explain xkcd - User contributions [en]

2298: Coronavirus Genome

2020-05-05T01:21:00Z

172.68.255.158: /* Explanation */

{{comic
| number = 2298
| date = April 24, 2020
| title = Coronavirus Genome
| image = coronavirus_genome.png
| titletext = Spellcheck has been great, but whoever figures out how to get grammar check to work is guaranteed a Nobel.
}}

==Explanation==
{{incomplete|Created by a NOBEL IN SPELLCHECKING. Do NOT delete this tag too soon.}}
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.

It was also the first in a [[:Category:Coronavirus Genome|new series]], followed in the next comic by [[2299: Coronavirus Genome 2]].

[[Megan]] is a {{w|Genetics|geneticist}} doing research on the SARS-CoV-2 virus. She is analyzing the virus's {{w|genome}}, its genetic material composed of {{w|RNA}}. The genomic sequence can be represented as a list of {{w|nucleotide}} bases ({{w|guanine}}, {{w|adenine}}, {{w|cytosine}}, {{w|thymine}} and {{w|uracil}} - often abbreviated as G, A, C, T, and U).

The nucleotide sequence displayed is a 100% match to six SARS-CoV-2 sequences in public databases, all of them originating from the East Coast of the United States. The sequence is from nucleotides 26202-26280 of the virus genome and overlaps an unknown open reading frame/gene named ORF3a. One of the matching sequences is [https://www.ebi.ac.uk/ena/data/view/MT344963]. However, SARS-CoV-2 is an RNA-virus, and so its genetic material (not containing any DNA) would not include thymine (T) but would use uracil (U) instead. The sequence uses the codes of DNA as {{w|RNA sequencing}} involves copying the genome into a DNA, and the DNA code is more familiar anyways.

[[Cueball]] is surprised that Megan and her colleagues actually use {{w|Microsoft Notepad}}, a simple {{w|text editor}}, to look at the genome, instead of more modern technology. She explains that better research institutions use {{w|Microsoft Word}}, a more advanced editor, to allow additional formatting (such as '''bolding''' and ''italics''), and humorously calls this "{{w|epigenetics}}". In the real world, epigenetics is the study of changes that are not caused by changes in nucleotides, but by chemical modifications of DNA or chromosomes that cause changes in patterns of gene expression and activation, sometimes several generations down. This might be considered analogous to altering the meaning of a text by changing its formatting rather than the content; for example, content can be moved into parentheses or footnotes to be de-emphasized, or rendered in boldface or enlarged to attract attention and emphasize key points. Much as text can be wrapped in HTML tags or similar markup to change its formatting, nucleotides can be {{w|DNA methylation|methylated}} to prevent transcription, and the {{w|histone}}s around which DNA is wound can also be modified to promote or repress gene expression. During DNA replication, these modifications are often also reproduced.

The real punchline comes when Megan uses {{w|Spell checker|spellcheck}} to detect mutations in the genome by adding the previous genome to spellcheck and comparing them. Overall, Megan uses ridiculously and humorously crude methods to analyze a major genetic item. The genome of SARS-CoV-2 is almost 30,000 base-pairs long, which exceeds the {{w|longest words}} of any natural language by two orders of magnitude (the longest words ever used in literature -- i.e. not constructed in isolation simply for the purpose of being a long word, or chemical formulas -- approach 200 letters), and may exceed the capabilities of any available spell-checking program. Furthermore, a spellcheck program underlines the whole word if a single letter is wrong and not just the letter itself. Thus, it would not be able to highlight individual mutated base pairs. Megan might be better served by using a {{w|diff}} tool, but most scientists generally use commercial software that is designed to view, annotate and edit DNA sequences (eg: Snapgene, Geneious, DNAstrider, ApE).

The title text mentions {{w|Grammar checker|grammar checking}} and claims that whoever discovers how to use that to compare genomic material should be awarded a {{w|Nobel Prize}}. Spell-checking is analogous to comparing sequences against ones previously known, an activity which is the bread and butter of bioinformatics nowadays. Grammar checking would be analogous to having some sort of sense as to how well all the sequences generally cooperate and interact to create possibly viable functionality in an organism, something we are unable to do at the moment except in very limited ways and only in a few simple cases. It may also be a snarky commentary on the untrustworthy nature of grammar-check programs in general, which often follow grammatical rules far more strictly than is practical, especially in English (whose grammatical rules are numerous and often contradictory); it's not uncommon for an author to follow a grammar-check recommended correction only to find the corrected portion is now part of a longer portion that the checker deems "incorrect".

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.]
:Cueball (off-screen): So that's the coronavirus genome, huh?
:Megan: It is!
:Laptop: TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA

:[Cueball walks up and stands behind Megan, still working on the laptop.]
:Cueball: It's weird that you can just look at it in a text editor.
:Megan: It's essential!
:Megan: We geneticists do most of our work in Notepad.

:[A frameless panel, Cueball still standing behind Megan.]
:Cueball: Notepad?
:Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic.
:Cueball: Ah, okay.
:Megan: That extra formatting is called "epigenetics".

:[A regular panel, Cueball still stands behind Megan. Megan rests her arm on the chair. He has his hand on his chin.]
:Cueball: Hey, why does that one have a red underline?
:Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations.
:Cueball: ''Clever!''

{{comic discussion}}

[[Category:Coronavirus Genome]]
[[Category:Comics sharing name|Coronavirus Genome]]
[[Category:COVID-19]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Biology]]

Talk:1960: Code Golf

2018-02-28T14:20:08Z

172.68.255.158:

What's the programming language? It seems to me like a special reverse golf variant of Python, where <code>def</code> is replaced by <code>define</code>, just to make it longer. Or is there a real language with that syntax? --[[Special:Contributions/172.68.110.106|172.68.110.106]] 08:40, 26 February 2018 (UTC)
: Lisp/some derivatives (I'm most familiar with scheme) use <code>define<define></code> as does Slate, however both have a different syntax. Most likely, this is just pseudo-code. [[User:Baldrickk|Baldrickk]] ([[User talk:Baldrickk|talk]]) 09:59, 26 February 2018 (UTC)

Definitely going to have to include a link to the actual longest language: Unary, which is literally just a certain length of 1s. No one actually writes in it: you write in another language and then it gets converted. [[User:Trlkly|Trlkly]] ([[User talk:Trlkly|talk]]) 10:48, 26 February 2018 (UTC)
: You could make a longer programming language by representing "1" with some longer string; perhaps the entire text of Moby Dick. And now the file size can be arbitrarily big. [[Special:Contributions/198.41.230.100|198.41.230.100]] 16:45, 26 February 2018 (UTC)
:: Though this idea is still quite compressible. It might be better (?) to make a language where the file size cannot be easily significantly compressed.[[Special:Contributions/172.68.25.106|172.68.25.106]] 16:48, 26 February 2018 (UTC)

This might be directed at a code golfing challenge currently taking place: https://codegolf.stackexchange.com/questions/152856/write-moby-dick-approximately. The goal is to write a program that outputs a text, that is as closly as possible to moby dick, while no containing it, and of course beeing as small as possible.[[Special:Contributions/141.101.105.150|141.101.105.150]] 13:04, 26 February 2018 (UTC)

Not sure why JSFuck is included in the explanation. Not sure how it really has any relevance here as it is not mentioned in the text and is not the programming language being used by Randall in the comic. [[Special:Contributions/108.162.216.94|108.162.216.94]] 13:18, 26 February 2018 (UTC)

: agreed, JSFuck is not relevant in the explanation. moved it to the discussion (see below) [[User:Thawn|Thawn]] ([[User talk:Thawn|talk]]) 13:56, 26 February 2018 (UTC)

:: Instead of {{w|Python (programming language)|Python}}, one could use {{w|JSFuck}} though, which is valid {{w|JavaScript}} code - but written with only six different characters. Even mundane variable names like `LowestDenominator` will take up hundreds, if not thousands, of bytes in JSFuck. {{unsigned|Comment Police}}
: I added it because JSFuck allows you to write you simple and useful tasks with zillions of bytes, each of which is needed for the programm to run correctly. It's the ultimate Reverse Coding Golf.--[[Special:Contributions/172.68.50.178|172.68.50.178]] 13:53, 27 February 2018 (UTC)
Off Topic: I just realized that statistical thermodynamics is nothing else than reverse molecule golf: The entropy of a given system is equal to the maximum score you can achieve in reverse molecule golf. [[User:Thawn|Thawn]] ([[User talk:Thawn|talk]]) 13:56, 26 February 2018 (UTC)

Seems like Java programmers play this game all the time.[[Special:Contributions/162.158.234.100|162.158.234.100]] 20:13, 26 February 2018 (UTC)

Someone made everyone's comments monospaced. Please fix this. [[Special:Contributions/198.41.230.100|198.41.230.100]] 14:24, 26 February 2018 (UTC)
:Fixed [[Special:Contributions/162.158.155.26|162.158.155.26]] 15:52, 26 February 2018 (UTC)
:They just wanted to play reverse comments golf with the comments section by making the comments take as much space as possible. [[Special:Contributions/162.158.126.76|162.158.126.76]] 15:56, 26 February 2018 (UTC)

This is called Code Bowling.

I would like to point out that there may be a ReCaptcha site shutdown? It will occur on the 1st of March (maybe). [[User:QATEKLYXM|QATEKLYXM]]

Is the explanation thinking of miniature golf when it mentions a hedge or border and the need for a ramp? In actual golf you can easily hit the ball through the air with almost every single club...and just as easily hit it off of the golf course.
[[[Special:Contributions/172.69.62.64|172.69.62.64]] 15:11, 27 February 2018 (UTC)]

Curious Georges also likes Reverse Regular Golf! [[Special:Contributions/108.162.237.232|108.162.237.232]] 02:18, 28 February 2018 (UTC)

I found this xkcd confusing because there appears to be no obvious limiting principal. The code in the panel is written verbosely, but it could easily be a word longer, a paragraph longer, a page longer, a chapter longer, an entire book longer. Nor is skill (or chance!) particularly required to do such a thing [I suppose in "blinded reverse code golf" the question might be to guess how much length your opponents would bother to express and then to top that]. The result is I feel confused. Maybe my standards for humor are too high, but maybe, also, I'm just missing something here? [[User:JohnHawkinson|JohnHawkinson]] ([[User talk:JohnHawkinson|talk]]) 12:02, 28 February 2018 (UTC)
: +1 [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 12:07, 28 February 2018 (UTC)

No mention of The International Obfuscated C Code Contest? It's about as close to reverse code golf as there is. [[Special:Contributions/172.68.255.158|172.68.255.158]] 14:20, 28 February 2018 (UTC)