though not in a form that can actually make people sick with COVID-19 (which may seem obvious, but then some people [https://www.forbes.com/sites/brucelee/2020/04/09/5g-networks-and-covid-19-coronavirus-here-are-the-latest-conspiracy-theories/ believe 5G causes coronavirus].)  If his post catches on and is widely shared, it might be described as &amp;quot;going viral&amp;quot;.&lt;br /&gt;
Additionally while exchanging research data generally is as good a good idea as using readymade tools for science publishing the genome of a dangerous virus actually might cause the virus to spread further: There are specialized manufacturers that can mail you arbitrary DNA snippets if you send them their sequence as an ASCII file. That actually can work in the other direction, too: Some of the machines used by such firms in order to save space stored a base pair in 4 bits of memory and could (using a buffer overrun) be convinced to actually try to execute instead of manufacturing the DNA code.&lt;br /&gt;
&lt;br /&gt;
In continuation of the previous strip, Cueball appears to be fascinated by the fact that the entire genome of this very consequential virus can be fully detailed in a text file, using only 30,000 characters. He realizes that he can't fit this much information in a single tweet (Twitter has a 280 character limit), but is able to fit the entire genome in a Facebook post (Facebook allows [https://www.zdnet.com/article/facebook-increases-status-update-character-limit-to-63206/ up to 63,206 characters in a post]).  It could also be [https://twitter.com/TruePrimal/status/1255258879623139328 tweeted as an image].&lt;br /&gt;
&lt;br /&gt;
This strip draws humor from the contrast between the costly physical precautions that are being taken to prevent the spread of coronavirus between people and the blitheness with which Cueball attempts to share (the genome of) the coronavirus electronically.  Cueball's response (that it's okay, because he sanitized his phone before posting) could be taken as a sarcastic rebuttal, given that Megan sent the genome to him without knowing why he wanted it, or a commentary on the useless or counterproductive behaviors of clueless people (e.g. people who wear gloves before touching potentially-contaminated surfaces, but then scratch their noses while still wearing the possibly-contaminated gloves).  It could also be a reference to the ''{{w|The Hitchhiker's Guide to the Galaxy|Hitchhiker's Guide to the Galaxy}}'' series, in which humanity is revealed to possibly be the descendants of the &amp;quot;useless&amp;quot; occupants of the planet Golgafrincham, including telephone sanitizers; unfortunately, after sending their useless members to the planet later called Earth, the remaining Golgafrinchans were subsequently wiped out by a plague caught from an unsanitized telephone. This may also be a reference to the concept of digital data sanitization (the screening of user inputs to prevent exploitation of security flaws) as in [[327: Exploits of a Mom]].&lt;br /&gt;
&lt;br /&gt;
The title text deals with the almost inevitable outcome of the resulting message being 'liked' by some other party. In this case Megan, although she just told Cueball it was weird that he shared it. This may be a commentary on the common reflex to &amp;quot;like&amp;quot; your friend's posts, even if you think they're strange. Alternately, the &amp;quot;like&amp;quot; button on Facebook was historically the only way to signal a reaction to a post (other than actually commenting).  When someone posted about a bad event, such as an injustice, a tragedy, or a difficult personal event, people might &amp;quot;like&amp;quot; the post to indicate their support of the person posting it, but it could read as having positive feelings toward the incident itself.  (Facebook has since added multiple reaction buttons to express such emotions as surprise, sadness or anger).  In this case, Megan &amp;quot;like&amp;quot;ing the coronavirus genome could be taken to mean that she likes the virus itself, which would be quite odd.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.]&lt;br /&gt;
:Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?&lt;br /&gt;
:Megan: Sure.&lt;br /&gt;
:Megan: ...Why?&lt;br /&gt;
&lt;br /&gt;
:[Megan has turned to her her laptop typing on it, Cueball is off-panel.]&lt;br /&gt;
:Cueball (off-panel): Nothing.&lt;br /&gt;
:Megan: I ... see.&lt;br /&gt;
:Megan: Well, here you go.&lt;br /&gt;
:Laptop: Click&lt;br /&gt;
&lt;br /&gt;
:[In &amp;quot;two&amp;quot; frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square &amp;quot;speech bubble&amp;quot; with a &amp;quot;speech line&amp;quot; going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.]&lt;br /&gt;
:Phone: &lt;br /&gt;
::GAAAGGTAAGATGGAGAGGCCTTGTC&amp;lt;span style=&amp;quot;background-color:pink&amp;quot;&amp;gt;CCTGGTTCAACGAGAA&amp;lt;/span&amp;gt;&lt;br /&gt;
::&amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;-29,602&amp;lt;/font&amp;gt; &amp;lt;font color=&amp;quot;skyblue&amp;quot;&amp;gt;(+)&amp;lt;/font&amp;gt; &amp;lt;span style=&amp;quot;background-color:skyblue; color:white&amp;quot;&amp;gt;Tweet&amp;lt;/span&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]&lt;br /&gt;
:Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post.&lt;br /&gt;
:Megan:  Unsettling that your first instinct is &amp;quot;share it online.&amp;quot;&lt;br /&gt;
:Cueball: It's cool, I sanitized my phone before posting.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:Coronavirus Genome]]&lt;br /&gt;
[[Category:Comics sharing name|Coronavirus Genome]]&lt;br /&gt;
[[Category:COVID-19]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Biology]]&lt;br /&gt;
[[Category:Social networking]]&lt;/div&gt;</summary>
		<author><name>162.158.91.77</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2299:_Coronavirus_Genome_2&amp;diff=191517</id>
		<title>2299: Coronavirus Genome 2</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2299:_Coronavirus_Genome_2&amp;diff=191517"/>
				<updated>2020-05-02T10:28:32Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.91.77: /* Spreading non-computer virusses via the internet is actually a thing. */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2299&lt;br /&gt;
| date      = April 27, 2020&lt;br /&gt;
| title     = Coronavirus Genome 2&lt;br /&gt;
| image     = coronavirus_genome_2.png&lt;br /&gt;
| titletext = [moments later, checking phone] Okay, I agree my posting it was weird, but it's somehow even more unnerving that you immediately liked the post.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a SANITIZED PHONE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.&lt;br /&gt;
&lt;br /&gt;
It is also a direct continuation of the previous comic, [[2298: Coronavirus Genome]], making this a [[:Category:Coronavirus Genome|new series]].&lt;br /&gt;
&lt;br /&gt;
[[Megan]] sent her copy of the coronavirus genome to [[Cueball]], who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the Internet, though not in a form that can actually make people sick with COVID-19 (which may seem obvious, but then some people [https://www.forbes.com/sites/brucelee/2020/04/09/5g-networks-and-covid-19-coronavirus-here-are-the-latest-conspiracy-theories/ believe 5G causes coronavirus].)  If his post catches on and is widely shared, it might be described as &amp;quot;going viral&amp;quot;.&lt;br /&gt;
Additionally while exchanging research data generally is as good a good idea as using readymade tools for science publishing the genome of a dangerous virus actually might cause the virus to spread further: There are specialized manufacturers that can mail you arbitrary DNA snippets if you send them their sequence as an ASCII file.&lt;br /&gt;
&lt;br /&gt;
In continuation of the previous strip, Cueball appears to be fascinated by the fact that the entire genome of this very consequential virus can be fully detailed in a text file, using only 30,000 characters. He realizes that he can't fit this much information in a single tweet (Twitter has a 280 character limit), but is able to fit the entire genome in a Facebook post (Facebook allows [https://www.zdnet.com/article/facebook-increases-status-update-character-limit-to-63206/ up to 63,206 characters in a post]).  It could also be [https://twitter.com/TruePrimal/status/1255258879623139328 tweeted as an image].&lt;br /&gt;
&lt;br /&gt;
This strip draws humor from the contrast between the costly physical precautions that are being taken to prevent the spread of coronavirus between people and the blitheness with which Cueball attempts to share (the genome of) the coronavirus electronically.  Cueball's response (that it's okay, because he sanitized his phone before posting) could be taken as a sarcastic rebuttal, given that Megan sent the genome to him without knowing why he wanted it, or a commentary on the useless or counterproductive behaviors of clueless people (e.g. people who wear gloves before touching potentially-contaminated surfaces, but then scratch their noses while still wearing the possibly-contaminated gloves).  It could also be a reference to the ''{{w|The Hitchhiker's Guide to the Galaxy|Hitchhiker's Guide to the Galaxy}}'' series, in which humanity is revealed to possibly be the descendants of the &amp;quot;useless&amp;quot; occupants of the planet Golgafrincham, including telephone sanitizers; unfortunately, after sending their useless members to the planet later called Earth, the remaining Golgafrinchans were subsequently wiped out by a plague caught from an unsanitized telephone. This may also be a reference to the concept of digital data sanitization (the screening of user inputs to prevent exploitation of security flaws) as in [[327: Exploits of a Mom]].&lt;br /&gt;
&lt;br /&gt;
The title text deals with the almost inevitable outcome of the resulting message being 'liked' by some other party. In this case Megan, although she just told Cueball it was weird that he shared it. This may be a commentary on the common reflex to &amp;quot;like&amp;quot; your friend's posts, even if you think they're strange. Alternately, the &amp;quot;like&amp;quot; button on Facebook was historically the only way to signal a reaction to a post (other than actually commenting).  When someone posted about a bad event, such as an injustice, a tragedy, or a difficult personal event, people might &amp;quot;like&amp;quot; the post to indicate their support of the person posting it, but it could read as having positive feelings toward the incident itself.  (Facebook has since added multiple reaction buttons to express such emotions as surprise, sadness or anger).  In this case, Megan &amp;quot;like&amp;quot;ing the coronavirus genome could be taken to mean that she likes the virus itself, which would be quite odd.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.]&lt;br /&gt;
:Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?&lt;br /&gt;
:Megan: Sure.&lt;br /&gt;
:Megan: ...Why?&lt;br /&gt;
&lt;br /&gt;
:[Megan has turned to her her laptop typing on it, Cueball is off-panel.]&lt;br /&gt;
:Cueball (off-panel): Nothing.&lt;br /&gt;
:Megan: I ... see.&lt;br /&gt;
:Megan: Well, here you go.&lt;br /&gt;
:Laptop: Click&lt;br /&gt;
&lt;br /&gt;
:[In &amp;quot;two&amp;quot; frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square &amp;quot;speech bubble&amp;quot; with a &amp;quot;speech line&amp;quot; going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.]&lt;br /&gt;
:Phone: &lt;br /&gt;
::GAAAGGTAAGATGGAGAGGCCTTGTC&amp;lt;span style=&amp;quot;background-color:pink&amp;quot;&amp;gt;CCTGGTTCAACGAGAA&amp;lt;/span&amp;gt;&lt;br /&gt;
::&amp;lt;font color=&amp;quot;red&amp;quot;&amp;gt;-29,602&amp;lt;/font&amp;gt; &amp;lt;font color=&amp;quot;skyblue&amp;quot;&amp;gt;(+)&amp;lt;/font&amp;gt; &amp;lt;span style=&amp;quot;background-color:skyblue; color:white&amp;quot;&amp;gt;Tweet&amp;lt;/span&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]&lt;br /&gt;
:Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post.&lt;br /&gt;
:Megan:  Unsettling that your first instinct is &amp;quot;share it online.&amp;quot;&lt;br /&gt;
:Cueball: It's cool, I sanitized my phone before posting.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:Coronavirus Genome]]&lt;br /&gt;
[[Category:Comics sharing name|Coronavirus Genome]]&lt;br /&gt;
[[Category:COVID-19]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Biology]]&lt;br /&gt;
[[Category:Social networking]]&lt;/div&gt;</summary>
		<author><name>162.158.91.77</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2301:_Turtle_Sandwich_Standard_Model&amp;diff=191516</id>
		<title>2301: Turtle Sandwich Standard Model</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2301:_Turtle_Sandwich_Standard_Model&amp;diff=191516"/>
				<updated>2020-05-02T10:24:06Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.91.77: /* Explanation: The standard particle model could be as wrong as the one presented here. */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2301&lt;br /&gt;
| date      = May 1, 2020&lt;br /&gt;
| title     = Turtle Sandwich Standard Model&lt;br /&gt;
| image     = turtle_sandwich_standard_model.png&lt;br /&gt;
| titletext = It's possible the bread and shell can be split into a top and bottom flavor, and some models additionally suggest Strange Bread and Charm Shells.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a TURTLE EATING A SANDWICH. The original explanation was obviously erroneous and needs to be replaced. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
This comic references particle physics. The {{w|Standard Model}} of physics explains the base particles and fields that make up the universe, including the quarks, which have six flavors: up, down, top, bottom, strange, charm. While much of the theory was written earlier on, it took a long time for experiments to catch up. Hence, there were many particles that were theorized to exist, but had not yet been found yet, like the two unconfirmed turtle/sandwich mixes.&lt;br /&gt;
&lt;br /&gt;
As parts of the standard model are still missing it is theoretically possible that the standard particle model is as wrong as the model that sandwichs and turtles are made of combinations of 4 interchangeable parts.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:[A two-by-two grid, with a piece of bread next to the top left cell; a turtle shell next to the bottom left cell; lettuce, cheese, and tomato above the top left cell; and an turtle head enclosed in a circle above the top right cell.]&lt;br /&gt;
&lt;br /&gt;
:[Top left cell: an image of a sandwich.]&lt;br /&gt;
✔ CONFIRMED&lt;br /&gt;
&lt;br /&gt;
:[Top right cell: an image of a shell-less turtle sandwiched between two slices of bread.]&lt;br /&gt;
(?)&lt;br /&gt;
&lt;br /&gt;
:[Bottom left cell: an image of a turtle shell housing lettuce, cheese, and tomato - the contents of a sandwich.]&lt;br /&gt;
(?)&lt;br /&gt;
&lt;br /&gt;
:[Bottom right cell: an image of a turtle.]&lt;br /&gt;
✔ CONFIRMED&lt;br /&gt;
&lt;br /&gt;
:[Caption below the panel]&lt;br /&gt;
Our lab is working to detect the two missing pieces of the turtle-sandwich standard model.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Science]]&lt;br /&gt;
[[Category:Physics]]&lt;/div&gt;</summary>
		<author><name>162.158.91.77</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1999:_Selection_Effect&amp;diff=158052</id>
		<title>1999: Selection Effect</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1999:_Selection_Effect&amp;diff=158052"/>
				<updated>2018-05-31T07:11:16Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.91.77: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;noinclude&amp;gt;:''&amp;quot;1999&amp;quot;, this comic's number, redirects here. For the comic named &amp;quot;1999&amp;quot;, see [[855: 1999]].''&amp;lt;/noinclude&amp;gt;&lt;br /&gt;
&lt;br /&gt;
{{comic&lt;br /&gt;
| number    = 1999&lt;br /&gt;
| date      = May 28, 2018&lt;br /&gt;
| title     = Selection Effect&lt;br /&gt;
| image     = selection_effect.png&lt;br /&gt;
| titletext = fMRI testing showed that subjects who don't agree to participate are much more likely to escape from the machine mid-scan.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
&lt;br /&gt;
The title refers to the effect in scientific fields where instead of investigating the whole population (i.e. ''all'' cancer patients or ''all'' trees) only a subset is analysed. This is common practice as the analysis of all specimens is often impractical. However, special care needs to be taken when selecting the sample to ensure that it accurately represents the general population. Otherwise the results are misleading and do not reflect reality. For example if 1000 people are asked about the numbers of cars they own but all live in a city the results cannot be generalised to the whole country. This is called the {{w|selection bias}}. If non-human subjects are studied this can be avoided by randomising the selection process, but this is not possible with humans as they cannot be forced to participate in a study against their will. For example, if people are asked to participate in a study about their political views it is likely that the responders care about politics while people with no clear opinion do not bother to respond. This is called the {{w|self-selection bias}}.&lt;br /&gt;
&lt;br /&gt;
[[Ponytail]] says that people who agree to be in a study at their lab are less likely to attempt to escape. The only way Ponytail could have come to this conclusion is if she compared those people to people who did not agree to be in the study. This implies that Ponytail has recently kidnapped people for a study, and that most of the people she kidnapped called the police, as one should do when being kidnapped. This makes sense, since if you agreed to the study, you know why you are there, while if you didn't, you may have been kidnapped. As Ponytail presents this as a finding, it appears that she was attempting to establish a protocol for randomised selection of human subjects and comparing it to the normal selection process.&lt;br /&gt;
&lt;br /&gt;
The comic shows Ponytail being allowed to present the results of this study at a conference; reputable scientific journals and conferences should not legitimize studies that clearly violate their ethical norms, such as by failing to obtain informed consent from human subjects before experimenting on them. Unfortunately, involuntary studies are published and presented, like this 2014 [http://america.aljazeera.com/articles/2014/6/30/facebook-ethics-labratsemotionalcontagion.html Facebook's emotional contagion study]. It is not clear how many people who did agree to participate may have attempted to call the police for assistance regardless; compare the {{w|Stanford Prison Experiment}}. This is similar to previous comics where obvious things are presented in obfuscated, scientific ways (e.g. [[1990: Driving Cars]]).&lt;br /&gt;
&lt;br /&gt;
The title text refers to a technique that measures brain activity, called {{w|Functional magnetic resonance imaging|Functional magnetic resonance imaging (fMRI)}}. The willingness to participate is here probably detected by a machine. And of course it's much more likely that those people will resist and escape before the scan is complete.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Ponytail stands on a podium giving a presentation in front of a chart with some box plots.]&lt;br /&gt;
:Ponytail: Our research shows that compared to the overall population, people who agree to participate in scientific studies are significantly less likely to call the police to rescue them from our lab.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Ponytail]]&lt;br /&gt;
[[Category:Science]]&lt;/div&gt;</summary>
		<author><name>162.158.91.77</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1999:_Selection_Effect&amp;diff=158051</id>
		<title>1999: Selection Effect</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1999:_Selection_Effect&amp;diff=158051"/>
				<updated>2018-05-31T07:08:30Z</updated>
		
		<summary type="html">&lt;p&gt;162.158.91.77: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;noinclude&amp;gt;:''&amp;quot;1999&amp;quot;, this comic's number, redirects here. For the comic named &amp;quot;1999&amp;quot;, see [[855: 1999]].''&amp;lt;/noinclude&amp;gt;&lt;br /&gt;
&lt;br /&gt;
{{comic&lt;br /&gt;
| number    = 1999&lt;br /&gt;
| date      = May 28, 2018&lt;br /&gt;
| title     = Selection Effect&lt;br /&gt;
| image     = selection_effect.png&lt;br /&gt;
| titletext = fMRI testing showed that subjects who don't agree to participate are much more likely to escape from the machine mid-scan.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
&lt;br /&gt;
The title refers to the effect in scientific fields where instead of investigating the whole population (i.e. ''all'' cancer patients or ''all'' trees) only a subset is analysed. This is common practice as the analysis of all specimens is often impractical. However, special care needs to be taken when selecting the sample to ensure that it accurately represents the general population. Otherwise the results are misleading and do not reflect reality. For example if 1000 people are asked about the numbers of cars they own but all live in a city the results cannot be generalised to the whole country. This is called the {{w|selection bias}}. If non-human subjects are studied this can be avoided by randomising the selection process, but this is not possible with humans as they cannot be forced to participate in a study against their will. For example, if people are asked to participate in a study about their political views it is likely that the responders care about politics while people with no clear opinion do not bother to respond. This is called the {{w|self-selection bias}}.&lt;br /&gt;
&lt;br /&gt;
[[Ponytail]] says that people who agree to be in a study at their lab are less likely to attempt to escape. The only way Ponytail could have come to this conclusion is if she compared those people to people who did not agree to be in the study. This implies that Ponytail has recently kidnapped people for a study, and that most of the people she kidnapped called the police, as one should do when being kidnapped. This makes sense, since if you agreed to the study, you know why you are there, while if you didn't, you may have been kidnapped. As Ponytail presets this as a finding it appears that she was attempting to establish a protocol for randomised selection of human subjects and comparing it to the normal selection process.&lt;br /&gt;
&lt;br /&gt;
The comic shows Ponytail being allowed to present the results of this study at a conference; reputable scientific journals and conferences should not legitimize studies that clearly violate their ethical norms, such as by failing to obtain informed consent from human subjects before experimenting on them. Unfortunately, involuntary studies are published and presented, like this 2014 [http://america.aljazeera.com/articles/2014/6/30/facebook-ethics-labratsemotionalcontagion.html Facebook's emotional contagion study]. It is not clear how many people who did agree to participate may have attempted to call the police for assistance regardless; compare the {{w|Stanford Prison Experiment}}. This is similar to previous comics where obvious things are presented in obfuscated, scientific ways (e.g. [[1990: Driving Cars]]).&lt;br /&gt;
&lt;br /&gt;
The title text refers to a technique that measures brain activity, called {{w|Functional magnetic resonance imaging|Functional magnetic resonance imaging (fMRI)}}. The willingness to participate is here probably detected by a machine. And of course it's much more likely that those people will resist and escape before the scan is complete.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Ponytail stands on a podium giving a presentation in front of a chart with some box plots.]&lt;br /&gt;
:Ponytail: Our research shows that compared to the overall population, people who agree to participate in scientific studies are significantly less likely to call the police to rescue them from our lab.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Ponytail]]&lt;br /&gt;
[[Category:Science]]&lt;/div&gt;</summary>
		<author><name>162.158.91.77</name></author>	</entry>

	</feed>