explain xkcd - User contributions [en]

Talk:2637: Roman Numerals

2022-06-28T20:43:10Z

172.70.85.211:

Immediately came to this site as soon as the comic popped up [[Special:Contributions/172.70.114.43|172.70.114.43]] 22:43, 24 June 2022 (UTC)

For anyone wondering about the alt text: "CheCk out thIs InnoVatIVe strIng enCoDIng IVe been DeVeLopIng! It's VIrtuaCy perfeCt! ...hang on, what's a "virtuacy"?" Roman numerals are in uppercase. : [[Special:Contributions/162.158.90.209|162.158.90.209]] 23:00, 24 June 2022 (UTC)
:I didn't see this comment, but I decoded it above. Feel free to update with your text, which includes the casing.
::It should be virtually - LL is 50 50, C is 100. [[Special:Contributions/172.70.110.121|172.70.110.121]] 00:37, 25 June 2022 (UTC)
:By the way, this encoding is not that innovative: back when Roman numbers still meant something to people they were oftentimes hidden inside inscriptions on churches and monuments. If you ever stand in front of a church and wonder why certain letters in a sentence of an inscription are capitalized seemingly at random, this may be the reason. --[[Special:Contributions/172.70.250.231|172.70.250.231]] 06:12, 25 June 2022 (UTC)
::The (almost) exact encoding style of the alt text also was used before, e.g. in works of fiction - the first I can think of is Howard Taylor's Schlock Mercenary (used for AI names) [[Special:Contributions/172.70.242.45|172.70.242.45]] 13:41, 25 June 2022 (UTC)

Relevant OEIS entry: https://oeis.org/A093788 [[Special:Contributions/162.158.129.117|162.158.129.117]] 23:43, 24 June 2022 (UTC)

Well, I immediately got the comic, when I saw it, but (though I admire the effort put in) the explanation that seems to have been given is... overly long, IMO. I have no wish to invalidate all the thought put into it, but I really feel it says too much. Even by my standards (I'm often a waffler, as I 'improve' the accuracy and all-inclusiveness of such text). But don't want to rain on the existing author(s) parade, myself, so just sayin'... [[Special:Contributions/162.158.159.15|162.158.159.15]] 02:01, 25 June 2022 (UTC)
:It's not overly long if someone spent the time writing it. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 02:10, 25 June 2022 (UTC)
::I wondered too when first reading but like it geeky like that. --[[Special:Contributions/172.68.50.15|172.68.50.15]] 05:37, 25 June 2022 (UTC)
:I've repeatedly had my edits, longer and shorter, reverted completely away. I've occasionally started the same to manage the experience. Your opinion is a breathe of fresh air but I wouldn't be worried about increases in quality that shorten the text. One can even leave concepts in by replacing them with links. [[Special:Contributions/172.70.110.241|172.70.110.241]] 12:01, 26 June 2022 (UTC)
::One thing you learn, when contributing to a wiki, is that you better be prepared to [https://www.masterclass.com/articles/what-does-it-mean-to-kill-your-darlings Kill Your Darlings], or have them killed by others. The many's the time I've written something I'm (eventually) quite pleased about, but it gets wiped out either by someone disagreeing with my particular form of self-satisfaction, or just completely rearranging things and either crashing through the carefully crafted copy or ruthlessly removing my radient repartee. But such is life...
:And often I feel that whoever got in there with the first footprint of explanation has ''not'' done it the way I would (surprisingly often I had the same idea, but obviously there are so many ways to do it... but here I may disagree entirely rather than "I'll happily work with it, then, however different it is...") and I might be ''very'' tempted to replace it wholesale. I don'5 think I have ever done so, but I might tweak it a ''lot'', in bits and pieces. It may still upset an OP who finds it bears little relationship to what they submitted, but I try never to do anything beyond the general hum of the community. Coward that I am. But it can happen to anyone. [[Special:Contributions/172.70.86.44|172.70.86.44]] 17:01, 26 June 2022 (UTC)
:I'm not sure about 'overly long', but as it stands it takes an awfully long time to come to the point. I'd be inclined to lift the basic explanation (roughly equating to the paragraph starting 'The joke is...') to the top, and only after that dive into the niceties of how each system works and what specifically is going on in the examples in the comic. [[Special:Contributions/172.70.91.58|172.70.91.58]] 09:11, 27 June 2022 (UTC)

I, in a rather faint and not really concerned way, object to the use of the phrase 'archaic' with regard to Roman Numerals. That would imply that they aren't in use at all, whereas when I look around me I can see a number of examples of current usage of Roman Numerals, e.g. Clock Faces, Chapter Numbering (some books) and the most important, the 'Manufacture Date' of a televisual programme from the BBC shown at the bottom of the end-credits. I believe a better phrase may be 'venerable' or 'historical' or 'unmodern'.
[[Special:Contributions/172.70.162.5|172.70.162.5]] 07:46, 25 June 2022 (UTC)
:I was also thinking that. But maybe qualified as "archaic but still commonly seen" (or similar), were my thoughts. I was wondering if it was a local perspective, though. 'Historical' US usage is rather sparser, I imagine, than the accumulation of Old World monuments/etc, from deeper back into the times it was more usual, so making only the "stylstically old" things predominantly use them (certain clock faces, etc). Meanwhile, even our programmes broadcast on the BBC still regularly close with the date in letters (anything from this year is "MMXXII") on the final frame/line of the credits, while our other broadcasters go with contemporary numerals in the same context. (I wonder, was 1999 "MIMIC", rather than "MCMXCIX"..? I think it was...) [[Special:Contributions/141.101.98.221|141.101.98.221]] 11:58, 25 June 2022 (UTC)
::In mathematics, Roman numerals are archaic (obsolete, no longer in active use), common use is just for numbering (monarchs - themselves a somewhat archaic concept, generations of using the same name, events, sequels, volumes, paragraphs or appendices, etc.) or very occasionally for years (e.g. of construction) - "archaic" is correct even if you mean from the/an archaic period which may be the period when a civilization built the foundation for a later "classical" period ("Golden Age") (some exemptions may apply) or specifically the time of the Greek archaic era leading up to Classical (Hellenic) Greece, usually defined some time between about 800 and 480 BCE (they did (probably) originate from the Roman archaic period which overlaps with the Greek one) [[Special:Contributions/172.70.242.45|172.70.242.45]] 13:41, 25 June 2022 (UTC)
::I recall that, while many 1999 films correctly used "MCMXCIX" at the end of their credit rolls, there was at least one that instead went with "MIM". Can't remember what it was, though. Also, MIMIC would be ''completely'' wrong, as that would equate to 1000 + (1000 - 1) + (100 - 1), or 2098. [[User:Dansiman|Dansiman]] ([[User talk:Dansiman|talk]]) 18:22, 28 June 2022 (UTC)
:::I wondered when someone would spot the MIMIC error (later realised I was probably confusing myself with {{w|Mimic (film)}}, but it was hours later, not worth an edit). But, yay! At least someone else did... ;) [[Special:Contributions/172.70.85.211|172.70.85.211]] 20:43, 28 June 2022 (UTC)

In case anyone is interested, I created a small encoder/decoder program (Python+PyQt): https://gist.github.com/MaurizioB/6bedeca961b5152006d030f56f817a2f [[User:Musicamanate|Musicamanate]] ([[User talk:Musicamanate|talk]]) 17:05, 25 June 2022 (UTC)

It's rather ironic that the hindu/arabic numerals contain zero, while roman numerals don't. By mixing a zero into the roman numerals things get confusing.

Ran500a100s 5ers1on of th1s en100o501ng 1s 4st 100o1000p50ete50y 50a100k1ng. He's ob6o5s50y forgotten that the 50etters 1, 5 and 10 are rea100y 4st 5ar1ants of 1 and 5 an500 999 not e11st 1n the 150ass99a50 50at1n a50phabet. "10" 1n part144ar 1s a Ger1000an99 1nno5at1on!
(sorry, 1 4st 100o445n't res1st, tho5gh 1 ''al1000ost'' 11sh 1 ha500 - b5t 1 500ef1n1te50y 50o5e the 10or500 999 - aka "did" 1n 5nen100o500e500 10r1t1ng) --[[Special:Contributions/172.70.250.185|172.70.250.185]] 15:35, 27 June 2022 (UTC)
:I figured out that you treated "U" as identical to "V", "J" as identical to "I", and "W" as identical to "X", but I'm not sure why you encoded "couldn't" as "100o445n't" - V and L are never used as subtractors, so it should be something more like "100o550500n't" or maybe "100o555n't". [[User:Dansiman|Dansiman]] ([[User talk:Dansiman|talk]]) 18:47, 28 June 2022 (UTC)

"virtuammmmmly" is a perfectly cromulent word! [[Special:Contributions/172.70.82.3|172.70.82.3]] 18:23, 27 June 2022 (UTC)

Talk:2638: Extended NFPA Hazard Diamond

2022-06-28T16:20:29Z

172.70.85.211:

Are we going to try identifying what material this is? [[Special:Contributions/172.70.82.179|172.70.82.179]] 01:50, 28 June 2022 (UTC)
:first one off the top of my head, aqua regia? [[Special:Contributions/172.70.38.69|172.70.38.69]] 02:46, 28 June 2022 (UTC)Bumpf
::Doesn't aqua regia score a 0 in reactivity? [[User:N-eh|N-eh]] ([[User talk:N-eh|talk]]) 03:23, 28 June 2022 (UTC)
:My guess would be something radioactive, like uranium or plutonium. [[User:Clam|Clam]] ([[User talk:Clam|talk]]) 03:29, 28 June 2022 (UTC)
::There are very, very few Health 4 / Fire 0 / Instability 2 compounds. The NIH database lists 4: nitrous oxide, phosphorus oxychloride, phosphorous trichloride, and thionyl chloride (although it's important to note these values aren't always standardized; some authorities consider phosphorus oxychloride to be Health 3, for example). Based on the street value and the number of US agencies who would be concerned about it, my guess is thionyl chloride, a useful industrial chemical which is also used in at least one meth lab synthesis pathway... AND highly regulated as a chemical weapon precursor (to both sulfur mustard and G-series nerve agents). Oh, and it is absolutely a Disposal Pain 4 candidate, too. [[User:Qalyar|Qalyar]] ([[User talk:Qalyar|talk]]) 04:52, 28 June 2022 (UTC)
: It could be the drop ceiling - if it's even moderately unstable that would certainly make it a hazard; it would be a pain in the arse to dispose of; there are probably a few agencies with an interest building regs, etc. that would want to know about it. I'm not sure what kind of street price it would command, though. [[Special:Contributions/172.70.85.211|172.70.85.211]] 16:20, 28 June 2022 (UTC)

The center square is a free space, but if you win without it you get a special bonus prize. [[Special:Contributions/172.70.42.129|172.70.42.129]] 04:18, 28 June 2022 (UTC)

Given Randall's fixation with velociraptors, is anyone else thinking the "dropped ceiling" may be a reference to the labs in Jurassic Park?
:Possible. The first thing I had to think of was HalfLife (ie Black Mesa). [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 07:34, 28 June 2022 (UTC)

Does Randall watch Warsaw local news? Yesterday [https://tvn24.pl/tvnwarszawa/mokotow/warszawa-wilanow-ul-branickiego-straz-miejska-interweniowala-w-sprawie-walacego-sie-budynku-5766504 there was an article about an accident with dropped ceiling]. Accident with dropped ceiling next day on xkcd gave me uncanny feeling. [[User:Tkopec|Tkopec]] ([[User talk:Tkopec|talk]]) 09:31, 28 June 2022 (UTC)
:I was wondering whether the whole thing was inspired by the {{w|2022 Aqaba toxic gas leak}}, that it was published well within a day of. Probably not (because 'too soon', especially with deciding what humour to add, assuming he started from scratch) but he might well have heard of it even as he was already mid-way through the drawing/publishing process and felt it ok to press ahead (perhaps modified to make it ''less'' likely to be directly associated in some way).
:Not worth an in-explanation (or Trivia) mention, but saying it here as a dismissable aside. [[Special:Contributions/172.70.162.5|172.70.162.5]] 13:58, 28 June 2022 (UTC)

The "''Number of times it's caused one of those terrifying lab accidents that chemists tell scary stories about late at night -> 2''" reminds me of the [https://www.science.org/topic/blog-category/things-i-wont-work-with Things I Won't Work With] category on Derek's Lowe blog, including famous [https://www.science.org/content/blog-post/sand-won-t-save-you-time Sand Won't Save You This Time] article about dangers of chlorine trifluoride, with a few ''scary stories'' included. --[[User:JakubNarebski|JakubNarebski]] ([[User talk:JakubNarebski|talk]]) 11:04, 28 June 2022 (UTC)
:The "smelling weird" one made me remember the one about [https://www.science.org/content/blog-post/things-i-won-t-work-thioacetone thioacetone]--[[Special:Contributions/172.71.114.63|172.71.114.63]] 12:53, 28 June 2022 (UTC)

Talk:2636: What If? 2 Countdown

2022-06-24T08:50:51Z

172.70.85.211:

I've started the table to explain all the calendar entries. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 00:19, 23 June 2022 (UTC)

Is the dog minutes calculation backwards? 777,777 dog minutes should be 777,777 x 7 human minutes, which is over 10 years. Randall seems to be dividing instead of multiplying. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 00:36, 23 June 2022 (UTC)
: No - 1 human year = 7 dog years; 1 dog year = 1/7 human year; 1 dog minute = 1/7 human minute; 777,777 dog minutes = 111,111 human minutes = 77 days, 3 hours, 51 minutes. [[Special:Contributions/172.70.90.173|172.70.90.173]] 11:32, 23 June 2022 (UTC)

First entry is probably mistake by Randall, e^pi would give value of 84.5 [[Special:Contributions/162.158.203.38|162.158.203.38]] 11:57, 23 June 2022 (UTC)
: That would be too high, though. 82.xxx days (from midnight at the start of launch day) would fall within the 83rd day before it (Jun 22). 84.5 would fall within the 85th (Jun 20). [[Special:Contributions/172.70.91.58|172.70.91.58]] 12:15, 23 June 2022 (UTC)

Not sure if this is even worth mentioning, but he forgot the box around the date number in the top corner for August 29th. [[Special:Contributions/172.70.126.151|172.70.126.151]] 12:49, 23 June 2022 (UTC)

Fyi, used wolfram alpha for most of the calculations. Seems to be able to handle anything I throw at it (nanocenturies, megaseconds, fortnights etc) [[User:Aditya95sriram|Aditya95sriram]] ([[User talk:Aditya95sriram|talk]]) 13:02, 23 June 2022 (UTC)aditya95sriram

Some of the calculations done forward (assuming what Randall means as a Generation, for example) might be best done as "to get this many days, what does Randall think ilhe is starting from. And see if 365, 365.25 or even 365.24 days per year works best, where relevent. Although I think in many cases you'll find the fractional differences negligable, when done right. (I'm also a bit surprised by the off-by-one errors in days-to-go and derived value, but I suspect that this is because of [[2585: Rounding|assymetric rounding effects]] that would be revealed by running the assumption backwards and seeing how different (or otherwise) the decimals actually are.) [[Special:Contributions/172.70.85.211|172.70.85.211]] 13:32, 23 June 2022 (UTC)
: I would suggest using 365.2425 days per year, as that's consistent with current leap year conventions. [[User:Dansiman|Dansiman]] ([[User talk:Dansiman|talk]]) 21:49, 23 June 2022 (UTC)
:: Did not see your comment, but already done trivial replacement. No recalculation that goes more complicated than magnitude, though.
::(For the mathematically curious, in the Gregorian calendar it's normally 365 days, but a leap day every four years (+0.25 => 365.25), except no leap day every century (-0.01 => 365.24), except there is every fourth century (+0.0025 => 365.2425). Which is very very close to the more astronomically-precise figure of 365.2422, at least at this point in our planet's history and definitely over the timescale of the Gregorian calendar itself. ''edit-to-add-convoluted-musings'': A successor system ''might'' need to de-reinstate three of the Four-Millenial leap-days in every 10,000 year period, or perhaps by re-removing four of its various leap-days then re-reinstating one of ''those'' back again, but by the time it's relevent I doubt that 365.2422 is going to be as valid for whatever reason... Hey, by then, maybe we could just deliberately adjust the Earth in or out a bit to make it a better fraction/not a fraction at all! )
::On the other hand, the old adage is "no use being precise over imprecise details". One can perhaps apply it to nominal decades (the true average decade; though a given decade might be 10*365 days plus either ''two'' or ''three'' leap-days, for 3652.5±0.5 days in that instance... not equally likely each way, though) but the Generations calculation already ''assumes'' 27 years per generation (not even 27.5, exactly half way between 22 and 33, which already seems a dubious backformation to suit other purposes) and gets a good-enough ''approximate'' number. Using a factor precise to around 1 in 146000 alongside one that's unlikely to be even as accurate as 1 in 54 is a bit rich and overly anal (rather than analytic) in the long-run.
::But this is explainxkcd, so I'm not saying it's misplaced, just that those who would be pedantic about everything (myself included) might find themselves even more out-pedanted in very reasonable circumstances... ;) [[Special:Contributions/172.70.162.77|172.70.162.77]] 22:47, 23 June 2022 (UTC)

Not sure about most numbers but at least the order of magnitude seemed plausible. I can't quite find a proper way to read August 28th. π^π^π is roughly 80662.666 - if you read πcoseconds as "picoseconds", that's way less than a second. I have no idea what π * coseconds are supposed to be. π * c * o * seconds doesn't look much better - there are values associated with "c" (speed of light, for example) but I have no idea what "o" could be and certainly nothing that would make this a unit of time. Sixteen days would be 1,353,600,000,000,000,000 ps (picoseconds). π^π^π^π is three orders of magnitude too small, π^π^π^π^π is many orders of magnitude too big a number. Am I missing something (really obvious, maybe?) here? [[User:627235|627235]] ([[User talk:627235|talk]]) 14:52, 23 June 2022 (UTC)
: Exponent towers are by convention evaluated top-down, so pi^pi^pi should be read as pi^(pi^pi), which is ~1.34e18, which in picoseconds is ~15.51 days. [[Special:Contributions/172.70.114.71|172.70.114.71]] 15:21, 23 June 2022 (UTC)

10,000 minutes in Heaven is making out for a week. I was able to find a record for the longest kiss (58 hours, 35 minutes), but not the longest make-out session. I think Randall may be indulging in some nerdy wishfull thinking. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 15:27, 23 June 2022 (UTC)

When the beer song reached F(0) how would you 'take one down' from -1 bottles of beer? Would they be imaginary bottles of beer? (Joking) At F(n-1) would there be a matter/antimatter annihilation, where Randal could do a riff of What-If #1 and describe the play by play of the bartender turning into exotic forms of matter? [[Special:Contributions/172.69.68.88|172.69.68.88]] 15:58, 23 June 2022 (UTC)
:(Not ✓-1, it's just straight repeated subtraction, not a power function...) After so much beer, you probably think it a good idea (even necessary) to fill cans up and start to put them back up on the wall... Not sure you could sustain it, to the point of F(-99), but I think someone'd be more than ready to start the process when F(-1) is invoked, for any group of just a few likely individuals.. [[Special:Contributions/172.70.91.58|172.70.91.58]] 16:23, 23 June 2022 (UTC)
:This begs the question of what beer bottles are doing on a wall, rather than a shelf. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 16:26, 23 June 2022 (UTC)
: Randall already considered what happens at F(0), refer to the title text. [[User:Paddles|Paddles]] ([[User talk:Paddles|talk]]) 08:16, 24 June 2022 (UTC)
: If you wanted to take down an imaginary bottle of beer, you'd have to take it from another wall that runs orthogonal to the original wall. [[Special:Contributions/172.70.85.211|172.70.85.211]] 08:50, 24 June 2022 (UTC)

We've finally filled in all the units columns in the table. Hopefully someone can automate turning that into a transcript. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 16:51, 23 June 2022 (UTC)

Funfact: This comic mentions Cyndi Lauper by name, and it was published on her birthday… [[Special:Contributions/162.158.38.27|162.158.38.27]] 20:51, 23 June 2022 (UTC)

Looks like someone's math is wrong on the explanation for July 18. I calculated using 4681 and 4763 years and they came out to 51.29 days and 52.19 days, respectively. So then I worked backwards and determined that Randall would actually have to be using a number closer to 5200 years to arrive at the correct result of 57 days. [[User:Dansiman|Dansiman]] ([[User talk:Dansiman|talk]]) 21:49, 23 June 2022 (UTC)

Randall seems to be wrong about "It's a Small World". The song is about 2 minutes long, so at 1/10,000 speed it's 20,000 minutes = 14 days. He seems to be using a length a little over 3 minutes. I found a YouTube video of the ride that's 3:45, but the song ends at 2:15 and the rest is silent. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 22:16, 23 June 2022 (UTC)
:[https://www.youtube.com/watch?v=PxRW-duSCLA This video of it] on YouTube lasts 3:02. It was uploaded by Universal Music Group (allied with Disney), making it some kind of 'official' version, and its length fits Randall's calculation. (Also, thanks for making the table!) [[User:DKMell|DKMell]] ([[User talk:DKMell|talk]]) 22:38, 23 June 2022 (UTC)

Could "eπ Ionian months" also be a very subtle reference to the {{w|Euler identity}} given the first two characters of Ionian? Or am I reading/visualising a bit too much into it? [[User:Paddles|Paddles]] ([[User talk:Paddles|talk]]) 08:16, 24 June 2022 (UTC)

Aug 26 needs editing, but I just reset my password and can't fix it. At 4 breaths per minute, 100,000 breaths is 17.36 days. To get 17 days exactly, Randall would need to assume about 4.085 breaths per minute. [[User:Wjw|Wjw]] 08:24, 24 June 2022 (UTC)

Talk:2636: What If? 2 Countdown

2022-06-23T13:32:38Z

172.70.85.211:

1844: Voting Systems

2022-06-22T08:05:38Z

172.70.85.211: Voting is a gamble, but gambling is a worse one...

{{comic
| number = 1844
| date = May 31, 2017
| title = Voting Systems
| image = voting_systems.png
| titletext = Kenneth Arrow hated me because the ordering of my preferences changes based on which voting systems have what level of support. But it tells me a lot about the people I'm going to be voting with!
}}

==Explanation==
This comic is about types of single-winner voting systems:

# '''{{w|Approval voting}}''' has voters "approve" (i.e. select) any number of candidates. The winner is the most-approved candidate. It works with the same unranked ballot as plurality voting, but would allow a "compromise" candidate who is the second choice of a majority to defeat a candidate who is supported by a plurality but disliked by other groups.
# '''{{w|Instant-runoff voting}}''' (also known as Ranked Choice or Preferential Voting) has voters rank the candidates in order of preference. Ballots are initially counted for each elector's top choice. If a candidate secures more than half of these votes, that candidate wins. Otherwise, the candidate in last place is eliminated and removed from consideration. Ballots that had this candidate as the top choice now have the second preference as the top choice (this is the "instant runoff"). The top remaining choices on all the ballots are then counted again. This process repeats until one candidate is the top remaining choice of a majority of the voters or all but one candidate have been eliminated. IRV's proponents have successfully implemented it in a few places, such as the city of San Francisco, and Federal elections in Australia.
# A '''{{w|Condorcet method}}''' elects the candidate that would win a majority of the vote in all of the head-to-head elections against each of the other candidates. A candidate with this property is called the Condorcet winner. Due to the {{w|Condorcet paradox}}, an election with 3 or more candidates might not have a Condorcet winner, so Condorcet methods differ in the secondary set of rules used to handle that situation.
# Not directly mentioned in the comic, '''{{w|First-past-the-post voting}}''' (FPTP, aka '''{{w|Plurality (voting)|plurality voting}}''') is the method currently used in the US, UK, and several other countries. It only allows voters to choose a single candidate. Experts on voting methods agree there are multiple reasons why FPTP is not the best way to implement democracy,<ref>https://www.ippr.org/files/images/media/files/publication/2011/05/Worst%20of%20Both%20Worlds%20Jan2011_1820.pdf</ref><ref>https://plato.stanford.edu/entries/voting-methods/#ExamVotiMeth</ref><ref>https://electionscience.org/voting-methods/spoiler-effect-top-5-ways-plurality-voting-fails/</ref><ref>https://www.fairvote.org/plurality_voting_leaves_elections_open_to_manipulation</ref><ref>https://www.researchgate.net/publication/254419149_And_the_loser_is_Plurality_Voting</ref><ref>https://www.makevotesmatter.org.uk/first-past-the-post</ref><ref>https://blog.realinstitutoelcano.org/en/no-electoral-system-is-perfect-but-some-seem-fairer/</ref> but they made little progress in replacing it in the United States for decades. However, this is changing; the state of Maine and numerous cities have adopted either IRV or Approval in recent years.

'''{{w|Arrow's impossibility theorem}}''' gives a list of criteria for ranked voting systems and states that [http://youtube.com/watch?v=Q60ZXoXP6Hg no system] can satisfy all of them at once, despite that for each of them it may seem "obvious" that an electoral system ought to satisfy it. Some voting theorists (such as Cueball) dislike IRV because it {{w|Comparison of electoral systems#Compliance of selected single-winner methods (table)|fails more of the criteria}} than Condorcet does.

The primary joke in the comic is the premise that people who are pedantic or knowledgeable enough to find Arrow's theorem to be relevant will self-fulfill the theorem by being inclined to disagree on any effort to change the voting system. This is illustrated by Cueball's voting system preference that is contingent on the preferences of other people, which defeats their effort to produce a community-wide ranking.

A secondary joke in the comic is that often voters don't pick their favorite choice in a vote. Instead, they vote for a less favorable, but more likely electable, person as a way to prevent their least favorite choice from being elected. This is commonly called "spoiler effect"; in Arrow's parlance it is a form of {{w|Independence of irrelevant alternatives|IIA criterion failure}}. Cueball's strategic vote switch implies that they may be using FPTP (which they dislike) to make the decision, as FPTP is the only system to involve a potential "spoiler effect" (note, however, that certain vote distributions in systems such as IRV can produce a similarly problematic and illogical effect on the outcome).

A third joke is the recursive self-referencing inherent in voting to choose a voting system.

The title text stipulates that Cueball has no fixed ranking of preference for human candidates, but makes this choice dependent on which voting system is favoured by the group. This exceeds strategic voting considerations as the ranking should have full information, whom Cueball prefers in each situation. Therefore Arrow's impossibility theorem and the analysis behind it assume the ranked preferences of an individual voter as a fixed given. To make them dependent on the voting system makes assessing the efficacy of the voting systems absurd or at least much more complicated to do as a general assessment. That is given as the reason why Arrow would wholeheartedly hate him.

==Transcript==
:[White Hat and Ponytail are standing on either side of Cueball who is talking while lifting one hand.]
:Cueball: I prefer approval voting, but if we're seriously considering instant runoff, then I'll argue for a Condorcet method instead.

:[Caption beneath the panel:]
:Strong Arrow's theorem: The people who find Arrow's theorem significant will never agree on anything anyway.

{{comic discussion}}

<references />

[[Category:Comics featuring White Hat]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Ponytail]]
[[Category:Politics]]
[[Category:Elections]]

2633: Astronomer Hotline

2022-06-15T20:01:34Z

172.70.85.211: /* Explanation */ Some stuff (including UFO liferalism)

{{comic
| number = 2633
| date = June 15, 2022
| title = Astronomer Hotline
| image = Astronomer Hotline.png
| titletext = Employment statistics have to correct for the fact that the Weird Bug Hotline hires a bunch of extra temporary staff every 17 years.
}}

==Explanation==
{{incomplete|Created by 17 YEAR CICADA TRYING TO LOOK LIKE A FIREFLY - Please change this comment when editing this page. Do NOT delete this tag too soon.}}
This comic is a joke about {{w|Helpline|helplines}}, and how people sometimes call helplines for non-significant reason.

The comic starts with someone having called the "Astronomer hotline", hence the title. Judging by the way the helpline employee, [[Cueball]], starts the call, by asking for a description of the weird lights, it is implied that this is the main/only purpose of the helpline, or is, in practice, the only type of call they receive.

The caller is in panic, and doesn't know how to describe the light. Cueball is used to this and asks the caller to stay calm, then starts to go through his check list, asking them if it is day time, because if it was he would assume they have just noticed the Sun. This could be seemed very condescending, but it is like when the employee at a tech support hot-line asks if the computer is turned on, or if the caller tried to restart the computer, see [[806: Tech Support]]. It may also refer to the most immediate danger, as looking directly to the sun is a bad idea.

The caller is not affronted, but tells Cueball that the Sun set, and when asked if they are stars, and thus stationary, says they are zipping around in the bushes.

At this point Cueball realizes that the caller has just seen {{w|Fireflies}}. He describes them for the caller as lightning bugs, tree blinkers or ground stars, and tells the caller that these are not a problem, so the caller is now relieved. Those descriptions are reminiscent of the fools stars (and planes) mentioned in [[2017: Stargazing 2]].

However, Cueball must admit that astronomers do not know much about fireflies, since they are too fast for the astronomers' telescopes (in general, astronomers don't study terrestrial phenomena). And he thus transfers the caller to the "Weird Bug Hotline" in a process that is apparently somewhat routine – enough to have the correct line somehow preprogrammed into his call-handling system. This is clearly not the first 'astronomy' query that are actually about fireflies.

Before the call ends, at Cueball's end, he hears the first question from the other hotline: Is it currently biting you.
Again going directly to the most important part, is there any immediate danger...

It is possible that Cueball will actually speak next, quickly priming the Weird Bug call-handler with the salient facts already established. This could get the original caller straight into the correct conversation if the onward line's handler is as competent and experienced in such a transfer.

Some people (often {{w|Unidentified flying object|UFO}} enthusiasts) tend to get a little over-excited about calling every light in the sky they don't expect a UFO. This comic takes this to the extreme, where someone calls a helpline because they saw fireflies, and thought they were UFOs. While UFOs are not mentioned by name, they are heavily implied. Technically, such a person would be correct, so long as the lights are actually unidentified, flying and caused by a physical object, but if the expectation is that it is an extraterrestrial spacecraft then the truth (if discovered and also accepted) can be disappointing to some people, rather than lead to an interesting alternative avenue of appreciation of whatever phenomenon it truly is.

The title text is a reference to bugs that have gaps of several years between emerging from their larval state. Most famous are the {{w|Periodical cicadas}}, 13- and 17-year cicadas, that only emerge every 13 or 17 years, depending on species. The 17 years in the title text thus refers to the 17-year cicadas. Every 17 years the bug hotline hires a bunch of temporary staff, either because there will be more callers due to the unexpected new bug no one has seen for 17 years, or it could be because they just like to emulate nature and thus do this every 17 years. The largest 17-year cicada appearance in the USA is called {{W|Brood X}} which last occurred in 2021 and before that 2004. There can be smaller broods in other years, but the majority come out with 17 years interval, and the next is expected in 2038. The joke in the title text is that the employment statistics for the weird hotline have to correct for this fact. Periodical cicadas have been mentioned before in [[2263: Cicadas]].

==Trivia==
:The UK Military had a UFO helpline for over 50 years. [[https://www.nbcnews.com/id/wbna34277625 Link]]
:This comic has a lot of themes that have been touched on in previous comics, including
::Helplines [[278: Black Hat Support]], [[806: Tech Support]]
::People not understanding basic concepts [[876: Trapped]]
::Cicadas [[2263: Cicadas]]
==Transcript==
:[Cueball, with a headset on, is sitting in an office chair at a desk in front of his computer screen, hands on the keyboard. He receives a call, and the callers voice is shown in a jagged frame above Cueball, between his two lines of text.]
:Cueball: Hello, Emergency Astronomer Hotline. How would you describe the lights?
:Caller on phone: ''I don't know! Help!''
:Cueball: Stay calm. Is it day? If so, that's The Sun.

:[Cueball is now seen en face with the headset, but the computer etc. is not shown. The callers voice is now written normally but with zigzag lines going to the text from Cueball's headphone. Cueball's reply have a normal line going up to it.]
:Caller on phone: No, the sun set and then the light appeared!
:Cueball: Hmm, could be stars. Are they stationary?
:Caller on phone: No, they're all zipping around bushes.

:[In a frame-less panel, the setting returns to the one from the first panel. Also with the callers voice in jagged frames again.]
:Cueball: ''Aha!'' Fireflies!
:Caller on phone: "Fireflies"?
:Cueball: Lightning bugs. Tree blinkers. Ground stars.
:Cueball: They're fine.
:Caller on phone: ''Phew!''

:[Same setting as first panel, but broader panel. After Cueball's reply and a short reply from the caller as in the first panel. There is a sound indicating transfer to another hotline. Then to the right there is a square panel with jagged edge, with the voice from the other hotlines employee.]
:Cueball: We don't know much about them as they're too fast for our telescopes, but I can transfer you to the Weird Bug Hotline.
:Caller on phone: Sure, thanks.
:Transfer of call. *''Click''*
:Weird Bug Hotline on phone: ''Hi, Weird Bug Hotline. Is it currently biting you?''

{{comic discussion}}


[[Category:Comics featuring Cueball]]
[[Category:Astronomy]]
[[Category:Animals]]

2632: Greatest Scientist

2022-06-15T09:45:11Z

172.70.85.211: /* Transcript */ Bell(+bell stand) and dog missed, insofar as local-verticals.

{{comic
| number = 2632
| date = June 13, 2022
| title = Greatest Scientist
| image = Greatest Scientist.png
| titletext = "Ow! One of the petri dishes I left on the tower railing fell and hit me on the head. Hey, that gives me an idea..."
}}

==Explanation==
{{incomplete|Created by HISTORY'S WURST SCIENTIST - Please change this comment when editing this page. Do NOT delete this tag too soon.}}
This comic takes the feats of six of history's most acclaimed scientists and combines them into one fictional act, claiming that this person was the greatest scientist in history. Pulling off a combination of all of these would, indeed, be rather impressive.{{Citation needed}}

These scientists are most likely {{w|Galileo Galilei}}, {{w|Benjamin Franklin}}, {{w|Alexander Fleming}}, {{w|Ivan Pavlov}}, {{w|Eratosthenes}}, and {{w|Isaac Newton}}.

The ground is noticeably curved in this comic, because the curvature of the Earth is mentioned and measured.

Humorously combining multiple science experiments into one was also a punchline in [[1584: Moments of Inspiration]]. Curved floors to represent Earths curvature were mentioned in [[2412: 1/100,000th Scale World]]

==Table of Experiments==
{| class="wikitable"
|+ List of experiments in the comic
|-
! Experiment in comic !! Experiment in reality !! Meaning !! Scientist
|-
| The Leaning Tower of Pisa || {{w|Galileo}} conducted [https://en.wikipedia.org/wiki/Galileo%27s_Leaning_Tower_of_Pisa_experiment an experiment] at the Leaning Tower of Pisa, where he dropped two objects to measure whether the rate at which objects fall is dependent on weight or is constant. || Galileo found that objects with different weights fall at the same rate, disproving Aristotle's statement which purported the opposite. However, {{w|Vincenzo Viviani}} had already discovered this. Galileo's experiment further developed experimentation in science, in opposition to the then-prevailing view that knowledge is learned by studying the writings of the ancients.|| {{w|Galileo Galilei}}
|-
|Flying a kite into a thunderstorm with lightning || In June 1752, Benjamin Franklin performed his famous {{w|kite experiment}} in which he attached a conductive wire to a kite and flew it near a thunderstorm. Attached to the kite was a key, which was further attached to a {{w|Leyden jar}}. || While the kite was not hit by lightning, "Franklin did notice that loose threads of the kite string were repelling each other and deduced that the Leyden jar was being charged." This is sometimes considered the discovery of the fact that lightning contains/is electricity. || {{w|Benjamin Franklin}}
|-
| Two moldy petri dishes || In August 1928, Alexander Fleming put ''Staphylococcus aureus'' into multiple petri dishes and then left to go on holiday/vacation. On September 3, he returned and found that one plate had mould on it. This plate was the only one that did not have ''S. aureus'' bacteria in it. He later repeated this experiment and {{w|History_of_penicillin#The_breakthrough_discovery|the result was confirmed}}. || The mould that Fleming had discovered produced penicillin, an antibiotic. This was the first time that a substance had been discovered that could ''reliably'' treat bacterial infections, having a huge impact on medicine across the world. || Sir {{w|Alexander Fleming}}
|-
| Salivating dog located next to a bell || [https://www.simplypsychology.org/pavlov.html In 1902 Ivan Pavlov conducted a study on dog reflexes] by giving dogs food and simultaneously ringing a bell. When the dog smelled and saw the food, it started salivating. Eventually, simply ringing the bell made the dog salivate, as the dog had associated the bell ringing with food. Pavlov also performed other, less humane experiments on other dogs. || This was the discovery of {{w|classical conditioning}}, where a stimulus is paired with an unrelated other thing through repeated exposure. The subject will eventually react to the unrelated thing in the absence of the stimulus. This is an example of taught reflexes, where a subconsious reaction like a reflex or instinct is taught. || {{W|Ivan Pavlov}}
|-
| The shadow angle of the dog determining the circumference of the Earth || |In the 200s BCE, the Greek philosopher Eratosthenes {{w|Earth's_circumference#Eratosthenes|measured the circumference of the Earth}}. While his exact method has been lost to time, a simplified version remains: At high noon on the summer solstice in Syene, Egypt, the sun was almost directly overhead. This was confirmed with a sundial. 5,000 stadia away in Alexandria, at the same time, the angle of the sun was measured with another sundial and converted into a fraction of the Earth's circumference. Some simple multiplication could then yield the circumference of the Earth. || The distance Eratosthenes calculated for the circumference of Earth was 250,000 stadia. This estimate was either 2.4% low or 0.8% high compared to modern knowledge, depending on whether he used Greek or Egyptian stadia - a remarkably accurate estimate for the time. || {{w|Eratosthenes}}
|-
| (Title text) A petri dish falling on the scientist's head, leading to a new discovery || Sir Isaac Newton, an inventor of calculus and discoverer of his famous {{w|Newton's laws of motion|Laws of Motion}}, also determined the basic mechanics of {{w|gravity}}. It's sometimes claimed that Newton came up with the notion of gravity when an apple fell from a tree and hit him on the head. While this is almost certainly an embellishment, Newton apparently told acquaintances that his inquiries into gravity were {{w|Isaac_Newton#Apple_incident|"occasion'd by the fall of an apple"}}. This purportedly led Newton to consider the question of what ''exactly'' caused the apple to fall straight to the ground. || This line of thinking ultimately let him to deduce the {{w|Law of Universal Gravitation}}, which is fundamental to understanding celestial mechanics. || Sir {{w|Isaac Newton}}
|}
It is also possible that the fact that two petri dishes fell in the comic but only one fell in the title text could be an obscure reference to {{w|Albert Einstein}}, through either the twins paradox or superposition. However, this connection is rather far-fetched and is more likely just a minor discrepancy.
==Transcript==
{{incomplete transcript |Please change this comment when editing this page. Do NOT delete this tag too soon.}}

:[On the left of the panel, there are some buildings and trees representing Pisa, Italy. One of these buildings is the Leaning Tower of Pisa. The height of the tower is labeled h1 against a locally non-leaning dotted line, the length of its shadow upon the grounds is marked L1, the angle from ground from the end of the shadow to the tip of the tower is labelled θ1. Attached to the top of the tower, there is a kite string. The kite is in the top right, next to a thunderstorm. Two disks are shown falling from the kite onto a bell underneath. The bell goes "Ding! Ding!" Next to the bell is a dog. A horizontal line above the dog and its shadow is ambiguously labeled (and possibly broken up by) h2, the length of its shadow on the ground L2, and the angle up from end of the shadow to the top of the dog θ2. The ground is noticeably curved. Around the horizon upon the middle of the curved surface are drawn various distant pyramids very nearly horizontal to the image. All buildings in 'Pisa', the supported bell/dog at the other side of the scene and various trees and plants around each end are locally-vertical in a radial manner, except for the Tower Of Pisa which is almost vertical to the image in exhibiting its local 'lean'. The two θ angles are clearly different but the dotted diagonal segments they define head in the same drawn direction from the tips of the shadows to the tips of their objects. The Sun is not illustrated but would be somewhere to the left of the image and upwards.]

:[Caption below the panel:]
:History's greatest scientist was probably that one who measured the shadow of the Leaning Tower of Pisa while flying a kite into a distant thunderstorm where lightning caused two moldy Petri dishes to fall onto a bell next to a salivating dog whose shadow angle determined the circumference of the Earth.

{{comic discussion}}
[[Category: Science]]

2624: Voyager Wires

2022-06-08T03:18:11Z

172.70.85.211: /* Explanation */ Incorrect, as Voyager is not accelerating

{{comic
| number = 2624
| date = May 25, 2022
| title = Voyager Wires
| image = voyager_wires.png
| titletext = Also, they're getting increasingly worried that someone will accidentally hit the 'retract' button, and that the end of the cable thrashing around as it winds up could devastate the Earth's surface.
}}

==Explanation==
{{incomplete|Created by a WIRE CUT BECAUSE OF BUDG- are you there houston? it's me v----ger, you'll never guess what I found! Please change this comment when editing this page. Do NOT delete this tag too soon.}}
This comic claims that the {{w|Voyager program|Voyager probe}}s communicate with NASA though ridiculously long copper wires. These wires would have to be continuously lengthened as the probes travel away from Earth. Supposedly, because of "high copper prices and budget constraints," they may not be able to afford to lengthen the wires much longer. If this occurred, they would have to either cut the wires or let them break, which would prevent any further communication with the probes. In reality [https://voyager.jpl.nasa.gov/mission/status/ they use radio waves], not long copper wires, so this will not actually happen.

If copper wires were dragged by the Voyager probes, assuming a 1mm² thick cable, 550 tons of copper would be needed per hour and it would add 1 million Ohm per hour to the cable resistance. At [https://www.moneymetals.com/copper-prices $8,560/ton], this would cost $41 billion dollars/year, which would be nearly twice [https://www.planetary.org/space-policy/nasas-fy-2022-budget NASA's entire annual budget].

The resulting wire would slow down the probes by drag unless the wire itself was actively suspended (i.e. accelerated) continuously as it was fed. The wire could not be used for any other mechanical purpose such as a {{w|Space elevator|space elevator}} for this reason.

Since the Earth spins, the wires would also spool around the Earth, slowing the probes down even further. [https://what-if.xkcd.com/157/ Clearly, this is not a good idea.] This problem might be avoided if the wires reached earth at one of the poles. Or perhaps they could go to an airplane that flies around earth at exactly 15 degrees of longitude per hour, with periodic air-to-air refueling, so that it is always on the side of the earth facing the probe.

Because the Voyager probes aren't in the plane of the earth's orbit around the sun, the Earth would not, in its rotation around the sun, drag these copper wires through the sun. If it did, the wires would melt.

The title text references the phenomenon seen with self-retracting cables, such as are commonly found on vacuum cleaners, where the free end of the cable, where the plug is, oscillates more and more wildly as the cable approaches full retraction, leading to the danger of a painful rap on the hand if it is not withdrawn in time. A planet-sized impact of this kind could cause severe damage.

A few days before this comic was released, [https://voyager.jpl.nasa.gov/news/details.php?article_id=124 NASA had reported] receiving corrupted data from the Voyager 1 probe. The fact that they are receiving any data at all means that the attitude control system must be working (or else the antenna would not point at Earth), but they continue to investigate how that data could be corrupted after that point.

;Spoiler alert
The consequence of a cable between a craft in space and a planetary location being suddenly retracted was recently imagined in the first episode of the Apple TV+ series ''{{w|Foundation (TV series)|Foundation}}'', wherein a {{w|space elevator}} tether was severed. [https://www.youtube.com/watch?v=huRmvG3zRpg It didn't end well for anyone other than the terrorists] who won the freedom of thousands of inhabited worlds which had formerly suffered under the jackbooted oppression of {{w|Trantor}}'s fascist galactic Empire regime.

Another illustration in fiction of a severed space elevator is in Red Mars, part of the {{w|Mars Trilogy}} by Kim Stanley Robinson.

==Transcript==
:[In the bottom right corner is a space probe, with large satellite dish and long antenna. Behind it runs a long wire, that makes three loops before it is connected to North America on the Earth in the top left corner. To the left of the Earth there is a second wire, which goes off-panel to the left.]

:[Caption below the panel:]
:Sad news: Due to high copper prices and budget constraints, NASA may finally have to cut the wires that they've been spooling out to communicate with Voyager 1 and 2.

{{comic discussion}}

[[Category:Space probes]]

Talk:2626: d65536

2022-06-07T09:11:32Z

172.70.85.211:

I wonder: can we even make a fair polyhedron with 65536 faces? In Randal's illustration, the faces seem to be irregular hexagons. [[Special:Contributions/172.70.130.105|172.70.130.105]] 21:37, 30 May 2022 (UTC)
: This is better than my question, which was simply if you could tile a sphere with these. [[Special:Contributions/172.70.211.36|172.70.211.36]] 23:01, 30 May 2022 (UTC)
:Definitely possible, just create two identical right pyramids with a 32768-gon base and glue the bases together. [[User:Clam|Clam]] ([[User talk:Clam|talk]]) 23:53, 30 May 2022 (UTC)
: Would this design be fair? Consider a set of 256 lines of latitude overlapping another set, with the second set's polar axis at the equator of the first. Cut flat quadrangles between the intersection points of the lines of latitude. Doesn't use hexagons like the comic does though. [[Special:Contributions/172.70.110.121|172.70.110.121]] 09:41, 31 May 2022 (UTC)
:: Fairness is a given for pyramids (if that's what you're asking). As long as there's enough 'rolling energy' to get either of the pyramids 'facing up', any N-agon base to the pyramids should have enough indeterminate impetous to then finally roll around a bit to end up with any of those exposed faces on top.
::(Interesting to note that for odd-numbered N-agonal bases, like that in a D10, you need to offset the bases and instead of sticking to the triangular faces base-to-base you now have kite-shapes that interlock in a serration that is no longer strictly planar along the axis's perpendiculars.)
::That might need a selection of the pyramidal slope. A very wide pair of bases with very little tip-'elevation' (to fit tightly within an oblate spheroid) should transition very well between same-pyramid faces, like a bulgy button, but one with highly acute tip-angle (prolate, likewise) might find the dominant behaviour to be tip-to-tip tipping, more like a toggle-fastener. OTOH, for odd-numbered end-agons it would probably ratchett to subsequent sides as it tips back and forth so long as it has enough energy to it.
::If you're asking about lines of latitude intersecting, consider that near the poles of either latitudinal reference the division of the other reference-system is going to be spliced more irregularly and thus give varying degrees of stability to rest upon.
::(Also, do you have a latitudinal line that crosses ''both'' pairs of poles, or are you deliberately moving them by half a phase (1/512th of the relevent circumference) so that you at least don't have them entirely coincident.)
::I believe the suggested scheme would be to take a dodecahedron or icosohedron (either of the two duals can be used to start with) and then subdivide each face in such a manner that equally-sized (but differently distorted) hexagons – and 12 little regular pentagons of identical area fitting in at the old dodecahedron centre/the old icosahedron vertex – emerge from the required segmentation/vertex-truncation and readjustment the radiality of all new mid-edge vertices (or maybe the newer-edges' centres or the newer-faces' centres) to touch the unit sphere. If done symmetrically, it should be entirely fair.
::The face-count might be troublesome, though. The twelve necessary pentagonal faces leaves 65524 hexagons, to split evenly between* either 12 or 20 zones, and it should be obvious that neither is possible**, in whole numbers, given the starting point of 2n faces...
:::(* - you can, and probably will in this design, have some that cross between two of the top-level polygons, but you can fully 'donate' as many as you then fully ''get'' donated from the next face around, so it might as well be just counted as a group of whole tiles on an a set of Escher-like interlocking 'rough' polygons.)
:::(** - If you're using 12 zones, that's 3x4x(however many in the zone + one corner each) and there's no factor of 3 in ''any'' value that is 2n. Arranging into 20 symmetrical zones (5x4), you will find that 65524 isn't divisible by 5, either...)
::You could probably arrange an N-ahedron with the number of faces being 12+(12a) or 12+(20b), for some higher value (a bit of mental arithmatic suggests 65592 might be that value) and mark all the 'excess' faces (56?) with "Roll Again!". Or perhaps some pithy motivational slogans that also convey roughly the same meaning... :P [[Special:Contributions/172.70.162.5|172.70.162.5]] 11:32, 31 May 2022 (UTC)
::Postcript: Ok, so this is my idea for face-placing. Take a D8 (octahedron) and divide each of its 8 originally triangular faces into 8192 smaller faces (alternatively, start with a cube and progressively truncate its corners towards the same end). This is not a divisible by three number (neither can you put one in the centre, the rest are divisble by three and can surround it symmetrically), but you don't need strict rotational symmetry in any way. The opposing side can reflect/copy the non-symmetry as required to create any useful symmetry across the whole of the structure (and make floored-base/upmost-face pairings, amongst other things).
::As long as you make the faces equally likely to land on ''and stay on'' (could be hyperstellated as a slightly flat irregular 8192agon-based right-pyramid with the pyramid-faces of adjacent sides matching or meshing edges with those of each other, or a complicated mostly-hexagonal mesh, or a triangular one that's a limited fragment of a fine geodesic-like bulged pattern) by some suitable scheme governing area, aspect ratio and inter-face angle of incidence (probably normalising features to touch the unit sphere, for a start) then it should do it fairly and with ''exactly'' 65536 faces. I leave the fine-tweaking up to someone else. [[Special:Contributions/172.70.162.5|172.70.162.5]] 12:59, 31 May 2022 (UTC)

I don't know why it's so big? Seems like it should have a diameter of approx. 1 meter. [[Special:Contributions/172.70.130.105|172.70.130.105]] 21:37, 30 May 2022 (UTC)
: Cueball is 50 pixels high. The ball is 340 px high. Assuming Cueball is an average-height male (1.7m), and is standing the same distance from the viewer as the center of the ball, roughly how large is each face of the polygon? Area of a sphere is 4.pi.r.r, r=0.85, so 9.08 m^2 or 9080000 mm^2, divide by number of faces, get 277 mm^2, so we get 1.6cm to a side. If I did that right, then you're right: those are fairly large faces. --[[Special:Contributions/172.69.70.39|172.69.70.39]] 05:58, 31 May 2022 (UTC)
:I ran the calculations for the Trivia section. I used 12pt font which gave each number an area of 1/6 square inch (about 1 square cm) [[Special:Contributions/162.158.106.237|162.158.106.237]] 06:57, 31 May 2022 (UTC)
:Simple: Exaggerated for comedic effect and to make the point it's unwieldy (plus avoid the fuss of figuring out a realistic size) [[User:NiceGuy1|NiceGuy1]] ([[User talk:NiceGuy1|talk]]) 06:31, 4 June 2022 (UTC)

Should the title and picture file use "d" or the comic's difficult to type "ᴅ"?
[[User:While False|While False]] ([[User talk:While False|talk]]) 21:55, 30 May 2022 (UTC)
:Since xkcd uses small caps as lowercase letters, the "ᴅ" should just be considered xkcd-font for "d", and as such need not be used on the title, which is not using the xkcd font.
:: Ah! [[User:While False|While False]] ([[User talk:While False|talk]]) 06:15, 31 May 2022 (UTC)

If you really did want to generate a 16 bit integer with physical dice, it would be much simpler to roll a [https://www.thediceshoponline.com/impact-opaque-hexidice-d16-hexadecimal-dice hex die] four times. [[User:Clayot|Clayot]] ([[User talk:Clayot|talk]]) 23:30, 30 May 2022 (UTC)
:Rolling a binary die 16 times would also work. You can get binary dice for 1¢ each. [[Special:Contributions/108.162.245.69|108.162.245.69]] 01:31, 31 May 2022 (UTC)
::The lowest-value coin of all is the Tiyin from Uzbekistan. Some 3,038 equate to one UK penny (and 2,000 tot up to one US cent) from https://www.bbc.co.uk/news/magazine-21572359. [[User:Arachrah|Arachrah]] ([[User talk:Arachrah|talk]]) 15:13, 31 May 2022 (UTC)
::Those 1¢ "dices" are not exactly guaranteed to be random. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 06:12, 31 May 2022 (UTC)
:::They seem as random as other dice? Am I wrong? [[Special:Contributions/172.70.230.63|172.70.230.63]] 09:33, 31 May 2022 (UTC)
:::: You can reduce bias by taking two not quite fair coins. Flip them together. If both heads, or both tails, then record a 0. If different, record a 1. [[User:Arachrah|Arachrah]] ([[User talk:Arachrah|talk]]) 15:13, 31 May 2022 (UTC)
::::: Actually, it's better to flip one coin twice. If it's heads then tails, record a 0, if it's tails then heads, record a 1. If it's HH or TT, try again. [[Special:Contributions/172.70.207.8|172.70.207.8]] 15:20, 2 June 2022 (UTC)

I think the hardest part (or maybe second-hardest part) is figuring out which facet is the one on top. [[Special:Contributions/162.158.78.109|162.158.78.109]] 00:46, 31 May 2022 (UTC)
:Roll it on a glass table, check from below which face it's landed on instead. Wait until it has settled safely, though, or it might land on ''your'' face! [[Special:Contributions/172.70.90.227|172.70.90.227]] 04:58, 31 May 2022 (UTC)
:: Good plan. Assuming standard dice design, subtract the value from 65537 to get the value of the uppermost face. --[[Special:Contributions/172.69.70.39|172.69.70.39]] 05:58, 31 May 2022 (UTC)
::: Because computer binary counting starts with ZERO (and in this case ends with 65535) one has to subtract from 65535. This die would not have a 65536 and it would have a zero. [[User:Inquirer|Inquirer]] ([[User talk:Inquirer|talk]]) 22:38, 31 May 2022 (UTC)
::::Notice that the parent comment says “assuming standard dice design” and standard dice start with 1 and end with their d number: a standard d4 has faces 1,2,3,4; a standard d6 has faces 1,2,3,4,5,6; a standard d10 1,2,3,[…],10; and a standard d100 has faces 1 through 100. Which is why rolling 2xd10 does NOT yield the same results as rolling 1xd100, because one cannot roll a 1 OR a 100 with two d10’s, and other numbers are over represented. This is why I have both a d12 and a d100 in my set of dice…[[User:John|John]] ([[User talk:John|talk]]) 11:40, 2 June 2022 (UTC)
:::::D10s are frequently (IME) numbered 0..9, with underlines to distinguish 6 from 9, whether or not that is as a deliberate sop to pairing up for percentiles ("It's the red dice first...", "It isn't!", "It is, it's ''always'' the red dice first, that's a 9 percent fail, not at 90 percent success!"). The 0 opposite 9, 1 opposite 8, etc.
:::::If you're rolling 1..10s (depends upon the system being used for... and arguments about the original intentions, possibly, where 10 of something or zero of something turning up/discovered means a lot to what exactly happens next) you ''treat'' them as full 10s, and double-zero can (again, hopefully understood in advance) be a "natural 100", rather than a natural-zero, to someone's obvious advantage or detriment.
:::::Similarly, games with D4 may use 0..3 as its outcomes, or D3s (D6/2s) have 0,0,1,1,2,2 as faces. Or if you are somehow stuck with a 1-based die of the appropriate (or divisible) range, and need to play something that requires a 0-based one, you agree that MAXNUM->ZERO or N=N-1.
:::::From my recollections of the truly huge collection of multicoloured, multisized and variously multifaceted dice that was dragged out for wargaming/role-playing sessions, years of accumulations from various sources, the D6s (spotted, not "Hit", "Missfire", <arrows for miss direction>, or otherwise for other uses), D8s, D12s and D20s were habitually 1-upwards, and Ds with 3, 4 and 10 almost all 0-upwards. D6s were the most numerous, but D10s well up there (enough for colour-mismatched pairs for each of a whole battalion of participants, even if the Hit/Miss die had to be passed around at need, and the few big yellow D20s might need to be offered onwards/rolled on someone's behalf on occasion).
:::::In short, the 'standard' is perhaps more firmly that opposite sides add up to double the average (not possible with D4, which is also "point-marked", not one number per side), though I'd like to check a D3 to see if it's 0 opposite 2 (x2) and 1 opposite 1 (which also happens to be a 0..5-dice with the opposition rule, but modded by 3) or perhaps in a basic {1..6}mod3 conversion 1 opposes 0(=6), 2 opposite 2(=5), 0(=3) opposite 1(=4). Maybe next time I go a gaming I'll get the chance. [[Special:Contributions/172.70.86.44|172.70.86.44]] 12:48, 2 June 2022 (UTC)
:::::HOW are you figuring any numbers are over represented in rolling 2xD10? There are 100 possibilities, 1 through 100, one chance per number, exactly equal... Each die has a 1 in 10 chance of rolling each value. Unless you're forgetting to pre-assign which die is the tens position and which is the ones... This is why any set with more than one D10 has then different colours so you can tell them apart... [[User:NiceGuy1|NiceGuy1]] ([[User talk:NiceGuy1|talk]]) 05:11, 4 June 2022 (UTC)
::::::Not sure what you're asking here. It seems to bear very little relevence to the meaning of the thing you're replying to (wot I wrote, which might indicate the error in conveying is at my end). I did not ''intend'' to suggest (as it is untrue) that 2D10≠1D100 (give or take adjusting what "00" means, which is an implementation issue, not a mathematical one), but I'll gladly clear up anything I left potentially saying something other than I thought it did. Quote the bit, and you can get a 'better' rewrite of it ASAP. [[Special:Contributions/162.158.159.41|162.158.159.41]] 05:48, 4 June 2022 (UTC)
:::::::"Which is why rolling 2xd10 does NOT yield the same results as rolling 1xd100, because one cannot roll a 1 OR a 100 with two d10’s, and other numbers are over represented.", that line. A 1 is rolling 0 on the tens die and a 1 on the ones die. A 100 is 0 on both dice (or you make the range 0 to 99, in which case two 0s is 0). NOW I think you were thinking of multiplying the values, which is indeed bad (for example, it then becomes impossible to roll a 17, as no two single digit numbers multiply to 17. Also, 9x9 is 81, 9x10 is 90, making those the last two possible values before 100, the other 80s and 90s unachievable. And then what you say make sense, you can get 24 with 3x8 or 4x6, two chances = over-represented). [[User:NiceGuy1|NiceGuy1]] ([[User talk:NiceGuy1|talk]]) 06:29, 4 June 2022 (UTC)
::::::::Ah, no, that was User:John, not me (172.70.86.44). Teach me for replying based on seeing the Diffs page, and not counting the indent-colons correctly! You were replying to a point that I had actually ''not even noticed'', at the same 'level' as I had jumped in on the zero-based-range thing with my spiel that you weren't actually arguing with. (Not sure John was thinking dice-multiplied, either, as 1x1=1. Perhaps why I blanked that bit out.)
::::::::On the subject, though, the Babylon 5 RPG used an interesting double-dice system, for some things (either straight success/fail or modifying other offsets, possibly). Red D6 and Green D6 (or similar hue distinction) rolled together. Take the ''lowest'' value of the two, and then call it negative if it was the red one. Equal rolls mean zero, except double-1 (critical/special failure of some kind) and -6 (likewise a success). Gives a slightly modified normalised-around-zero distribution (intentionally or otherwise) with the possible results being ((-Critical -5 -4 -4 -3 -3 -3 -2 -2 -2 -2 -1 -1 -1 -1 -1 0 0 0 0 +1 +1 +1 +1 +1 +2 +2 +2 +2 +3 +3 +3 +4 +4 +5 +Critical)), if you order the 36 possibilities. Similar to 2D6 added, minus 7 (to bunch up the unexceptionalism towards the baseline), but two of the middlingest possibilities removed and given special status at the either end for that little possible pizzaz! ;)
::::::::It reminded me of the experiment with monkeys where they were taught to recognise values (as number of bananas, e.g.) and then taught that whichever of two options they chose, it was the ''other'' one's value that dictated their reward. When done with abstract numbers (digits, or colours/shapes relating to numbers by training) they would "choose low, to get high", but when given ''actual'' quantities of reward-items, they'd instinctively "choose high", by instinct, immediately before their conscious brains kicked in and they realised they'd done the wrong thing. Or something like that (look for 30/40-year-old study, possibly shown to be flawed, these days)...
::::::::Anyway, it took a short while to train oneself to be somehow excited by 3 dots on a green when paired with six dots on a red, say, (or dissapointed with a green 6 in the light of any non-6 red) when previously the merest glance at the cumulative spots on thrown dice would suffice to satisfy the question of how well they fell for you. ;)
::::::::Not useful for this comic, but had always been dying to mention it, from the beginning! [[Special:Contributions/172.70.86.64|172.70.86.64]] 11:10, 4 June 2022 (UTC)
:::::::::LOL! Yes, I indented to answer John, his comment mystified me, :) And I did not check your identity, just understood by your response YOU were the one I was speaking to. :) The comments on here are so many and so LARGE I haven't read most, just that his caught my eye. THAT is an interesting if complicated dice system, wow! [[User:NiceGuy1|NiceGuy1]] ([[User talk:NiceGuy1|talk]]) 05:03, 5 June 2022 (UTC)

What material should it be to be light enough to easily roll it but cheap enough that doing the 1,5 meters doest cost a fortune ? Sorry if the question is not clear. [[Special:Contributions/141.101.69.30|141.101.69.30]] 05:50, 31 May 2022 (UTC)
:I recommend making it hollow. You could probably do something like this for $3000 if you made it out of 1/8th inch acrylic plate. [[Special:Contributions/162.158.106.237|162.158.106.237]] 07:02, 31 May 2022 (UTC)
:At first I thought aluminum for sturdiness, but really you could make this out of cardboard for dirt cheap, lasercutting precise shapes, but you'd have to design its structural frame to keep it intact, exchanges design effort for price. [[Special:Contributions/172.70.230.63|172.70.230.63]] 09:32, 31 May 2022 (UTC)

I disagree with this dice being really random. Like, sure, if thrown correctly, but that's going to be quite hard. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 06:12, 31 May 2022 (UTC)

:True. For a rolled die to be random, it needs to roll far enough so that the initial orientation no longer governs the outcome. Say, ten times the circumference, or about 150 meters? -- [[User:Dtgriscom|Dtgriscom]] ([[User talk:Dtgriscom|talk]]) 10:28, 31 May 2022 (UTC)
::Interesting to consider the 'necessary minimum'. Simplify to a "wheel of fortune" (just one axis of continual rotation) it would depend upon the potential variation of imparted rotation. If (say) 'aiming' at two whole rotations has a (perhaps 'normal') spread of variance that relates to ±½ rotational uncertainty at the 1st and 3rd quartile of probability then the sub-first and above-third 'tails' might wrap around to (roughly) equalise the chances that 2±(whatever fraction) spins lands just about anywhere just about equally. Aiming at four whole rotations (similary ±1 spin at the given quartiles, and the tailing chancs 'filling in' above 5 rotations and below 3) would smooth things out, all else equal, but takes twice as much perceived/attempted effort for not much more 'randomising'.
::Similarly, requiring 10 full rolls (maybe honestly aiming for 10, but allowing it to be 7.5 or less if not obviously 'just nudged') seems overkill, in the single dimension.
::Except, of course that you also need enough distance (on top of whatever factor you consider practical as a variation-wrapping value, which might not be the ½-in-2 I give) to also roll ''sideways''. If for some reason you really don't want to roll 65536 or 1 (or is it 65535 and 0?), which may be on polar-opposite faces, you might make sure that they are directly to the left and right before you propel the die forwards ''a little'', not caring which distribution of numbers is on/near the rolling-equator (2 is acceptible to you, and 65533, etc; other very low/high values conceivably placed on that thin band of "wheel-like chance" but you're just avoiding the very largest and smallest, or specifically just the one of them) but knowing that it's more unlikely to easily present the exact face(s) you dislike than it might be in a truly 'fair' roll.
::Perhaps the best thing is to have a rolling track to send the thing down that puts it the required "two or so rotations" forward to then either hit a wall or climb slightly up a slope (at a roughly 45 degree angle) that then sends it back roughly sideways to the original vector for a similar distance with a perpendicular or even composite moment of rolling rotation, to bring 'initially axial' numbers fully into play... And that dog-leg would require a sligthly shorter length from launch-position to where the thoroughly mixed-up final stopping point should be, whilst significantly foiling the master-manipulators who actually try to arrange an initial setup that favours better final results (rather than just nudge it, uncaring, for a result not as totally random but certainly not more predominently of desired-for ranges than otherwise). [[Special:Contributions/141.101.99.8|141.101.99.8]] 12:28, 31 May 2022 (UTC)
::At what point does the structural material the die is composed of, combined with its mass, create a smoothing effect that will destroy the fairness of the die. I mean a small plastic die is no problem. A 2-ton acrylic die would start grinding off the edges of some faces with every roll, would it not? [[Special:Contributions/172.69.69.122|172.69.69.122]] 13:35, 31 May 2022 (UTC)

Should it be related to https://xkcd.com/221/ ? [[Special:Contributions/162.158.183.246|162.158.183.246]] 08:07, 31 May 2022 (UTC)

I'm going to wait, I think - I don't think there's room in my attic for this as well as all the Betamax kit, my drawers full of MiniDiscs and my Zune collection. No, I'll sit tight - I'm hearing encouraging things about the introduction of the Magic 65536-Ball... [[User:Yorkshire Pudding|Yorkshire Pudding]] ([[User talk:Yorkshire Pudding|talk]]) 09:41, 31 May 2022 (UTC)
:The number of sides on the die inside the ball is not what determines the name of the ball. It's the exterior housing which is colored in the manner of an Eight Ball. The classic design uses a d20, and is still called an Eight Ball, not a Twenty Ball. [[Special:Contributions/172.70.130.195|172.70.130.195]] 18:00, 31 May 2022 (UTC)
::Full disclosure: I don't have any of those things in my attic. And I'm not entirely sure, but I don't think Randall thinks rolling a d65536 is genuinely the hardest part of generating random 16-bit numbers. And Grape Nuts contain neither grapes nor nuts. [[User:Yorkshire Pudding|Yorkshire Pudding]] ([[User talk:Yorkshire Pudding|talk]]) 23:37, 31 May 2022 (UTC)

I'm suprised the hidden message points to 2624. I would've thought it would point to 2626 to refer to itself. Maybe things didn't get published as intended? Or maybe Randall really just wanted to point people to the Voyager comic? [[User:Linux2647|Linux2647]] ([[User talk:Linux2647|talk]]) 18:13, 31 May 2022 (UTC)
:I'm no ASCII expert, but from the description provided I'm pretty sure the comic URL would require the number representing "26" to show up twice. A die with, say, two 13,359 faces would obviously not be fair. If only Randall had published this as #2625 or #2627! (Or maybe he ''planned'' to publish it last week and had to shuffle his schedule after finalizing this comic?) [[User:GreatWyrmGold|GreatWyrmGold]] ([[User talk:GreatWyrmGold|talk]]) 18:24, 31 May 2022 (UTC)
::Probably the latter, seeing as it doesn't actually line up so that any of them are actually "26". The numbers are xk-cd-.c-om-/2-62-4/, so the 26 and 24 aren't lined up like that. [[Special:Contributions/172.70.126.87|172.70.126.87]] 19:38, 31 May 2022 (UTC)
::To change the number from 24 to 26 would mean changing 13,359 to 13,871. The only way that would be a problem is if 13,871 was already in the comic, which it isn't. Convert 13,359 to hex, it's 342F. In ASCII, 34 is "4", 2F is "/". Add 2 you get 36, so the new hex number is 362F, which converted to decimal is 13,871. [[User:NiceGuy1|NiceGuy1]] ([[User talk:NiceGuy1|talk]]) 11:37, 5 June 2022 (UTC)
:Perl code to decode the ASCII: <pre>perl -E 'for (30827, 25444, 11875, 28525, 12082, 13874, 13359) { print chr($_ >> 8), chr($_ & 0xff) }; print "\n"'</pre>

<big><big>'''Remember that "die" is singular and "dice" is plural'''</big></big> [[User:Mushrooms|Mushrooms]] ([[User talk:Mushrooms|talk]]) 09:30, 1 June 2022 (UTC)

;Might be worth offering some easier alternatives..
Needless to say, 16 ordered coins (eg ordered by the date of their minting) provide a much easier alternative to a d65536.

Other (easy to find) d p^2 - such as 8 ordered d4, or 5 ordered d8 and a coin (or bit-shave a dice.)
It's true some rules need to be applied (the highest number of the die is treated as a 0, and the order of the dice is strictly followed).

For example using a rainbow spectrum ordering of 6d8,
I role: 7, 1, 2, 8, 3, 5. Each dice represents 3 bits -
111-001-010-000-011-101. We shave off the last two bits (because we want 16 bits, not 18, for a d65536)
1110 0101 0000 0111. Hex = E507, which is decimal 58,631.

While it takes a few seconds for a human to convert the number it is quite trivial to write a program to convert an image capture.

There are also specialist dice - such as d16 'hexidice' which provide 4 bits per ordered die, and far less human calculation.
There are even d256 hex dice made, but they suffer the same problem that a d65536 would have.

[[User:20040302|20040302]] ([[User talk:20040302|talk]])
: how are you trivially converting image captures? i still use my keyboard. what's the update? [[Special:Contributions/162.158.79.120|162.158.79.120]] 18:26, 1 June 2022 (UTC)
:For your D8 system, since a D8 absolutely SCREAMS octal, you'll get results from 001 to 1000 octal for each die roll. Just subtract 1, and it's a perfect 3 digit range, 000 to 111! Which feels better than 8, the highest roll, becoming 0, the lowest, like you're doing. And as the previous commenter asked, how is image capture trivial? Especially from a programming perspective? Seems like the ACTUAL trivial method is to put a calculator into scientific mode and just type in the hex number to convert... :) [[User:NiceGuy1|NiceGuy1]] ([[User talk:NiceGuy1|talk]]) 05:11, 4 June 2022 (UTC)

I found an octahedral Goldberg with 65538 sides, 6 squares and 65532 irregular hexagons, notated GP₄(128,0). Can be constructed by chamfering a cube 7 times (Conway cccccccC). I don't think anything can be closer. [[User:SDSpivey|SDSpivey]] ([[User talk:SDSpivey|talk]]) 04:37, 2 June 2022 (UTC)
:I have had two designs in mind:
:*Start with octahedron, subdivide each face triangle into 16,384 triangular faces (subdivide all original edges into 128ths, effectively, while "halving into quarter-sized triangles), pairing the triangles up into half that many 'diamonds' then inflating to touch the bounding sphere, keeping the diamonds planar and possibly equal area, but will also distort them (some into kites, others may be utterly irregular) so it'll be a (literal?) balancing act to make all tippings between faces equally possible.
:*Start with a tetrahedron, subdivide likewise, stick with the triangles, have the same issue of inflating the faces towards the unit sphere while balancing the resulting distortions.
:I tried to work out something that seems to exactly match the image (or as exactly as I perceive it to be) with mildly distorted hexagons - albeit with the necessary pentagonal substitutions to carry the curvature - formed of (a similarly subdivided set of) sub-triangles drawn out on the original surfaces of either icosahedron or a snub-stellated extension onwards the dodecahedron, but I couldn't get the numbers to add up. Which is not to say that there isn't a way to do it. I was going to spend more time on this issue later, so if I get past the issues, then... Watch this space? [[Special:Contributions/172.70.162.77|172.70.162.77]] 13:17, 2 June 2022 (UTC)

I WAS going to say a far simpler way is to roll a D6 and 4 D10s (what is WITH all the lowercase Ds? Every time I see dice named it's uppercase!), figuring that gives a range of 0 to 69,999, and throw out/re-roll results higher than 65,535. (I realize that probably adjusts the odds, but I would think minimally and equally). Then I realized the D6 can't give a result of 0, so the real range is 10,000 to 69,999. Oops! And a D7 feels weird and rare if it even exists, SO! 5 D10s and still throw out everything above 65,535. :) Oh, and I agree with the Warning text, NEEDS an explanation how these numbers turn into a URL. WITHOUT relying on writing a program or concepts like "big endian", just say what's being done to ONE number, come on! EDIT: Never mind, I figured it out and added a MUCH simpler explanation. :) [[User:NiceGuy1|NiceGuy1]] ([[User talk:NiceGuy1|talk]])
:I think a D7*2 exists, i.e. a D14div2 (two faces for each of seven digits), though they're rarer than D14s (same idea as a D10, but interlocked heptagonally-based pyramid 'ends') which are already niche. I saw one with days on (Mo/Tu/We/Th/Fr/Sa/Su, leastwise), which is the only vaguely obvious reason for one. Might as well have a spinner. But to save so much 'wasted' rolling, use a D8 and only reject the 8 (or, rather, 8=0, reroll the 7 and all the rest, to prevent actual statistical clumping, ditto onwards from any other 'bust'). [[Special:Contributions/162.158.159.41|162.158.159.41]] 05:48, 4 June 2022 (UTC)
::Yup, didn't think about a D8 (which is extra stupid as I was discussing D8 higher up, LOL!) D'oh! And yes, I didn't think about rolling a day of the week, that would make a D7/D14 useful. Even if it was so labelled, just have Sunday equals 0, Monday is 1, etc. Range becomes 0 to 69999, only about 4,000 possibilities thrown out (I'd probably just re-roll the D7/D14). For a D8 I'd agree with your method.

::Reminds me of a Facebook Memory I had the other day: If you want to confuse someone, ask them why there's a line under the 6 on a D8.[[User:NiceGuy1|NiceGuy1]] ([[User talk:NiceGuy1|talk]]) 06:14, 4 June 2022 (UTC)

'''"hexakismyriapentakischiliapentahectatriacontakaihexahedron"''' [From the Explanation] Would anyone care to take a stab at deciphering that word? As of this comment, Google only returns this page as a reference. [[User:These Are Not The Comments You Are Looking For|These Are Not The Comments You Are Looking For]] ([[User talk:These Are Not The Comments You Are Looking For|talk]]) 01:55, 7 June 2022 (UTC)
:I have not checked for accuracy/consistency with the accepted "large specific number prefixing" conventions, but "hexa" (6) "kismyria" (x10,000) "penta" (5) "kischilia" (x5,000) "penta" (5) "hecta" (x100) "tria" (3) "conta(kai?)" (x10) "hexa" (6) "hedron" (-faced 3d shape")... Possibly constructed by historic geometrical naming rules (historically may not have dealt with myriads enough to establish a firm usage-policy), possibly just the root number Google Translated to modern Greek, in the latin alphabet and geometrised/de-spaced a bit. It was funny enough for me not to investigate too closely, but this is my impression. It'll be lost once the Incomplete is edited off, anyway, and was never part of the comic to be explained. The 'Incomplete' rewrites sometimes ''do'' seem to need a bit of counter-nerdsniping, but as we don't have an explainexplainxkcd.com to discuss them, in Talk is as good a place as any... :) [[Special:Contributions/172.70.85.211|172.70.85.211]] 09:11, 7 June 2022 (UTC)

It seems like it would be inappropriate for me to make the call, as I'm the one who made the fix, but can the "Don't remove this too soon" request for more information on the hidden message trivia be declared resolved? I feel I've made it clear (I feel like fully doing the conversion on every number would seem too bulky). Also, it begs the question, why THAT comic, is it worth mentioning that this makes it seem likely that THIS was supposed to be 2624, and he forgot to update the number? It would have been simple enough to just add 2 to the last number... [[User:NiceGuy1|NiceGuy1]] ([[User talk:NiceGuy1|talk]]) 05:26, 5 June 2022 (UTC)

2623: Goofs

2022-05-31T05:00:54Z

172.70.85.211: /* Explanation */ If you must, do the punctuation correctly.

{{comic
| number = 2623
| date = May 23, 2022
| title = Goofs
| image = goofs.png
| titletext = The film is set in 2018, but when Commander Bremberly chases the hologram through Times Square, there's a billboard for Avengers: Age of Ultron. Depending on the date, that billboard would have been advertising either Infinity War or this movie.
}}

==Explanation==
{{incomplete|Created by a IN THE EVENT OF DIFFERENCES BETWEEN REALITY AND FICTION REALITY IS WRONG - Please change this comment when editing this page. Do NOT delete this tag too soon.}}
IMDb is the {{w|Internet Movie Database}}, a website that contains detailed, user-contributed information about movies and TV shows. One of the sections in many entries is "[[#Goofs|Goofs]]". This may list bloopers, inconsistencies, implausible actions, anachronisms, etc. in the movie. While some people find enjoyment in searching for these errors, to others, the entries listed can often be overly pedantic and missing the point{{Citation needed}} (a problem that can often afflict sites that rely on users to provide their content [Hey! Who you calling a pedant?]). The comic makes fun of this with several goofs that simply point out differences between something in the movie and reality; but since the movie is fiction (in this case, a science fiction film that includes a space detective, a cybernetic dog, blimp drones, and a hologram kissing scene), one can say that these "goofs" might simply be more differences between the movie world and our own.

In the first goof, a named street doesn't actually exist in the city in which the movie is set. Unless the address is important to the plot (Manhattan has a number of streets with well-known characters - for example, the main theatre district is on Broadway, Fifth Avenue is a major shopping district, and Wall Street is known for large financial institutions), screenwriters can and do make up street names. It might actually be expedient to 'rename' a setting in many cases, to avoid issues such as fans showing up at said street and harassing the residents.

In the second example, they point out that there's no harpoon store at the location where the characters obtain a harpoon in the movie, and the nearest actual harpoon store doesn't have a display window. Movies take liberties with details like this for plot expediency, and is not considered a goof. Manhattan does not appear to have ''any'' notable harpoon stores,{{Citation needed}} with or without the kind of frontage described.

In the third example, the background of a scene is of an apartment in Downtown Vancouver (a cheap and popular filming location that frequently stands in for other cities). The goof points out that the real-life apartment does not belong to the character who supposedly lives in it. Fictional movie characters do not exist in reality,{{Citation needed}} and many scenes are set in fictional locations that are completely separate from their real-life filming locations. As such, this is only a "goof" if the scene is taken entirely literally.

The title text describes an actual anachronism. The film is set in 2018, but there's a billboard for the movie ''{{w|Avengers: Age of Ultron}}'', which came out in 2015, while the next Avengers film, ''{{w|Avengers: Infinity War}}'', came out in 2018. Assuming the movie was filmed before 2018, the filmmakers wouldn't have known what films would be current at the time it would be released, and certainly not the artwork they'd be using to promote them. They could have chosen to set it during the time of initial filming, but again, unless the specific date is significant to the plot, it's common to set (or rather, assume) a film takes place about the same time it's released. Generic advertisements for fictional (or {{w|Last Action Hero|parody}}) films might be put over egregiously obvious existing material, physically or in post-production editing, as might references to major brands – perhaps replaced by those agreed with from {{w|product placement}} partners.

The title text also mentions the possibility of a self-reference – the billboard could be for this film itself since it's being released at the same time it's set. This assertion that {{w|Blazing Saddles|in-universe self-reference}} is plausible for a movie production is likely another example of the goof's writer failing to understand the basic "premise of fiction". Most movies do not exist within the fictional world they portray,{{Citation needed}} and many audiences would find self-reference to be a far greater obstacle to suspending disbelief than an ad for the wrong Avengers movie.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
:[An excerpt from an Internet Movie Database web page showing a list of goofs from a film. Each item has some small illegible text below it, which on the real IMDb would say something like "7 of 72 found this interesting | Share this". The first and third items have a faint yellow-tinted background. The third item is only partially visible at the bottom of the "screen".]
:[Heading:]
:<big> Goofs (78) </big>
:[List:]
:The space detective's office is on Chestnut Ave, but Lower Manhattan has no street by that name. Agent Glennifer pursues the cybernetic dog onto what is clearly Ludlow Street.
:The agents destroy the blimp drones in Union Square with harpoons from a store display rack. The nearest harpoon store is several blocks away and has no outdoor displays.
:The apartment in the background of the hologram kissing scene actually exists in downtown Vancouver. We called the owners, who confirmed they had no residents named [...]

:[Caption below the panel:]
:Sometimes the IMDB "Goofs" section really seems to struggle with the whole premise of fiction.

==Goofs==
* There is no entry for a film featuring an agent called Glennifer or a commander named Bremberly on IMDb. Randall is clearly failing to do basic research.
* On the real IMDb, each item in the Goofs section would be listed under a category such as "Errors in geography" (which might apply to the three goofs listed in the main cartoon) or "Anachronisms" (which might apply to the goof in the title text). However, no such category is displayed here.
* On real Goofs pages, the information below each entry includes a public feedback listing (X of Y found this interesting) and a link entitled "Share this". In the comic, only unintelligible squiggles are included in their place, which really breaks the immersion of the purported "webpage". Of course, on a real IMDb page, all of the text would also be in the Verdana font, not Randall's handwriting.
* The comic features two entries with a yellow background, which is impossible. On IMDb, entries alternate between having white and gray backgrounds and only turn yellow when the mouse hovers over them.
* On IMDb, the number of goofs is located in a navigation box between the header and the goofs list. In the comic, the number is placed in the header, and there is no navigation box at all.
* A similar Goofs section exists in the [[explain xkcd]] wiki's page for this comic, [[2623: Goofs]], but it fails even more evidently to recreate the look of IMDb's Goofs page. Additionally, the last entry is recursive, which is clearly unprofessional.
* The penultimate entry is also recursive leading to a form of pairwise recursion and formal structure subject to analysis not typically associated with goofs sections in their generalized forms.{{Citation needed}}

{{comic discussion}}

[[Category:Comics with color]]
[[Category:Fiction]]

2624: Voyager Wires

2022-05-30T08:37:41Z

172.70.85.211: /* Explanation */ No, it's 'attitude' ("from the probe's attitude articulation and control system (AACS)"), but it doesn't explicitly say that this is the corrupted part of the data (or isn't!) and it seems not to stop it pointing back at us.

{{comic
| number = 2624
| date = May 25, 2022
| title = Voyager Wires
| image = voyager_wires.png
| titletext = Also, they're getting increasingly worried that someone will accidentally hit the 'retract' button, and that the end of the cable thrashing around as it winds up could devastate the Earth's surface.
}}

==Explanation==
{{incomplete|Created by a WIRE CUT BECAUSE OF BUDG- are you there houston? it's me v----ger, you'll never guess what I found! Please change this comment when editing this page. Do NOT delete this tag too soon.}}
This comic claims that the {{w|Voyager program|Voyager probe}}s communicate with NASA though ridiculously long copper wires. These wires would have to be continuously lengthened as the probes travel away from Earth. Supposedly, because of "high copper prices and budget constraints," they may not be able to afford to lengthen the wires much longer. If this occurred, they would have to either cut the wires or let them break, which would prevent any further communication with the probes. In reality [https://voyager.jpl.nasa.gov/mission/status/ they use radio waves], not long copper wires, so this will not actually happen.

If copper wires were dragged by the Voyager probes, assuming a 1mm² thick cable, 550 tons of copper would be needed per hour and it would add 1 million Ohm per hour to the cable resistance. At [https://www.moneymetals.com/copper-prices $8,560/ton], this would cost $41 billion dollars/year, which would be nearly twice [https://www.planetary.org/space-policy/nasas-fy-2022-budget NASA's entire annual budget].

The resulting wire would slow down the probes by drag, but be perfect space elevators for lightweight spacecraft.
Since the Earth spins, the wires would also spool around the Earth, slowing the probes down even further. Clearly, this is not a good idea.{{Citation needed}} This problem might be avoided if the wires reached earth at one of the poles. Or perhaps they could go to an airplane that flies around earth at exactly 15 degrees of longitude per hour, with periodic air-to-air refueling, so that it is always on the side of the earth facing the probe.

Because the Voyager probes aren't in the plane of the earth's orbit around the sun, the Earth would not, in its rotation around the sun, drag these copper wires through the sun. If it did, the wires would melt.

The title text references the phenomenon seen with self-retracting cables, such as are commonly found on vacuum cleaners, where the free end of the cable, where the plug is, oscillates more and more wildly as the cable approaches full retraction, leading to the danger of a painful rap on the hand if it is not withdrawn in time. A planet-sized impact of this kind could cause severe damage.

A few days before this comic was released, [https://voyager.jpl.nasa.gov/news/details.php?article_id=124 NASA had reported] receiving corrupted data from the Voyager 1 probe. The fact that they are receiving any data at all means that the attitude control system must be working (or else the antenna would not point at Earth), but they continue to investigate how that data could be corrupted after that point.

;Spoiler alert
The consequence of a cable between a craft in space and a planetary location being suddenly retracted was recently imagined in the first episode of the Apple TV+ series ''{{w|Foundation (TV series)|Foundation}}'', wherein a {{w|space elevator}} tether was severed. [https://www.youtube.com/watch?v=huRmvG3zRpg It didn't end well for anyone other than the terrorists] who won the freedom of thousands of inhabited worlds which had formerly suffered under the jackbooted oppression of {{w|Trantor}}'s fascist galactic Empire regime.

==Transcript==
:[In the bottom right corner is a space probe, with large satellite dish and long antenna. Behind it runs a long wire, that makes three loops before it is connected to North America on the Earth in the top left corner. To the left of the Earth there is a second wire, which goes off-panel to the left.]

:[Caption below the panel:]
:Sad news: Due to high copper prices and budget constraints, NASA may finally have to cut the wires that they've been spooling out to communicate with Voyager 1 and 2.

{{comic discussion}}

[[Category:Space probes]]

Talk:72: Classhole

2022-05-24T14:05:40Z

172.70.85.211: Undo revision 276806 by Hago caca en paginas (talk) Go away.

I think this is a biblical reference. Matthew 7:9, "Which of you, if your son asks for bread, will give him a stone?" Black Hat the "classhole", evidently will.{{unsigned ip|‎108.162.216.109}}
:50 points for that excellent reference! PS Hi from [[1408]]. [[User:Jarod997|Jarod997]] ([[User talk:Jarod997|talk]]) 12:57, 15 August 2014 (UTC)

----
Yes I have to put that seperating line. God, how do you do a line across text, dang I meant strikethrough. This is going nowhere. [[User:StillNotOriginal|StillNot]][[User talk:StillNotOriginal|Original]] 02:01, 21 May 2018 (UTC)
:<s><s></s><s>This is a strikethrough</s></s>. [[User:Beanie|Beanie]] ([[User talk:Beanie|talk]]) 10:12, 16 March 2021 (UTC)

Is the explanation ever going to explain the first panel? It's been over 13 years, and it STILL hasn't been explained.[[Special:Contributions/108.162.242.21|108.162.242.21]] 15:57, 8 November 2019 (UTC)
:What part about it do you need explained? It's pretty straightforward. [[User:Fabian42|Fabian42]] ([[User talk:Fabian42|talk]]) 20:28, 30 October 2019 (UTC)
::I dunno. Note: I forgot to sign it. Just fixed that up.[[Special:Contributions/108.162.242.21|108.162.242.21]] 15:57, 8 November 2019 (UTC)

Talk:528: Windows 7

2022-05-24T14:04:32Z

172.70.85.211: /* Vista */

Is this a reference to [http://en.wikipedia.org/wiki/Godwin's_law Godwin's Law]? [[User:Saibot84|Saibot84]] ([[User talk:Saibot84|talk]]) 21:59, 13 April 2013 (UTC)
:An ironic one, possibly. --[[User:Qwach|Qwach]] ([[User talk:Qwach|talk]]) 13:54, 31 August 2013 (UTC)
::A second opinion: No. [[Special:Contributions/108.162.219.223|108.162.219.223]] 19:30, 10 January 2014 (UTC)

I think the title-text joke is mainly in the word "hardly" instead of "not" when describing the hitler-y-ness of the beta. {{unsigned|Gigahertz}}

;Hitler-y
I don't know but look at this: [http://www.urbandictionary.com/define.php?term=hitlery hitlery]. It really seems that it belong to Hillary Clinton. Look at Goooogle: [https://www.google.com/#q=Hitler-y Hitler-y]. This has to be explained, even for non US citizens. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 21:03, 3 June 2014 (UTC)
:I added some description clarifying the implied Hitler reference. I believe it has to do with Adolf Hitler because it has a hyphen before the "Y" implying a general characteristic description rather than a nickname. --[[User:themacman33|themacman33]] ([[User talk:themacman33|talk]])
:I can't imagine the use of "Hitler-y" here, especially with the hyphen, is used to mean anything other than "Hitler-like". --[[User:Alex|Alex]] ([[User talk:Alex|talk]]) 23:09, 24 June 2014 (UTC)
:The entry given was created by author "anti-communist/anti-fascist" who also wrote definitions for the terms "kkk" and "gay marriage." Not only were the entries written eight years ago, they were also written down the same day. It seems obvious that said author took that day to spread his own personal political views, and should not be treated as normal day-to-day speech. Furthermore, there is no other reference to Hilary Clinton in this strip. I am removing the incomplete tag from this explanation. If the need is felt to restore it, please give a more justifiable reason. [[User:Castriff|Jimmy C]] ([[User talk:Castriff|talk]]) 02:13, 30 June 2014 (UTC)
:I think it's pretty clear that Hitler-y is simply the way Randall adjectived Hitler. {{unsigned ip|108.162.216.87}}
:Considering [[1756]], I am almost 100% certain it wasn't a slam on Secertary Clinton. [[User:Eeddgg|Eeddgg]] ([[User talk:Eeddgg|talk]]) 17:42, 23 February 2021 (UTC)
I'm pretty sure that this is a reference to a German play called The Resistible Rise of Arturo Ui (Der aufhaltsame Aufstieg des Arturo Ui). It's a satirical allegory about Hitler, where Hitler's name in the play is Ui. https://en.wikipedia.org/wiki/The_Resistible_Rise_of_Arturo_Ui [[Special:Contributions/108.162.221.173|108.162.221.173]] 12:04, 21 September 2015 (UTC)
:Sorry, but there's no way this is the case. It's too much of a stretch for an incredibly obtuse visual pun. Hitler was just chosen because he's probably the worst thing you could have stuck on your monitor forever. [[Special:Contributions/108.162.242.134|108.162.242.134]] 09:08, 11 January 2016 (UTC)

Worse then the original goatse.cx?{{NSFW}} [[Special:Contributions/108.162.216.166|108.162.216.166]] 12:18, 21 July 2017 (UTC)

Yo, Windows is NOT N*zism. Seriously. --[[Special:Contributions/162.158.187.239|162.158.187.239]] 18:20, 12 November 2020 (UTC)

This comic reminds me of a blog post Raymond Chen has written on The Old New Thing about [https://devblogs.microsoft.com/oldnewthing/20030825-00/?p=42803 Windows bringing out the Rorschach test in everyone]. Funny enough, said blog post mentions about beta users mentioning that one the generic user icon looking like Hitler near the end when Windows XP was getting tested. [[User:Toastadieu|Toastadieu]] ([[User talk:Toastadieu|talk]]) 16:44, 18 September 2021 (UTC)

== Vista ==

Am I the only person in the world who liked Windows Vista? [[User:Hago caca en paginas|Hago caca en paginas]] ([[User talk:Hago caca en paginas|talk]]) 13:27, 24 May 2022 (UTC)
:I've done a quick survey of everyone in the room and the answer to that is probably "Yes", with 100% of me not liking Vista. And that is [[1478: P-Values|statistically significant at a p>0.05 level]]! [[Special:Contributions/172.70.85.211|172.70.85.211]] 14:04, 24 May 2022 (UTC)

explain xkcd:Sandbox

2022-05-23T08:25:49Z

172.70.85.211:

__NOINDEX__ [[Category:explain xkcd]]
Make changes, try things out, or just have fun with the wiki here! Just leave everything above the line alone, please. 
>[http://www.explainxkcd.com/wiki/index.php?title=explain_xkcd:Sandbox&action=edit&oldid=91667 clear sandbox]
------
[[File:Header.png|900px|center]]

<pre>

X X K K CCCC DDDDD
X X K K C C D D
X X K K C D D
X KK C D D
X X K K C D D
X X K K C C D D
X X K K CCCC DDDDD

</pre>

{{#expr:sqrt(1.5*(circumference/diameter))}}

⬆ It's [https://www.explainxkcd.com/wiki/index.php/1292:_Pi_vs._Tau pau!]

(If xkcd could do variables)

[http://www.example.com Test]

[https://www.explainxkcd.com/wiki/index.php/Special:Random Random Page]

this is a [http://www.example.com Test]

this is a [http://www.example.com link]

[http://www.example.com this][http://www.example.com is][http://www.example.com a][http://www.example.com link]

== test ==

''lksjdflsjd''

'''Bold text'''

[[Link title]]

== ==

I'm just going to say... ''Amazingly'' quiet.

23 May 2022
07:57 (User creation log)‎ . . [ <65ish‎ of the expected failed Spam accounts ]
m 06:38 2622: Angular Diameter Turnaround‎ (diff | hist) . . (+4)‎ . . Theusaf (talk | contribs) (grammar)
22 May 2022
23:55 (User creation log)‎ . . [ <the final act of the prior UTC day being to add to that day's list, obviously...> ]

I mean, in a good way. But unusual, even on the third day since a new comic, nust the one tweak in over eight hours? Just testing here, in case only Admins (and spambot account creators) are able to do stuff now. Doubt it, but I need to know and/or comment, right? ;)
 Hmmm... When I previewed, it glitched my browser on this tab. That recent MediaWiki common.js change with the delay didn't do something did it? Or was it just this page/my browser (quite possible)? Making this note, just in case I only get to post this the once... [[Special:Contributions/172.70.85.211|172.70.85.211]] 08:25, 23 May 2022 (UTC)

User talk:Bubblegum

2022-05-22T16:25:15Z

172.70.85.211: /* Arab Soyjak and other site vandalism */ new section

{{Welcome}} — [[User:Sqrt-1|The 𝗦𝗾𝗿𝘁-𝟭]] [[User talk:Sqrt-1|talk]] [[Special:Contributions/Sqrt-1|stalk]] 03:41, 15 December 2020 (UTC)

== Arab Soyjak and other site vandalism ==

::((Copied away from a comic discussion page. Left the original there, but it was ''really'' drifting off topic to add my own rambling comments after it. As you actually have a working Talk page, I thought I might make use of it! - Regards, the IP that is the initial responder below...))

[[Special:Contributions/162.158.107.124|162.158.107.124]] is repeatedly changing the comic title to "Arab Soyjak" and the image to a picture of Osama bin Laden, and being awfully rude in the edit summaries; also has a history of vandalism along with various associated IP addresses - however also having made actual contributions to the wiki, etc etc, I haven't checked other IP addresses that are associated; [[416: Zealous Autoconfig]] is one of the pages that are currently vandalised </ramble> [[User:Bubblegum|bubblegum]]-[[User_talk:Bubblegum|talk]]|[[Special:Contributions/Bubblegum|contribs]] 02:56, 22 May 2022 (UTC)
:IP (as currently registered¹) is not very useful. I can post two things within as many minutes and be noted (as a lazy 'not got an account yet' person) by different IPs, sometimes way off (though often within an /16 subnet, if not /24). Though expectations are that the possible ranges are then at least geographic (so that only those routed via the same 'nearest hub' can land on the exact same IP ad used previously by others), I have no idea how sparse or dense the hub-locales are (whole of the UK through London? London+Birmingham+Cardiff+Glasgow (e.g.) and NI either Belfast or served by Dublin? We ultimatey share a gateway with most of Northern Europe?) and how much overlap there is (chances of being load-shared via <''next'' nearest hub, or further>) in a dynamic fashion.
::¹ - noting that someone mentioned a thing to do to avoid the hiding behind the bog-standard intemediary gateway's limited range of semi-random IPs. It was a few weeks before Davidy22 returned, though, and it might even not be their level of access that makes it possible, so unsure if it was seen and left undone or whether the suggestion needs to be rediscovered...
: As it is, I'd ignore the Contribs list. The vandalism itself tends to make itself obvious by the theme of its content. I know I saw some residual vandalism earlier today (after you put this) which I reverted, plus saw others had done in some other instances. With a couple of (comparitively) subtle defacements, people alert to the "crap" stuff might have missed them, but I'm fairly sure I personally caught the Zealous Autoconfig (and another example that seemed to have the same modus operandi to it. Will check when I've finished here, in case something else flew under the radar.
:(I was personally busy, yesterday, and had a nice long walk up into some moorland where there's variable mobile coverage and, besides, I wasn't going to sit down and check in on things... For one thing, it's difficult unless you can shade out the sky and see the tablet screen, and there weren't enough trees to provide a canopy! ;) Anyway, so some of the things I tend to check for may have not been seen by others who have their own way of suppressing the various onslaughts. I know there are plenty of others, but though I'm fairly sure they weren't up and about on the very same lonely and peaceful moorland as me, I can't say they ''weren't'' similarly distracted. :P )
:Anyway, the one advantage of a username is that one can recognise a long-standing contributor of good repute. That's you. Of course you can't really be sure who I am, and that's I price I pay just so I don't have to try to remember yet ''another'' login credential. Or (like the bad guys who bother to go that far) create new accounts whenever I get locked out of the prior one due to some oversight. For me, the balance is calculated around how much good I want to do (rather than how much meddling I might want to do),
:Hopefully you realise that someone who decided to write as much as me isn't that kind of fly-by-night, though! [[Special:Contributions/172.70.85.211|172.70.85.211]] 16:25, 22 May 2022 (UTC)

Talk:2622: Angular Diameter Turnaround

2022-05-21T02:43:48Z

172.70.85.211: /* Hooray! */

== Congratulations, you won a brand new galaxy! ==

Your new galaxy will be delivered in only 3 billion years, to a drop-off point only 1 million light years from your home planet. With this cutting-edge protogalaxy, which will be mature upon delivery, you will find incredible features such as:
* supermassive black hole
* exotic spacefaring lifeforms
* intriguing dense matter that does not emit radiation, you'll never have enough
* unique and enthralling galactic formations, each with ancient magical myths told in history by the spacefaring lifeforms
* and the ability to grow brand new stars!
[[Special:Contributions/172.70.114.247|172.70.114.247]] 00:07, 21 May 2022 (UTC)

== Comments ==



Slightly creepy, NGL[[Special:Contributions/172.69.34.10|172.69.34.10]]
: Warning, horrible content: The universe was created by the severed bloody hands of google employees convincing phone manufacturers to ditch the previous phone backends and explode the google play store throughout reality in a mess of intergalactic gore. Our planet developed from an angrybirds download, nourished by the decaying corpse of the owner who played it all their life. [[Special:Contributions/172.70.110.209|172.70.110.209]] 20:37, 20 May 2022 (UTC)

So apparently this is a real thing, which I never knew [[wikipedia:Angular_diameter_distance#Turnover_Point]] [[Special:Contributions/108.162.221.81|108.162.221.81]] 20:46, 20 May 2022 (UTC)

Could be related to comic 1422, what with both containing expanding phones analogous to some cosmic structure. [[Special:Contributions/172.70.130.105|172.70.130.105]] 21:46, 20 May 2022 (UTC)
:[[1422]] has been crapped. [[Special:Contributions/172.70.126.221|172.70.126.221]] 21:50, 20 May 2022 (UTC)

So confusing…I thought that 13 billion years ago they had flip phones. [[User:JohnHawkinson|JohnHawkinson]] ([[User talk:JohnHawkinson|talk]]) 22:32, 20 May 2022 (UTC)

Before this explanation is marked “complete” it had better mention that “sinking into dilute blood” is a terrible (one could even say ignorant or stupid) description of red shift, completely missing the fundamental cause and completely distorting the effect. [[Special:Contributions/108.162.216.159|108.162.216.159]] 23:23, 20 May 2022 (UTC)

== Hooray! ==

Something good is happening!!!!!! [[Special:Contributions/172.70.126.215|172.70.126.215]] 21:22, 20 May 2022 (UTC)
: No. It just means you can't get a date tonight. Again. (I presume you're the "crap"per, right? Eager to fill your own worthless life by making ''everybody else'' actually feel useful... How ironic.) [[Special:Contributions/172.70.91.36|172.70.91.36]] 00:08, 21 May 2022 (UTC)
:: I thought it was just a visitor I worried I had badly depressed with my story of severed google hands, wanting to add positivity. [[Special:Contributions/162.158.79.112|162.158.79.112]] 00:21, 21 May 2022 (UTC)
: the "crap"er is a bot called "Explain xkcd server admin". -> https://www.explainxkcd.com/wiki/index.php/User:Explain_xkcd_server_admin/common.js [[User:Firestar233|Firestar233]] ([[User talk:Firestar233|talk]]) 00:11, 21 May 2022 (UTC)
:: Yes, same (style) as the umpteen previous times. No imagination and rather boring.
:: Now I'm limited in what I can do (still, been reverting pages left right and centre, to hold my bit up) but the "Hooray!" commenter (as, I suspect, the one who 'wished the crap would happen again' the other day, or words to that effect) seems to be very much like someone's idea of taunting us, thus proving that he (if you'll excuse that assumption) can't get laid and for some reason they haven't discovered the more solo method of getting their rocks off, so he's rubbing up against us and trying to generate the satisfying feeling of friction in his groin.
:: (You know when your dog has a favourite stuffed toy? Like that.)
:: Pretty boring, really, for us. But small things amuse small minds. And maybe that's the reason why. Also having small... 'feet'. Too shy to show his 'feet' to girls. Can't earn enough to get 'feet' enlargement surgery. No personality either. Pity. [[Special:Contributions/172.70.85.211|172.70.85.211]] 02:43, 21 May 2022 (UTC)

Talk:2620: Health Data

2022-05-18T09:08:11Z

172.70.85.211:

Did a basefor the setup[[Special:Contributions/108.162.246.34|108.162.246.34]] 23:51, 16 May 2022 (UTC)a

"Cure for Causality" sounds like a pretty good band name. [[Special:Contributions/141.101.104.4|141.101.104.4]] 07:13, 17 May 2022 (UTC)

Panel 1 reminds me of a conversation I had with one of my docs. I'd had some blood work done and the doc said, "The numbers look good. For a man your age." I mean, really; for a man my age? I didn't think we'd been talking about some teenager . . . . [[Special:Contributions/172.70.130.161|172.70.130.161]] 08:40, 17 May 2022 (UTC)
:Yeah, but it's possibly even worse when a gynacologist says those exact words... ;) [[Special:Contributions/172.70.162.77|172.70.162.77]] 11:23, 17 May 2022 (UTC)

Is poisoning other than drug overdoses that rare? The linked source states:
"1. Poisoning
Due in large part to the opioid epidemic, poisoning has overtaken car crashes as the country’s leading cause of accidental death, with 64,795 poisoning deaths in 2017, 22,000 of them from opioid painkillers. Additionally, people can be poisoned by common household substances, including:

Carbon monoxide
Pesticides and cleaning products
Lead"

even without the 22,000 opoid painkiller deaths posioning would still be number 1.[[Special:Contributions/162.158.50.68|162.158.50.68]] 09:25, 17 May 2022 (UTC)

:Yeah, I've re-checked that source and it doesn't actually seem that accurate in its numbers. I've replaced it with one that seems better. Wait, actually, that one's also pretty questionable. [https://www.cdc.gov/nchs/data/hestat/poisoning/poisoning.htm This one] seems accurate but not really all the information we're looking for—maybe the CDC has a better article? If someone could find one that is accurate and relevant, that would be a big help. [[User:Ncpenguin|Ncpenguin]] ([[User talk:Ncpenguin|talk]]) 02:24, 18 May 2022 (UTC)

:Well, there are other drugs you can overdose with. However, the most obvious problem with that statistics is that many people would assume that "poisoning" means "being deliberate poisoned", but most of those deaths from poisoning are accidents. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 21:39, 17 May 2022 (UTC)

Should we also link 1471 Gut Fauna wich shows another ewemple of Dr Ponytail practicing a weird form of medicine ?[[Special:Contributions/162.158.50.68|162.158.50.68]] 09:25, 17 May 2022 (UTC)

It is meant as a joke here, but ultimately life might just achieve this one day, uncoupling action from harm.

'Vagueness' is really an insufficient description for the absolute insanity that is blaming the passage of time for your problems. Almost to the point of being humorous in its own right. --[[Special:Contributions/172.69.33.199|172.69.33.199]] 10:13, 17 May 2022 (UTC)
: My nice little homo sapiens is turning into robots and they haven't even solved war. Curse evolution! I should have given them long distance communication thousands of years ago! [[Special:Contributions/172.70.230.143|172.70.230.143]] 15:35, 17 May 2022 (UTC)

Can it be also a pun: 'causality' vs 'casualty'? [[User:Tkopec|Tkopec]] ([[User talk:Tkopec|talk]]) 10:32, 17 May 2022 (UTC)

I think I might be covering up existing advantages with my description of a cold war from my dynamic ip. Be great if somebody could add cited material around that, but of course it's very hard to relate around norms of suppressed discussion. [[Special:Contributions/172.70.110.65|172.70.110.65]] 16:21, 17 May 2022 (UTC)

Check your family tree for any incidence of death. If all your forbears at any past generation are mortal, then science shows that with a high level of confidence that you are mortal.

The Inheritance Pattern of Death by Joseph Eastern, M.D., Carol Drucker, M.D. and John E. Wolf, Jr., M.D., 1982, J.I.R. Volume 28, Issue 22
[[http://www.linkedin.com/in/Comet Comet]] 17:40, 17 May 2022 (UTC)
:Sounds legit, although technically family history is not needed: statistically, everyone is mortal. The leading cause of death is being alive. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 21:39, 17 May 2022 (UTC)

If you have a lot of doctor visits, it's probably the case that you have some chronic illness, and also that you have a lot of measurements. Nevertheless, how many measurements you've had is not a good metric of health. Robert Carnegie rja.carnegie@gmail.com [[Special:Contributions/172.70.90.145|172.70.90.145]] 19:34, 17 May 2022 (UTC)

I'm convinced this particular comic is a snipe at poor control of {{w|availability bias}} and {{w|base rate fallacy}} in family medicine, (perhaps even involving the roots of the opioid crisis and similar scandals) so I added those and did a lot of copy-editing including adding some overlooked comic dialog and trimming about six or seven sentences of proposed possible explanations which were entirely unconvincing to me. If you put one of your potential explanations that I deleted back in, please try to flesh it out a little showing how it might relate to the actual comic instead of just sharing vague abstract philosophical similarities. Thank you! [[Special:Contributions/162.158.166.183|162.158.166.183]] 01:55, 18 May 2022 (UTC)

This reminds me a bit of [https://www.youtube.com/watch?v=CF2ZhY8xX_w The United Appeal for the Dead] in "Kentucky Fried Movie" [[User:Kimmerin|Kimmerin]] ([[User talk:Kimmerin|talk]]) 08:56, 18 May 2022 (UTC)

Is it really 'technically correct' to say that 'causality is the leading cause of death'? This seems like a category error to me. 'Causality' refers to the chain of events - it's not, in itself, a thing that can be a cause. I would say rather that this has the appearance of an obviously tautological statement, but in fact is meaningless nonsense. [[Special:Contributions/172.70.85.211|172.70.85.211]] 09:04, 18 May 2022 (UTC)

Talk:2620: Health Data

2022-05-18T09:06:34Z

172.70.85.211:

Did a basefor the setup[[Special:Contributions/108.162.246.34|108.162.246.34]] 23:51, 16 May 2022 (UTC)a

"Cure for Causality" sounds like a pretty good band name. [[Special:Contributions/141.101.104.4|141.101.104.4]] 07:13, 17 May 2022 (UTC)

Panel 1 reminds me of a conversation I had with one of my docs. I'd had some blood work done and the doc said, "The numbers look good. For a man your age." I mean, really; for a man my age? I didn't think we'd been talking about some teenager . . . . [[Special:Contributions/172.70.130.161|172.70.130.161]] 08:40, 17 May 2022 (UTC)
:Yeah, but it's possibly even worse when a gynacologist says those exact words... ;) [[Special:Contributions/172.70.162.77|172.70.162.77]] 11:23, 17 May 2022 (UTC)

Is poisoning other than drug overdoses that rare? The linked source states:
"1. Poisoning
Due in large part to the opioid epidemic, poisoning has overtaken car crashes as the country’s leading cause of accidental death, with 64,795 poisoning deaths in 2017, 22,000 of them from opioid painkillers. Additionally, people can be poisoned by common household substances, including:

Carbon monoxide
Pesticides and cleaning products
Lead"

even without the 22,000 opoid painkiller deaths posioning would still be number 1.[[Special:Contributions/162.158.50.68|162.158.50.68]] 09:25, 17 May 2022 (UTC)

:Yeah, I've re-checked that source and it doesn't actually seem that accurate in its numbers. I've replaced it with one that seems better. Wait, actually, that one's also pretty questionable. [https://www.cdc.gov/nchs/data/hestat/poisoning/poisoning.htm This one] seems accurate but not really all the information we're looking for—maybe the CDC has a better article? If someone could find one that is accurate and relevant, that would be a big help. [[User:Ncpenguin|Ncpenguin]] ([[User talk:Ncpenguin|talk]]) 02:24, 18 May 2022 (UTC)

:Well, there are other drugs you can overdose with. However, the most obvious problem with that statistics is that many people would assume that "poisoning" means "being deliberate poisoned", but most of those deaths from poisoning are accidents. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 21:39, 17 May 2022 (UTC)

Should we also link 1471 Gut Fauna wich shows another ewemple of Dr Ponytail practicing a weird form of medicine ?[[Special:Contributions/162.158.50.68|162.158.50.68]] 09:25, 17 May 2022 (UTC)

It is meant as a joke here, but ultimately life might just achieve this one day, uncoupling action from harm.

'Vagueness' is really an insufficient description for the absolute insanity that is blaming the passage of time for your problems. Almost to the point of being humorous in its own right. --[[Special:Contributions/172.69.33.199|172.69.33.199]] 10:13, 17 May 2022 (UTC)
: My nice little homo sapiens is turning into robots and they haven't even solved war. Curse evolution! I should have given them long distance communication thousands of years ago! [[Special:Contributions/172.70.230.143|172.70.230.143]] 15:35, 17 May 2022 (UTC)

Can it be also a pun: 'causality' vs 'casualty'? [[User:Tkopec|Tkopec]] ([[User talk:Tkopec|talk]]) 10:32, 17 May 2022 (UTC)

I think I might be covering up existing advantages with my description of a cold war from my dynamic ip. Be great if somebody could add cited material around that, but of course it's very hard to relate around norms of suppressed discussion. [[Special:Contributions/172.70.110.65|172.70.110.65]] 16:21, 17 May 2022 (UTC)

Check your family tree for any incidence of death. If all your forbears at any past generation are mortal, then science shows that with a high level of confidence that you are mortal.

The Inheritance Pattern of Death by Joseph Eastern, M.D., Carol Drucker, M.D. and John E. Wolf, Jr., M.D., 1982, J.I.R. Volume 28, Issue 22
[[http://www.linkedin.com/in/Comet Comet]] 17:40, 17 May 2022 (UTC)
:Sounds legit, although technically family history is not needed: statistically, everyone is mortal. The leading cause of death is being alive. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 21:39, 17 May 2022 (UTC)

If you have a lot of doctor visits, it's probably the case that you have some chronic illness, and also that you have a lot of measurements. Nevertheless, how many measurements you've had is not a good metric of health. Robert Carnegie rja.carnegie@gmail.com [[Special:Contributions/172.70.90.145|172.70.90.145]] 19:34, 17 May 2022 (UTC)

I'm convinced this particular comic is a snipe at poor control of {{w|availability bias}} and {{w|base rate fallacy}} in family medicine, (perhaps even involving the roots of the opioid crisis and similar scandals) so I added those and did a lot of copy-editing including adding some overlooked comic dialog and trimming about six or seven sentences of proposed possible explanations which were entirely unconvincing to me. If you put one of your potential explanations that I deleted back in, please try to flesh it out a little showing how it might relate to the actual comic instead of just sharing vague abstract philosophical similarities. Thank you! [[Special:Contributions/162.158.166.183|162.158.166.183]] 01:55, 18 May 2022 (UTC)

This reminds me a bit of [https://www.youtube.com/watch?v=CF2ZhY8xX_w The United Appeal for the Dead] in "Kentucky Fried Movie" [[User:Kimmerin|Kimmerin]] ([[User talk:Kimmerin|talk]]) 08:56, 18 May 2022 (UTC)

Is it really 'technically correct' to say that 'causality is the leading cause of death'? This seems like a category error to me. 'Causality' refers to the chain of events - it's not, in itself, a thing that can be a cause. I would say rather that this seems like an obviously tautological statement, but in fact is meaningless nonsense. [[Special:Contributions/172.70.85.211|172.70.85.211]] 09:04, 18 May 2022 (UTC)

Talk:2620: Health Data

2022-05-18T09:04:31Z

172.70.85.211:

Did a basefor the setup[[Special:Contributions/108.162.246.34|108.162.246.34]] 23:51, 16 May 2022 (UTC)a

"Cure for Causality" sounds like a pretty good band name. [[Special:Contributions/141.101.104.4|141.101.104.4]] 07:13, 17 May 2022 (UTC)

Panel 1 reminds me of a conversation I had with one of my docs. I'd had some blood work done and the doc said, "The numbers look good. For a man your age." I mean, really; for a man my age? I didn't think we'd been talking about some teenager . . . . [[Special:Contributions/172.70.130.161|172.70.130.161]] 08:40, 17 May 2022 (UTC)
:Yeah, but it's possibly even worse when a gynacologist says those exact words... ;) [[Special:Contributions/172.70.162.77|172.70.162.77]] 11:23, 17 May 2022 (UTC)

Is poisoning other than drug overdoses that rare? The linked source states:
"1. Poisoning
Due in large part to the opioid epidemic, poisoning has overtaken car crashes as the country’s leading cause of accidental death, with 64,795 poisoning deaths in 2017, 22,000 of them from opioid painkillers. Additionally, people can be poisoned by common household substances, including:

Carbon monoxide
Pesticides and cleaning products
Lead"

even without the 22,000 opoid painkiller deaths posioning would still be number 1.[[Special:Contributions/162.158.50.68|162.158.50.68]] 09:25, 17 May 2022 (UTC)

:Yeah, I've re-checked that source and it doesn't actually seem that accurate in its numbers. I've replaced it with one that seems better. Wait, actually, that one's also pretty questionable. [https://www.cdc.gov/nchs/data/hestat/poisoning/poisoning.htm This one] seems accurate but not really all the information we're looking for—maybe the CDC has a better article? If someone could find one that is accurate and relevant, that would be a big help. [[User:Ncpenguin|Ncpenguin]] ([[User talk:Ncpenguin|talk]]) 02:24, 18 May 2022 (UTC)

:Well, there are other drugs you can overdose with. However, the most obvious problem with that statistics is that many people would assume that "poisoning" means "being deliberate poisoned", but most of those deaths from poisoning are accidents. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 21:39, 17 May 2022 (UTC)

Should we also link 1471 Gut Fauna wich shows another ewemple of Dr Ponytail practicing a weird form of medicine ?[[Special:Contributions/162.158.50.68|162.158.50.68]] 09:25, 17 May 2022 (UTC)

It is meant as a joke here, but ultimately life might just achieve this one day, uncoupling action from harm.

'Vagueness' is really an insufficient description for the absolute insanity that is blaming the passage of time for your problems. Almost to the point of being humorous in its own right. --[[Special:Contributions/172.69.33.199|172.69.33.199]] 10:13, 17 May 2022 (UTC)
: My nice little homo sapiens is turning into robots and they haven't even solved war. Curse evolution! I should have given them long distance communication thousands of years ago! [[Special:Contributions/172.70.230.143|172.70.230.143]] 15:35, 17 May 2022 (UTC)

Can it be also a pun: 'causality' vs 'casualty'? [[User:Tkopec|Tkopec]] ([[User talk:Tkopec|talk]]) 10:32, 17 May 2022 (UTC)

I think I might be covering up existing advantages with my description of a cold war from my dynamic ip. Be great if somebody could add cited material around that, but of course it's very hard to relate around norms of suppressed discussion. [[Special:Contributions/172.70.110.65|172.70.110.65]] 16:21, 17 May 2022 (UTC)

Check your family tree for any incidence of death. If all your forbears at any past generation are mortal, then science shows that with a high level of confidence that you are mortal.

The Inheritance Pattern of Death by Joseph Eastern, M.D., Carol Drucker, M.D. and John E. Wolf, Jr., M.D., 1982, J.I.R. Volume 28, Issue 22
[[http://www.linkedin.com/in/Comet Comet]] 17:40, 17 May 2022 (UTC)
:Sounds legit, although technically family history is not needed: statistically, everyone is mortal. The leading cause of death is being alive. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 21:39, 17 May 2022 (UTC)

If you have a lot of doctor visits, it's probably the case that you have some chronic illness, and also that you have a lot of measurements. Nevertheless, how many measurements you've had is not a good metric of health. Robert Carnegie rja.carnegie@gmail.com [[Special:Contributions/172.70.90.145|172.70.90.145]] 19:34, 17 May 2022 (UTC)

I'm convinced this particular comic is a snipe at poor control of {{w|availability bias}} and {{w|base rate fallacy}} in family medicine, (perhaps even involving the roots of the opioid crisis and similar scandals) so I added those and did a lot of copy-editing including adding some overlooked comic dialog and trimming about six or seven sentences of proposed possible explanations which were entirely unconvincing to me. If you put one of your potential explanations that I deleted back in, please try to flesh it out a little showing how it might relate to the actual comic instead of just sharing vague abstract philosophical similarities. Thank you! [[Special:Contributions/162.158.166.183|162.158.166.183]] 01:55, 18 May 2022 (UTC)

This reminds me a bit of [https://www.youtube.com/watch?v=CF2ZhY8xX_w The United Appeal for the Dead] in "Kentucky Fried Movie" [[User:Kimmerin|Kimmerin]] ([[User talk:Kimmerin|talk]]) 08:56, 18 May 2022 (UTC)

Is it really 'technically correct' to say that 'causality is the leading cause of death'? This seems like a category error to me. 'Causality' refers to the chain of events - it's not, in itself, a thing that can be a cause. [[Special:Contributions/172.70.85.211|172.70.85.211]] 09:04, 18 May 2022 (UTC)

2620: Health Data

2022-05-18T08:59:44Z

172.70.85.211: /* Explanation */

{{comic
| number = 2620
| date = May 16, 2022
| title = Health Data
| image = health_data.png
| titletext = Donate now to help us find a cure for causality. No one should have to suffer through events because of other events.
}}

==Explanation==
{{incomplete|Created by A UNIQUE SEQUENCE OF PAST EVENTS YIELDING FURTHER INFORMATION IF INVESTIGATED - Please change this comment when editing this page. Do NOT delete this tag too soon.}}
[[Cueball]] is at [[:Category:Doctor Ponytail|Doctor Ponytail's]] office receiving examination or test results, but her statements are frustratingly generic, and entirely useless. She says that his "numbers" have revealed many "measurements" and "variables" but doesn't specify what they, or their values, are. The number of measurements observed is simply a product of how many have been taken, and not of Cueball's specific condition. In response to being asked whether that is bad, she ominously says that variables are the number one risk of "outcomes." This is obvious{{Citation needed}}, and therefore unhelpful, since every outcome is the product of some set of variables. Additionally, outcomes can be good, bad, or neutral, so it does not address the question. Doctor Ponytail further states that the past is "a big contributor to" the future, a similarly uninformative statement, as Cueball implies by asking whether that is just {{w|causality}}. The doctor replies that causality is the leading cause of death, which is so [[703: Honor Societies|tautological]] as to be meaningless (though technically correct).

Cueball tries to cut to the root of the issue by asking his chances of survival. Ponytail asks whether Cueball has a family history, but rather than asking for a history of specific illnesses, she is merely asking whether he has any family history at all. Her apparent concern on discovering that he does is presumably due to the fact that everyone who has a family history dies, and therefore she sees this as a negative thing. However, this is not medically informative, since everyone has some kind of family history (whether they personally know anything of it or not) and everyone eventually dies.{{Citation needed}}

The comic is likely a comment on the impenetrability of some medical diagnoses, where high levels of jargon and non-contextualized statistics, combined with a lot of hedging language, can leave patients none the wiser about their prospects or the relative merits of various courses of treatment. Similarly, it could be reflecting on the effects of {{w|availability bias}} and the {{w|base rate fallacy}} when medical practitioners are deriving diagnoses, treatment options, and similar conclusions from medical records designed to highlight the information necessary to diagnose specific well-understood illnesses. It may also be making fun of poorly defined health statistics: statistics for the [https://medicalxpress.com/news/2014-03-poisoning-unintentional-death.html leading causes of accidental death in the United States], for example, typically cite 'poisoning' as the number one cause, even though poisoning other than drug overdoses is actually quite rare. The comic takes vague statistics to the extreme, citing 'causality' as the leading cause of death.

The title text continues the joke, suggesting that researchers are searching for a cure for causality, which is absurd and inconceivable.

The comic as a whole is reminiscent of [[830: Genetic Analysis]] and [[1840: Genetic Testing Results]] (particularly the title text of the latter), as the information given by the doctor in all three is self-evident and useless as a result.

==Transcript==
:[Cueball and Doctor Ponytail are talking to each other. Cueball is sitting on an examination table and Doctor Ponytail, in a doctor's coat, is looking down and reading from a clipboard with some illegible writing on it.]
:Doctor Ponytail: I'm taking a look at your numbers, and it doesn't look good.
:Doctor Ponytail: You have a lot of measurements. Quite a few variables.

:[Same setting but Doctor Ponytail looks up at Cueball.]
:Cueball: Is that... bad?
:Doctor Ponytail: Variables are the #1 risk factor for outcomes.
:Doctor Ponytail: The past is a big contributor to the future.

:[Same setting but Doctor Ponytail puts her arm with the clipboard down.]
:Cueball: Isn't that just causality?
:Doctor Ponytail: Causality is the leading cause of death in this country.

:[Same setting.]
:Cueball: So what are my odds?
:Doctor Ponytail: Do you have a family history?
:Cueball: Of what?
:Doctor Ponytail: Just, in general.
:Cueball: ...Yes?
:Doctor Ponytail: Oh no.

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Ponytail]]
[[Category:Doctor Ponytail]]
[[Category:Medicine]]

2620: Health Data

2022-05-18T08:57:53Z

172.70.85.211: /* Explanation */

{{comic
| number = 2620
| date = May 16, 2022
| title = Health Data
| image = health_data.png
| titletext = Donate now to help us find a cure for causality. No one should have to suffer through events because of other events.
}}

==Explanation==
{{incomplete|Created by A UNIQUE SEQUENCE OF PAST EVENTS YIELDING FURTHER INFORMATION IF INVESTIGATED - Please change this comment when editing this page. Do NOT delete this tag too soon.}}
[[Cueball]] is at [[:Category:Doctor Ponytail|Doctor Ponytail's]] office receiving examination or test results, but her statements are frustratingly generic, and entirely useless. She says that his "numbers" have revealed many "measurements" and "variables" but doesn't specify what they, or their values, are. The number of measurements observed is simply a product of how many have been taken, and not of Cueball's specific condition. In response to being asked whether that is bad, she ominously says that variables are the number one risk of "outcomes." This is obvious{{Citation needed}}, and therefore unhelpful, since every outcome is the product of some set of variables. Additionally, outcomes can be good, bad, or neutral, so it does not address the question. Doctor Ponytail further states that the past is "a big contributor to" the future, a similarly uninformative statement, as Cueball implies by asking whether that is just {{w|causality}}. The doctor replies that causality is the leading cause of death, which is also so tautological as to be meaningless though technically correct.

Cueball tries to cut to the root of the issue by asking his chances of survival. Ponytail asks whether Cueball has a family history, but rather than asking for a history of specific illnesses, she is merely asking whether he has any family history at all. Her apparent concern on discovering that he does is presumably due to the fact that everyone who has a family history dies, and therefore she sees this as a negative thing. However, this is not medically informative, since everyone has some kind of family history (whether they personally know anything of it or not) and everyone eventually dies.{{Citation needed}}

The comic is likely a comment on the impenetrability of some medical diagnoses, where high levels of jargon and non-contextualized statistics, combined with a lot of hedging language, can leave patients none the wiser about their prospects or the relative merits of various courses of treatment. Similarly, it could be reflecting on the effects of {{w|availability bias}} and the {{w|base rate fallacy}} when medical practitioners are deriving diagnoses, treatment options, and similar conclusions from medical records designed to highlight the information necessary to diagnose specific well-understood illnesses. It may also be making fun of poorly defined health statistics: statistics for the [https://medicalxpress.com/news/2014-03-poisoning-unintentional-death.html leading causes of accidental death in the United States], for example, typically cite 'poisoning' as the number one cause, even though poisoning other than drug overdoses is actually quite rare. The comic takes vague statistics to the extreme, citing 'causality' as the leading cause of death.

The title text continues the joke, suggesting that researchers are searching for a cure for causality, which is absurd and inconceivable.

The comic as a whole is reminiscent of [[830: Genetic Analysis]] and [[1840: Genetic Testing Results]] (particularly the title text of the latter), as the information given by the doctor in all three is self-evident and useless as a result.

==Transcript==
:[Cueball and Doctor Ponytail are talking to each other. Cueball is sitting on an examination table and Doctor Ponytail, in a doctor's coat, is looking down and reading from a clipboard with some illegible writing on it.]
:Doctor Ponytail: I'm taking a look at your numbers, and it doesn't look good.
:Doctor Ponytail: You have a lot of measurements. Quite a few variables.

:[Same setting but Doctor Ponytail looks up at Cueball.]
:Cueball: Is that... bad?
:Doctor Ponytail: Variables are the #1 risk factor for outcomes.
:Doctor Ponytail: The past is a big contributor to the future.

:[Same setting but Doctor Ponytail puts her arm with the clipboard down.]
:Cueball: Isn't that just causality?
:Doctor Ponytail: Causality is the leading cause of death in this country.

:[Same setting.]
:Cueball: So what are my odds?
:Doctor Ponytail: Do you have a family history?
:Cueball: Of what?
:Doctor Ponytail: Just, in general.
:Cueball: ...Yes?
:Doctor Ponytail: Oh no.

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Ponytail]]
[[Category:Doctor Ponytail]]
[[Category:Medicine]]

Talk:2618: Selection Bias

2022-05-16T10:32:10Z

172.70.85.211: Is xkcd only for engineers?

Why is the site giving errors so much? [[Special:Contributions/172.70.130.121|172.70.130.121]] 21:19, 11 May 2022 (UTC)
:It just went down for about ten minutes. Once in a while I was able to get pages to load, but it was rare (probably 3-5 times). Most of the pages that did load had no CSS. [[Special:Contributions/172.70.130.161|172.70.130.161]] 22:03, 11 May 2022 (UTC)
:I blame a secret global infiltration by brain-eating extraterrestrials bent on steadily eroding our infrastructure while we kill each other in stimulated warfare. Do you agree with this common hypothesis? [[Special:Contributions/172.70.114.241|172.70.114.241]] 01:00, 12 May 2022 (UTC)

I love the [https://www.explainxkcd.com/wiki/index.php?title=2618%3A_Selection_Bias&type=revision&diff=268675&oldid=268673 current explanation] of the title text, thanks [[User:Kev|Kev]] ;-) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 06:38, 12 May 2022 (UTC)
:: I am the individual on mobile who revised the referenced text so as to mention engineers. This above comment by Kynde was added after my revision, but links to the previous version which was not current at the time of their post. I do not know why they call it current. [[Special:Contributions/162.158.62.123|162.158.62.123]] 07:07, 13 May 2022 (UTC)
:Hear, hear! A true gem! [[Special:Contributions/172.69.134.17|172.69.134.17]] 07:37, 12 May 2022 (UTC)
:Thank you kindly, meanwhile I return to find a much improved BALLPIT APPARTMENT and have come to say ''I got that reference'' and heartilly approve''''Italic text''''[[User:Kev|Kev]] ([[User talk:Kev|talk]]) 22:27, 12 May 2022 (UTC)
::I agree wholeheartedly, but what does it have to do with selection bias??? [[Special:Contributions/172.70.114.241|172.70.114.241]] 01:06, 13 May 2022 (UTC)Bumpf
::I don't get it at all, which kind of defeats the point of Explain XKCD when people are adding inside jokes. [[Special:Contributions/172.70.130.121|172.70.130.121]] 05:06, 13 May 2022 (UTC)
::: it's a reference to [[150: Grownups]] and [[162: Angular Momentum]], two very well known xkcd comics (so much so they are the footer comics!)[[Special:Contributions/172.69.69.250|172.69.69.250]] 13:35, 13 May 2022 (UTC)Bumpf
:::: Neither of those have anything whatsoever to do with this comic, and I never look at the footer, assuming I even read comics on the XKCD website rather than here. [[Special:Contributions/172.70.126.221|172.70.126.221]] 18:07, 13 May 2022 (UTC)
:::: I wonder if they are practicing familiarity with xkcd ! Anything drawn from xkcd makes you sound like a nettie cause randal half parroted nettie culture to make stuff. [[Special:Contributions/172.70.110.209|172.70.110.209]] 00:00, 14 May 2022 (UTC)
:: They're randomly drawn phrases out of a brain filled with XKCD, so there may be some bias in what words are selected. There may be a risk of becoming [[917:_Hofstadter|so meta even for any acronyms]] [[User:Kev|Kev]] ([[User talk:Kev|talk]]) 17:20, 13 May 2022 (UTC)

Acquiescence bias is often used in sales to try to induce a bigger sale. Asking, "Will there be anything else?" instead of "Is that all?" can make a significant difference in the amount of a sale, even though you are still leaving the decision up to the customer. [[User:Nutster|Nutster]] ([[User talk:Nutster|talk]]) 06:30, 13 May 2022 (UTC)

WHY is the explanation unsure if she made the error accidentally??!? It's clearly intentional and part of her presentation! Ugh, one thing that always bugs me about this site, how often people express uncertainty where there's certainty... Don't be so timid! LOL! [[User:NiceGuy1|NiceGuy1]] ([[User talk:NiceGuy1|talk]]) 05:13, 14 May 2022 (UTC)
:Of course she makes the mistake and is not aware of it. This becomes clear when they do the same in the title text. The joke is that she is not aware of it, or else it would not even be fun. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 18:45, 15 May 2022 (UTC)
::She is 100% aware of it, she isn't making any mistake, she is DEMONSTRATING Selection Bias completely on purpose as part of her presentation on Selection Bias. It is the AUDIENCE who is participating by accident, not realizing that by voting that they are demonstrating the bias. THAT is the joke, THAT is the fun, that they are pawns in her presentation. She is cleverly using them without their knowledge or realization. Her next line could be "See? I got you!". :) [[User:NiceGuy1|NiceGuy1]] ([[User talk:NiceGuy1|talk]]) 05:44, 16 May 2022 (UTC)

> Are you familiar with that webcomic for engineers
I always assumed it was mainly for scientists...

641: Free

2022-05-12T19:29:30Z

172.70.85.211: /* Explanation */ Did not properly address the (competing) negative claims. Had overlooked the full "positive by exception" nature of such a claim.

{{comic
| number = 641
| date = September 25, 2009
| title = Free
| image = free.png
| titletext = Asbestos is bad; definitely get the one on the right. Wait -- this one over here has no swine flu! Now I can't decide.
}}

==Explanation==
{{w|Asbestos}} is a fibrous material most commonly known and used for its heat-resistant properties. It was commonly used in housing insulation until its astonishingly destructive effects on human lungs were discovered. The use of asbestos in housing is now banned, but asbestos is still quite common in laboratory hot pads, as well as in concrete industrial buildings where the risk of it getting into the air is minimal.

The comic depicts a common advertising trick taken to an absurd extreme; quite clearly all of the cereal products depicted are asbestos-free, but most have opted not to advertise that fact (if it even occurred to them at all) because it should be obvious. A more realistic example can be found in {{w|Confectionery|confectionery}} products, wherein the term "{{w|fat}} free" might be applied when it's clear that {{w|sugar}}, {{w|gelatin}}, and other ingredients involved in the product are in no way related to, or contain, fat. Note that in some countries, like Germany for example, this practice is actually not allowed, since it counts as "misleading advertising".

While the suggestive implication might be that competitive products do not declare as asbestos free because they cannot truthfully say this, the irony may be that the "asbestos-free" disclaimer could also cause a customer to ''distrust'' the product on the grounds of {{w|Damning with faint praise|damning by faint praise}}—if the best thing they can say about a product is that it doesn't contain a toxic building material, do we really want to know what actually ''is'' in this stuff?

The claim in the title text—that a rival product has no {{w|swine flu}}—is equally superfluous, as any food product containing disease-causing viruses would be subject to recalls, severe fines, and quite a few people losing their jobs; the fact that the product is actually on a supermarket shelf implies that it already has a stellar reputation for not causing serious illness.{{Citation needed}} The use of it here could also be a reference to [[574: Swine Flu]].

The competing claims, however, sets up the ''hopefully'' false risks involved in whether to choose the one with definitely no asbestos (but possibly contains swine flu) or the other that definitely has no swine flu (but may include asbestos).

* GenCo probably stands for {{w|Generic brand|Generic}} or General Company and may be a reference to {{w|General Mills}}

* [http://ghostbusters.wikia.com/wiki/Stay_Puft_Marshmallows Stay Puft] is also the company that produces marshmallows in the movie franchise [[wikipedia:Ghostbusters_%28franchise%29| Ghostbusters]].

* [http://redfarmnyc.com/ RedFarm] is a Chinese restaurant in NYC.

Misleading advertising is also the subject of the previous comic [[624: Branding]], and of subsequent comics [[870: Advertising]] and [[993: Brand Identity]].

==Transcript==
:[A shelf holds 3 boxes of cereal. Each box shows a bowl of cereal.]
:GenCo Ⓞat Cereal
:StayPuft Oat Cereal
:RedFarm Oat Cereal (with additional text in a star) Asbestos-free!
:I hate whatever marketer first realized you could do this.

{{comic discussion}}

2301: Turtle Sandwich Standard Model

2022-05-11T18:35:06Z

172.70.85.211: Undo revision 265629 by 👖🔥 (talk)

{{comic
| number = 2301
| date = May 1, 2020
| title = Turtle Sandwich Standard Model
| image = turtle_sandwich_standard_model.png
| titletext = It's possible the bread and shell can be split into a top and bottom flavor, and some models additionally suggest Strange Bread and Charm Shells.
}}

==Explanation==
This comic references particle physics. The {{w|Standard Model}} of physics explains the base particles and fields that make up the universe. The elementary {{w|fermions}} of the standard model can be laid out in a 3×4 grid, with three "{{w|Generation (particle physics)|generations}}" of matter, each containing a {{w|quark}} with charge +⅔, a quark with charge -⅓, a {{w|lepton}} with charge -1, and a {{w|neutrino}} with charge 0. The first generation contains the familiar up and down quarks, which make protons and neutrons, the electron, and the electron neutrino. Each succeeding generation of matter is more massive than the one before, and only the first generation of particles occurs naturally on Earth; the others have only been created and identified in particle accelerator experiments (although they also arguably exist in various extreme places around the universe; for example, the strange quark is suspected to be a component of the denser parts of neutron stars).

Quarks were initially proposed by {{w|Murray Gell-Mann}} to simplify the "{{w|particle zoo}}" that physicists were discovering. He found that the twenty-five or so mesons and hadrons that were known at that time could be organized into what he called the "{{w|eightfold way (physics)|eightfold way}}" by just three properties: {{w|spin (physics)|spin}}, charge, and what he called "{{w|strangeness}}". He proposed that three quarks (and their corresponding antiquarks) governed these properties. His chart had an empty space for what he called the {{w|omega baryon}}, and when a particle of the properties he predicted (including its mass) was discovered, his model received a lot of support. The quark model was eventually extended to include six quarks, and as with the eightfold way, one of the lines of evidence in favor of what became known as the Standard Model is that it predicted the existence and masses of several particles, which have since been confirmed; the {{w|top quark}}'s mass was predicted in 1973, and experimentally verified in 1995, for example, and on the {{w|gauge boson}} side of the chart, the {{w|Higgs boson}} was discovered in 2012.

In this comic strip, sandwiches (lettuce, cheese, tomato, and possibly other fillings, surrounded by bread) and turtles (an aquatic reptile which wears an armored shell) are likewise proposed to not be "elementary" entities, but in fact combinations of 4 elementary parts, namely bread, fillings, reptile, and shell. The narrator's lab is looking for the hypothesized "bread-shelled turtle" and "shell-coated sandwich". In fiction, turtles' shells are often depicted as articles of clothing which they can remove at will, but in the real world, the shell is a part of the turtle's skeleton, so unless the narrator's lab is willing to commit extremely invasive surgery, they will never find a bread-shelled turtle, although they could much more easily take the shell of a dead turtle and put some sandwich fillings inside.

The failure to detect the bread-shelled turtle could be taken as evidence that the turtle-sandwich standard model is flawed -- perhaps turtles and sandwiches are elementary entities, or perhaps the elementary entities that make them are much smaller than is proposed here. There is also the small matter that there are things besides sandwiches and turtles in the universe{{Citation needed}}. Alternatively, it could be taken as evidence that the bread-shelled turtle has an extremely high energy, and so does not exist under typical conditions of our universe. This might be analogous to {{w|magnetic monopole}}s; we would know one if and when we saw one (and many experiments have sought them out), and we believe we know how they would behave, but no such particle has ever been verifiably detected or created.

In the same vein, the lack of observation could be due to the instability of the arrangements. Turtleshell-turtle assemblies can last for more than 100 years, while bread-filling assemblies are indefinitely stable under {{w|Refrigeration|sufficiently low energies}}. The two other arrangements may simply be formed rarely, and have a relatively short half-life.

The title text introduces more particle physics jargon, proposing that the "top and bottom" parts of the bread and/or shell have distinct "{{w|Flavour (particle physics)|flavors}}", and that there may be "strange" and "charm" variants as well (a reference to the higher-generation quarks -- strange and charm in the second generation, and top and bottom in the third).

Unlike the turtle-sandwich standard model, there are no particles predicted by our Standard Model that have not yet been detected; however, there are several gaps between the pure Standard Model and what we observe in reality, most notably the {{w|Quantum gravity|existence of gravity}} and the {{w|Baryon asymmetry|apparent asymmetry}} between the amounts of {{w|matter}} and {{w|antimatter}} in the universe. For this reason, the Standard Model is generally considered to be somehow incomplete.

=== Trivia ===

* Comic [[474]] also puns on the flavors of quarks.
* The phrase "Turtle Sandwich Standard Model" fits the same trochaic tetrameter stress pattern as ''Teenage Mutant Ninja Turtles'' and other Wikipedia articles enumerated in [[1412: Teenage Mutant Ninja Turtles]].
* The comic may be a nod to turtles similarly used as metaphors in philosophy (cf. {{w|Achilles and the Tortoise}}) or religion and cosmology (cf. the {{w|World Turtle}}).
* As of 5:23am UTC on 4 May 2020 a glitch caused the comic image to display at 4682 pixels wide when viewed on non-Retina/HiDPI screens.

==Transcript==

:[A two-by-two grid, with a piece of bread next to the top left cell; a turtle shell next to the bottom left cell; lettuce, cheese, and tomato above the top left cell; and an turtle head enclosed in a circle above the top right cell.]

:[Top left cell: an image of a sandwich.]
✔ CONFIRMED

:[Top right cell: an image of a shell-less turtle sandwiched between two slices of bread.]
(?)

:[Bottom left cell: an image of a turtle shell housing lettuce, cheese, and tomato - the contents of a sandwich.]
(?)

:[Bottom right cell: an image of a turtle.]
✔ CONFIRMED

:[Caption below the panel]
Our lab is working to detect the two missing pieces of the turtle-sandwich standard model.

{{comic discussion}}
[[Category:Science]]
[[Category:Physics]]

700: Complexion

2022-05-11T18:34:01Z

172.70.85.211: Undo revision 265475 by 👖🔥 (talk)

{{comic
| number = 700
| date = February 10, 2010
| title = Complexion
| image = complexion.png
| titletext = Why do all my attempts at science end with me being punched by Batman? (P.S. benzoyl peroxide soap works great.)
}}

==Explanation==
[[Cueball]] suffers from {{w|acne}}. Like many others afflicted with the same condition, he uses skin care products designed to treat acne. Unlike most other people, he does his own controlled trial by using them on only one half of his face and measuring the effects; the blemishes on the treated half of his face are noticeably diminished, while the untreated half remains the same, allowing him to isolate the effects of the cream versus the effects of time.

He convinces his friends to try the same experiment with different treatments so they can find out which works the best. In order to properly randomize the trials, he flips a coin. However, because half of his face is "scarred" (with acne blemishes), he's flipping a coin, and appears to be threatening someone with acid, he's mistaken for the Batman villain {{w|Two-Face}}. (Two-Face flips a coin to decide whether his victims will live or die, and was badly burned by acid on exactly one half of his face.) Cueball is subsequently punched by Batman; the title-text implies this has happened before.

{{w|Salicylic acid}} and {{w|benzoyl peroxide}} are both chemicals known for their skin care effects (salicylic acid in particular is also used to treat {{w|psoriasis}}).

==Transcript==
:I get frustrated trying to judge whether acne creams are having any effect. In the spirit of a controlled trial, I used one on just half my face for a few weeks.
:[A graph shows pimples vs. time, with two lines: one remains one steady, and one is declining.]

:It was cool seeing the effects so clearly, so I got some friends to try different treatments in an impromptu study.
:[Cueball looks in a mirror, sees a half-pimpled face, and applies a treatment.]

:[Cueball is talking to Ponytail and Megan, each with some pimples also.]
:Cueball: Okay, you try the salicylic acid first.
:Ponytail: Wait, we should randomize the trials. Got a coin?

:Cueball: Okay, call it. Heads, she gets the-
:(Off-panel): YOU!

:[Batman runs into frame and punches Cueball. The coin goes flying.]

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics with color]]
[[Category:Line graphs]]

1976: Friendly Questions

2022-05-11T18:32:25Z

172.70.85.211: Undo revision 265711 by 👖🔥 (talk)

{{comic
| number = 1976
| date = April 4, 2018
| title = Friendly Questions
| image = friendly_questions.png
| titletext = Just tell me everything you're thinking about in order from most important to last, and then we'll be friends and we can eat apples together.
}}

==Explanation==
A common theme in xkcd is [[:Category:Social interactions|social awkwardness]]. Oftentimes [[Cueball]]/[[Randall]] will grossly overthink casual social interactions, such as small talk.

In this comic, Cueball has prepared a note to himself, preparing for the said small talk with [[Hairy]], but it ultimately backfires. This is very similar to the comic [[1961: Interaction]] which came out just 5 weeks before this one. And a similar interaction between Cueball and Hairy occurs in [[1917: How to Make Friends]] from less than half a year before this comic.

In this comic, Cueball has prepared for a conversation with Hairy, by writing an instructional note for himself. The note tells him to start the conversation by asking some questions about the other person. In theory, this is perfectly good conversational advice; unfortunately, Cueball's understanding of social interactions is so abstract that he actually has no idea ''what'' questions to ask. He hastily improvises a question about the number of apples Hairy has eaten in his lifetime, which, although it does meet the criteria suggested by the note, is not a particularly interesting or meaningful question to ask someone. Cueball realizes from Hairy's reaction that he has made a mistake, and decides to abort the interaction.

Normally, one would ask questions such as "How are you?" or "What have you been up to lately?", instead of asking random facts of someone else's life, such as "How many apples have you eaten in your life?"{{Citation needed}}

The title text continues to show the flaws in Cueball's approach to social interaction, which is very systematic: he seems to trying to create some kind of reproducible methodology that he can follow in order to carry out a conversation, unaware that conversations tend to be spontaneous and do not follow rigidly defined rules. Additionally, one of the main points of conversation is to gain some understanding of the other person; by focusing on the conversation ''itself'', Cueball is denying the very purpose of the interaction.

A slight side-joke is the list being numbered despite only containing one item, although this could imply that Cueball has other notes that he would have continued to refer to if the first one produced a successful result.

The advice to "Ask them about themselves", specifically noted as the "first thing" after introducing yourself, was promoted to overcome society anxiety in the {{w|Periscope}}-based videocast of {{w|Scott Adams}}, creator of the ''{{w|Dilbert}}'' comic strip (see audio-only podcast [http://blog.dilbert.com/2018/04/04/episode-12-youtube-shooter-amazon-com-trade-war-and-overcoming-social-anxiety/]). Given Randall's personality and previous professional vocation (working with nerds at {{w|NASA}} and in academia), it is highly likely he would be a fan of the strip and also the creator's related works such as Adams's blog, Twitter feed, and the like. The real coincidence is the videocast in question likely occurred ''just a day before this comic was published''; the audio was published the same day as the comic and usually delays the video by a day.

==Transcript==
:[Cueball and Hairy meet each other.]
:Cueball: Hey!
:Hairy: Oh, hi!

:[Cueball looks down at a sticky note in his hand.]

:[The yellow sticky note reads:]
:Normal human conversation
:<hr width="150" style="background-color:black" align="left">
:1. Ask them about themselves

:[Cueball looks at Hairy.]
:Cueball: How many...apples...have you eaten?
:Hairy: ...Like, in my life?
:Cueball: Yes.
:Hairy: ...
:Cueball: ...I should go.
:Hairy: OK.

{{comic discussion}}

[[Category:Comics with color]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Hairy]]
[[Category:Social interactions]]

1886: Typing Notifications

2022-05-11T18:31:56Z

172.70.85.211: Undo revision 265708 by 👖🔥 (talk)

{{comic
| number = 1886
| date = September 6, 2017
| title = Typing Notifications
| image = typing_notifications.png
| titletext = Over the years I've decided I'd rather have them on than not, but I'm glad there aren't "has opened a blank note to compose a reply to you" notifications.
}}

==Explanation==
[[Randall]] has sent an instant message to someone and is now watching the screen expecting a reply. The message contains simple questions about a show Randall had undertaken and he insists on an honest answer. The phone indicates that the respondent is typing a response, but then pauses, resumes typing, and pauses a second time, before sending a simple "It was great!"

Typing notifications, often called "typing awareness indicator", is a feature of some {{w|instant messaging}} systems. It lets you know when the other person in a conversation is typing and preparing a reply. It may appear in different forms, like the literal text "[Contact] is typing." or often has a empty answer (possibly a different color) containing three animated dots. It gives the sender confidence that their message has been received and the other one is working on a reply.

When the final response is received it is anodyne "It was great", suggesting that the first two deleted drafts could be far more critical. The fact that you know that a message has been deleted or edited twice provokes you to imagine what the deleted drafts may have contained. The issue with typing notifications that Randall is talking about might also just be the difficulty to interpret them. The distant contact might just have been doing something else at the same time, had a bad, unsteady internet connection, started typing in the wrong conversation, or corrected a typo, but because Randall has interpreted the long pauses the same way one would read face-to-face interactions, the typing notifications make it seem like they weren't honest.

If one partner of a conversation takes their sweet time to reply, possibly deleting their text and starting from scratch as shown in this comic, the typing notification feature can lead to anxiety, as the person waiting for a response starts to overthink the issue. Thoughts come to mind like the other person might not be honest, try to carefully word a sensitive subject or not care enough about you to quickly reply. If finally the answer arrives and consists of just a laconic "ok" or similar, these feelings become even stronger, leading to thoughts like the other person is trying to hide something. This phenomenon has become so widespread that many people have written about it in newspapers and blogs, calling it [https://www.nytimes.com/2014/08/31/fashion/texting-anxiety-caused-by-little-bubbles.html texting anxiety].

The caption below the screens summarizes that what Randall dislikes the most about these systems of notification that the other party on the conversation is actively working on a reply is the lengthly alternation between indications that the other party is composing a reply, amidst pauses wherein one presumes the other party is thinking carefully about what they are wanting to say, then more typing as in response to their deep thinking, etc. until at the end of this extended period when one expects the other side to have written a book's worth of notes given the time and work they appear to have dedicated to the reply -- and all they get is a simple 3-word reply. It leaves him wondering what all the other party really typed, and really thought, that they ended up not sending. This type of notification was mentioned as rule no. 1 in the much later [[2235: Group Chat Rules]].

One way around giving your text receiver texting anxiety would be to open a blank note and work out what you want to say there. Since you're not typing in the messaging app, there's no typing notification.

In the title text, Randall expresses that he likes to watch when the recipient reacts and is trying to write an answer but he's also happy to not receive notifications that the texter is composing a response in a blank note file. Typically, one composes responses in blank notes when they need to be careful or thoughtful about how they respond (as well as avoid alerting the recipient, via the notifications, that they've received their text and are preparing a response). If Randall were to be notified about such actions, it would confirm his above fears that the writer was being tactful and guarded in their response, which would just lead to more anxiety about what they were trying to hide. Also, it would expose him if he wanted to compose his own message privately.

==Transcript==
:[A sequence of eight panels representing the same conversation in an electronic chat. The header always reads:]
:What did you think of my show? Did you like it? Be honest!

:[The reply area on the first seven panels is empty, but on the 2nd, 3rd, 5th, and 7th the input is activated and showing three dots.]

:[On the last panel the reply area reads:]
:It was great!

:[Caption below the panels:]
:My least favorite aspect of typing notifications

{{comic discussion}}

[[Category:Computers]]
[[Category:Social networking]]
[[Category:Social interactions]]
[[Category:Phones]]

2299: Coronavirus Genome 2

2022-05-11T18:31:21Z

172.70.85.211: Undo revision 265953 by 👖🔥 (talk)

{{comic
| number = 2299
| date = April 27, 2020
| title = Coronavirus Genome 2
| image = coronavirus_genome_2.png
| titletext = [moments later, checking phone] Okay, I agree my posting it was weird, but it's somehow even more unnerving that you immediately liked the post.
}}

==Explanation==
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|COVID-19 pandemic}}.

It is also a direct continuation of the previous comic, [[2298: Coronavirus Genome]], making this a [[:Category:Coronavirus Genome|new series]].

[[Megan]] sent her copy of the coronavirus genome to [[Cueball]], who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the Internet, though not in a form that can actually make people sick with COVID-19 (which may seem obvious, but then some people [https://www.forbes.com/sites/brucelee/2020/04/09/5g-networks-and-covid-19-coronavirus-here-are-the-latest-conspiracy-theories/ believe 5G causes coronavirus].) If his post catches on and is widely shared, it might be described as "going viral".(This "virtually" spreading the {{w|COVID-19|coronavirus}}, would be a prank).
Additionally while exchanging research data generally is as good an idea as using readymade tools for science publishing the genome of a dangerous virus actually might cause the virus to spread further: There are specialized manufacturers that can mail you arbitrary DNA snippets if you send them their sequence as an ASCII file. That actually can work in the other direction, too: Some of the machines used by such firms in order to save space stored a base pair in 4 bits of memory and could (using a buffer overrun) be convinced to actually try to execute instead of manufacturing the DNA code.

In continuation of the previous strip, Cueball appears to be fascinated by the fact that the entire genome of this very consequential virus can be fully detailed in a text file, using only 30,000 characters. He realizes that he can't fit this much information in a single tweet (Twitter has a 280 character limit), but is able to fit the entire genome in a Facebook post (Facebook allows [https://www.zdnet.com/article/facebook-increases-status-update-character-limit-to-63206/ up to 63,206 characters in a post]).

This strip draws humor from the contrast between the costly physical precautions that are being taken to prevent the spread of coronavirus between people and the blitheness with which Cueball attempts to share (the genome of) the coronavirus electronically. Cueball's response (that it's okay, because he sanitized his phone before posting) could be taken as a sarcastic rebuttal, given that Megan sent the genome to him without knowing why he wanted it, or a commentary on the useless or counterproductive behaviors of clueless people (e.g. people who wear gloves before touching potentially-contaminated surfaces, but then scratch their noses while still wearing the possibly-contaminated gloves). It could also be a reference to the ''{{w|The Hitchhiker's Guide to the Galaxy|Hitchhiker's Guide to the Galaxy}}'' series, in which humanity is revealed to possibly be the descendants of the "useless" occupants of the planet Golgafrincham, including telephone sanitizers; unfortunately, after sending their useless members to the planet later called Earth, the remaining Golgafrinchans were subsequently wiped out by a plague caught from an unsanitized telephone. This may also be a reference to the concept of digital data sanitization (the screening of user inputs to prevent exploitation of security flaws) as in [[327: Exploits of a Mom]].

The title text deals with the almost inevitable outcome of the resulting message being 'liked' by some other party. In this case Megan, although she just told Cueball it was weird that he shared it. This may be a commentary on the common reflex to "like" your friend's posts, even if you think they're strange. Alternately, the "like" button on Facebook was historically the only way to signal a reaction to a post (other than actually commenting). When someone posted about a bad event, such as an injustice, a tragedy, or a difficult personal event, people might "like" the post to indicate their support of the person posting it, but it could read as having positive feelings toward the incident itself. (Facebook has since added multiple reaction buttons to express such emotions as surprise, sadness or anger). In this case, Megan "like"ing the coronavirus genome could be taken to mean that she likes the virus itself, which would be quite odd.

==Transcript==
:[Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.]
:Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?
:Megan: Sure.
:Megan: ...Why?

:[Megan has turned to her her laptop typing on it, Cueball is off-panel.]
:Cueball (off-panel): Nothing.
:Megan: I ... see.
:Megan: Well, here you go.
:Laptop: Click

:[In "two" frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square "speech bubble" with a "speech line" going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.]
:Phone:
::GAAAGGTAAGATGGAGAGGCCTTGTCCCTGGTTCAACGAGAA
::-29,602 (+) Tweet

:[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]
:Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post.
:Megan: Unsettling that your first instinct is "share it online."
:Cueball: It's cool, I sanitized my phone before posting.

{{comic discussion}}

[[Category:Comics with color]]
[[Category:Coronavirus Genome]]
[[Category:Comics sharing name|Coronavirus Genome]]
[[Category:COVID-19]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Biology]]
[[Category:Social networking]]

1244: Six Words

2022-05-11T18:31:03Z

172.70.85.211: Undo revision 266104 by 👖🔥 (talk)

{{comic
| number = 1244
| date = July 29, 2013
| title = Six Words
| image = six words.png
| titletext = Ahem. We are STRICTLY an Orbiter shop.
}}

==Explanation==
The six words are: "It works in ''Kerbal Space Program''".

The {{w|Kuiper Belt}} is a region of the outer Solar System beyond the orbit of Neptune consisting of numerous small icy bodies, including the dwarf planets {{w|Pluto}} and {{w|Eris (dwarf planet)|Eris}}. An {{w|Oberth effect|Oberth maneuver}} is a spaceflight maneuver, specifically an engine burn performed during the flyby of a celestial body. The point of this is to optimize usable energy, because rocket burns are more effective to perform at high speeds than at low speeds. The more massive the body and the lower the altitude, the higher the flyby speed will be, and the greater the performance gain due to the Oberth effect. The theoretical way to use rocket fuel most efficiently is therefore to execute the burn during a flyby of the most massive celestial body available, as close as possible.

[[Cueball]] is proposing to implement an "Oberth Kuiper Maneuver", and the proposal diagram shows the spacecraft using {{w|Gravity assist|gravity assists}} to travel first towards (presumably) {{w|Venus}} for a first boost, then towards Jupiter for another swing by, aiming it back towards the {{w|Sun}}, the most massive Solar System body, to perform an Oberth maneuver at the point of closest approach, as indicated by a small dot along the spacecraft trajectory. It is possible that the diagram might only be a simplified outline of a more complex flight plan. For example, the trajectory from Earth to Venus would require two separate burns in deep space. The first burn would occur immediately after escaping Earth's sphere of influence. The second burn would occur about halfway to Venus. Alternatively, Cueball may have gotten it wrong, or [[Randall]] may simply not have concerned himself with such things for the purpose of a webcomic sketch.

An Oberth maneuver in the close vicinity of the Sun, while theoretically possible and extraordinarily effective at the speeds the spacecraft would reach, would however be very difficult to carry out in real life, because the neighborhood of the Sun is an extremely hostile environment{{Citation needed}} and the spacecraft could be incinerated during a too-close flyby.

Cueball's argument for why the maneuver will work in real life is that it works in ''{{w|Kerbal Space Program}}'' (KSP), a sandbox spaceflight simulator game. While KSP does simulate a lot of the physics of space flight, it is (necessarily) simplistic in its modeling of orbital dynamics. For example, KSP does not do any {{w|N-body simulation}}s, so if one were flying a rocket from Earth to the moon, in the game the rocket would only be affected by Earth's gravity until it reaches a certain point where it will only be affected by the moon's gravity, unlike in real life where the rocket would feel the effects of both celestial bodies at all times. Therefore, orbits modeled using KSP would poorly reflect the actual orbital behavior of a probe traveling through the solar system on a multi-year mission involving multiple fly-by maneuvers.

Another reason why using KSP would not inspire confidence is that many players playing the game use a 'trial-and-error' method, field testing designs and inevitably either crashing them or running out of fuel stranding the craft in deep space. Inside a game this is not a major issue as one can simply reload an earlier save with no repurcussions, but in real life this would result in expensive costs constructing new spacecraft and even loss of human life, which NASA would likely frown on.

The humor in referencing KSP in the comic lies in using a simple game program to simulate complex space missions which in reality take a great number of experts to plan and implement. Fly-by maneuvers, used to minimize the fuel needed to reach a destination, need to be very carefully timed - often to within seconds - so the use of ''Kerbal Space Program'' to simulate them isn't a good enough argument for NASA to agree to implement the proposal, and implies simplistic thinking on the part of the proposer; therefore one should not say it at NASA.

The title text refers to ''{{w|Orbiter (simulator)|Orbiter}}'', which is another spaceflight simulator program. The title text suggests that the argument doesn't work for NASA, not because it's not scientifically sound, but because NASA relies on the ''Orbiter'' simulator rather than the ''Kerbal'' simulator (although the proposed maneuver would appear to work in both).

==Transcript==
:[Caption above the frame:]
:The six words you ''never'' say at NASA:

:[A diagram shows a possible trajectory path for a space probe starting at Earth and involving two slingshots around two other planets, and finally the Sun. There is a title above and a label beneath the diagram. The diagram is being presented by Cueball in front of three other Cueball-like guys. Behind Cueball Ponytail appears to be taken by surprise by his six words, and holds her hand to her mouth.]
:Title: Proposal:
:Label: Oberth Kuiper Maneuver

:Cueball: And besides—
:Cueball: It works in Kerbal Space Program.

==Trivia==
*In 2018, {{w|NASA}} launched a mission to the sun with a closest distance of only 8.5 solar radii. The {{w|Parker Solar Probe}} is using seven Venus flybys to reach its [http://parkersolarprobe.jhuapl.edu/index.php first close approach]. The maneuvers will last nearly seven years, before the real mission starts.

*Humorously, in real life [http://news.cnet.com/8301-1023_3-57495117-93/mars-curiosity-rover-team-prefers-macs-to-pcs/ a group of NASA team members "love" to play ''Kerbal''].

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Ponytail]]
[[Category:Multiple Cueballs]]
[[Category:Astronomy]]
[[Category:Space probes]]
[[Category:Space]]
[[Category:Kerbal Space Program]]

2065: Who Sends the First Text?

2022-05-11T18:29:01Z

172.70.85.211: Undo revision 266008 by 👖🔥 (talk)

{{comic
| number = 2065
| date = October 29, 2018
| title = Who Sends the First Text?
| image = who_sends_the_first_text.png
| titletext = I sort of wish my texting app showed the percentage next to each person, but also sort of don't want to know.
}}

==Explanation==
{{w|Text messaging}} is a back-and-forth communication via SMS between two users. In this comic, Randall shows a line graph of "who sends the first text more often?" This is meant to show who Randall initiates conversations with, and who initiates conversations with him.

Maintaining a friendship or relationship (whether intimate, friendship, casual, or business) typically requires communication; often that communication takes place when two individuals are not in the same location by means of an exchange of text messages. A normal balanced relationship typically involves both parties involved to have an approximately equal interest in making conversations happen, as measured in this case by "who sends the first text". The person who desires that a particular communication take place typically will send a text message, and once the other person responds the conversation happens, and the relationship progresses. If neither person initiates, the relationship will likely suffer.

While this graph shows the majority of his relationships involve friends whereby both sides are prone to initiating conversations, the graph also shows some groups that are a little more at the extremes, some where Randall texts a lot but they typically don't initiate text conversations to him, and some where others text him a lot but he rarely initiates text conversations with them.

On the left side of the graph are people with whom Randall initiates conversations with "100% of the time". On the right side of the graph are those who initiate conversations with Randall.

The chart is separated into 5 blocks. The two blocks on the left are those who may be, or definitely are, "just politely putting up with [Randall]". This is implied that they may not be close friends with Randall, but Randall still wants to be friends with them. Their reluctance to initiate conversation with Randall is shown by the fact that Randall usually sends the first text to them.

The largest block, in the middle, is "friends". These friends range from Randall initiating a lot, to them initiating a lot. There is a healthy range of who initiates first.

The next block to the right is for "that really nice friend who keeps inviting me to things even though I flake constantly". This means that Randall promises to go to events that this friend invites him to, but does not always follow through. This friend is still persistent in inviting Randall. Additionally, Randall could be less close to this person, based on him not categorizing this person under "friends".

The final block is "automated alerts and political campaigns". Randall would certainly not be likely to initiate "conversation" with automated systems, and would be very unlikely to initiate conversations with political campaigns. The fact that the bar is not purely 100% suggests that he has on rare occasion sent the first text to such recipients, perhaps for a campaign he believes in, or to request to be added to an automated alert system (i.e. opt-in). The fact that it includes political campaigns is a reference to the incessant texts being sent to Americans about the upcoming midterms.

In the title text, Randall wishes that he would know the percentage of "who sends the first text more often", for each person that he texts. But he is also wary of the potential implications of finding out this information.
(Many old school messenger like pidgin offer such statistics through plugins though)

==Transcript==
:'''Who sends the first text more often?'''
:[A line graph with a segmented bar underneath shows a 50/50 marker in the middle while the left end is labeled "I text first 100% of the time" whereas the right end is labeled "They text first 100% of the time".]

:[The bar below is divided into five sections:]

:[A small part at the left, and a next, slightly larger part. The text below points to the second part:]
:People who I think of as friends but secretly worry that they're just politely putting up with me

:[Below this a text is shown for the first part:]
:...'''''definitely''''' just politely putting up with me

:[In the middle is a big part:]
:Friends

:[To the right the parts are symmetric, the first is larger:]
:That really nice friend who keeps inviting me to things even though I flake constantly

:[The last small bar at the right:]
:Automated alerts and political campaigns

{{comic discussion}}

[[Category:Charts]]

2066: Ballot Selfies

2022-05-11T18:28:37Z

172.70.85.211: Undo revision 265632 by 👖🔥 (talk)

{{comic
| number = 2066
| date = October 31, 2018
| title = Ballot Selfies
| image = ballot_selfies.png
| titletext = There were actually some good reasons for those laws, but IMO they now do more harm than good. Which raises a question: If there's a ballot measure to strike them down, how can I resist the urge to take a picture of my "yes" vote?
}}

==Explanation==

This comic was published six days prior to the {{w|United States elections, 2018|2018 United States general elections}}, also called {{w|United States midterm election|midterm elections}}, because they happen halfway between two presidential elections, two years before and after. At the time, the [[xkcd]] header still provided a link to [https://www.vote.org/ vote.org], a website that helps US citizens with essential voting issues, like how to register or how to find their polling locations. It is the first of three consecutive comics that deal with this election.

In the United States, "{{w|ballot selfie}}s" refers to the practice of taking a picture of oneself with a completed ballot. These have been illegal in many states, due to laws passed to prevent vote selling.

Without proof of how a vote was cast, if someone bribed (or even violently coerced) a voter to vote for candidate A, the voter could just vote 'B' and the coercer would be unable to tell whether they voted as instructed. This is at the heart of the concept of "a secret ballot". But if ballot-selfies or other proof-of-vote mechanisms are permitted then the evil-doer can demand verification that the voter did what they were coerced to do - and this jeopardizes the idea of a truly free and fair election.

However, the "secret ballot" principle is not universally valued nor enforced. Some voting machines produce a paper receipt showing the choices the voter made - and many jurisdictions permit use of a postal ballot - so there are plenty of other ways to circumvent the law in those places. So the ban on ballot selfies is harder to justify unless those other lines of coercion are also ruled out.

On the other hand, the desire to take and distribute ballot selfies often comes from an excitement in participating in the voting process and the desire to share that excitement in the hopes of encouraging others to vote, and anything that helps get more people to the polls is generally considered to be a good thing. In addition, the law is incredibly difficult to enforce -- there is little way to prevent somebody from photographing their ballot and privately showing this photo to somebody else -- and the practice of enforcing it (i.e. searching for possible photographic devices all together) would make the local government incredibly unpopular. Lastly, voters storing evidence of their votes could be useful to prevent voting fraud performed by the state.

This dual threat/benefit has led some states to explicitly legalize ballot selfies, other states to specifically disallow them and even levy steep financial penalties, while the rest are [https://www.vox.com/policy-and-politics/2016/10/25/13389980/ballot-selfie-legal-illegal still debating or ignoring the issue].

As [[Ponytail]] is aware of this law, she believes she has identified a solution wherein she will make an {{w|oil painting}} of her voting rather than taking a {{w|photograph}}. A painting being more of an artistic endeavor that doesn't have to faithfully record all aspects of the image, it may well be valid both on grounds of {{w|freedom of speech}} as well as not being a verbatim record of her vote - thereby preserving the secrecy of the ballot. Of course, making a painting of her vote may lead to additional problems. If she intends to paint the portrait herself, of herself (i.e. a {{w|self-portrait}}) casting her vote, it would be very difficult and time consuming to attempt to do that, especially without a mirror, which she apparently doesn't have with her and which is generally not standard issue in voting booths.{{Citation needed}} She could also try to recruit someone else to do the painting, not knowing the level of their artistic talent, however, usually only the person casting the vote is allowed in the booth, and they are expected to close the curtain or otherwise ensure no outside person, like the painter, can view the vote casting act. It would also require her to stay in the booth longer than most voters.

While [[Hairbun]] and [[White Hat]] are simply standing in line, [[Megan]] can be seen using a mobile phone.

The comic might also be a reference to the existing {{w|Courtroom photography and broadcasting#United_States|ban of cameras in US courtrooms}}, which lead US newspapers to widely adopt cartoons as a replacement.

In many US states, changes to state law can be made through the {{w|Initiatives and referendums in the United States|initiative and referendum}} process, which can be initiated and pursued by any citizen.

The title text refers to the legality of taking a ballot selfie whilst voting against the law against ballot selfies.

==Transcript==
:[Megan, Ponytail, Cueball, White Hat, and Hairbun are standing in a line with Hairbun in front. All are facing forward to the right except Cueball, who is looking to his left at Ponytail. Megan holds a phone in her hand while Ponytail carries an easel under her left arm and a paintbrush in her right hand.]
:Ponytail: Ballot selfies are illegal in this state, so to immortalize my vote I'm doing an oil painting in the voting booth.

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring White Hat]]
[[Category:Comics featuring Hairbun]]
[[Category:Politics]]
[[Category:Elections]]

Talk:1902: State Borders

2022-05-10T15:10:57Z

172.70.85.211: Looks like a bad pre-post-edit by the last contributor. Removing this aborted fragment, the complete version remains below...

Let's be honest- it should ''all'' be Canada. [[Special:Contributions/162.158.74.123|162.158.74.123]] 12:24, 13 October 2017 (UTC)
:Or... Indigenous people's land? [[Special:Contributions/108.162.216.232|108.162.216.232]] 04:27, 15 October 2017 (UTC)

Could Arizona, New Mexico be a reference to Trump? Like, make the border straighter so it's easier to build a wall? [[User:Herobrine|Herobrine]] ([[User talk:Herobrine|talk]]) 12:35, 13 October 2017 (UTC)
:More likely the joke is that conceding territory to Mexico is about the last thing Trump would do [[User:AnotherAnonymous|AnotherAnonymous]] ([[User talk:AnotherAnonymous|talk]]) 13:04, 13 October 2017 (UTC)
::I don't think there's a Trump joke here. Randall doesn't tend to be political. [[User:Jkshapiro|Jkshapiro]] ([[User talk:Jkshapiro|talk]]) 05:49, 24 June 2018 (UTC)

My first thought is to wonder if it would be possible to arrange the map such that all internal borders are "straight lines" that span the entire country, to satisfy as many criteria as possible:
* The number of states remains unchanged
** …and they all get to keep their capitals (probably quite difficult)
*** …or (and?) each state manages to keep either its current population, land area, or coastline length
* Or all internal borders are parallels or meridians
* Or all states have the same land area
** …or population; or population density
* Or if you're allowing more (or fewer) states than the present layout, what's the greatest number of states possible such that they all contain at least one complete city?

Which of those criteria would be the most interesting challenge? And which could you construct an algorithm to solve?
I really should refrain from trying to build those algorithms, because I'm supposed to be working --[[User:Angel|Angel]] ([[User talk:Angel|talk]]) 13:28, 13 October 2017 (UTC)
:I'd like to see what a map of the US would look like with each house gerrymandered by their legislative preferences... Borders everywhere, and wow what a nightmare of litigation it would generate as people cross from one district to another!
:More to your query: I don't see any modifications you could make that would keep the population unchanged. Some people would inevitably end up in a different state.
:How about a map where every state has an equal number of spiders? [[Special:Contributions/108.162.216.232|108.162.216.232]] 04:39, 15 October 2017 (UTC)
::Population as in number of people; not necessarily the same people. --[[User:Angel|Angel]] ([[User talk:Angel|talk]]) 10:28, 15 October 2017 (UTC)
:::Oh... Hm, that doesn't sound very useful ''or'' aesthetically satisfying... I think mapping the regions where various spider populations dominate might be more interesting. [[Special:Contributions/108.162.216.232|108.162.216.232]] 10:46, 15 October 2017 (UTC)

There are some great videos on YouTube about weird State boundaries. There are some REALLY weird oddities out there. Take for instance the "Give to Canada" piece - that's the Northwest Angle in Minnesota. It's really an accident that it ever ended up in the USA at all, and doesn't make any sense! [[User:Martini|Martini]] ([[User talk:Martini|talk]]) 13:40, 13 October 2017 (UTC)Martini
:I wouldn't call the NW Angle an accident as much as a slightly illogical solution in order to maintain the terms of the original border agreement in the face of the Mississippi River's inconveniently located headwaters. My recollection is that it said roughly: the border goes west of <this> point until reaching the Mississippi river [which all parties assumed continued that far north]. [[Special:Contributions/108.162.216.40|108.162.216.40]] 14:13, 13 October 2017 (UTC)

I believe Randall's overall point is that though a large part of the individual United States have straight boundaries, especially in the West, or other features that are aesthetically pleasing, as in the S Carolina/Georgia/Florida coastline, there are a good number of internal inconsistencies. Many of these (most of the untagged "fixes") can be attributed to the concept that "Rivers make good logical boundaries", but even then, if you look closer, there are some really puzzling bits:
* The "Give To Canada" bit of Minnesota is almost all Indian Reservation land, so that kind of makes sense...
* The "Fix this thing" in Missouri is even stranger than it initially looks - while the notch in Arkansas is caused by the Mississippi River, there is a large bight of land in the middle of the Missouri-owned bit that is actually Kentucky (yes, there's an island of Kentucky that is separate from the main Kentucky state and entirely surrounded by Missouri)
* Not edited, but equally odd is the dip Florida cuts into Georgia near the east coast - there's no apparent town or natural features there to cause that irregularity

I don't happen to think the Arizona/New Mexico bits are political commentary, just "the entire rest of the state is a box, make this a straight line, too." cleanup. I mean yes, it would make wall-building easier, theoretically, but the Chinese showed the world centuries ago that straight lines are not needed to build a big fricking wall. [[Special:Contributions/108.162.238.131|108.162.238.131]] 14:23, 13 October 2017 (UTC)

- While I agree it probably isn't conscious political commentary, its interesting that there are not places the border increases; always concessions, never gains. May take into account its easier to give than take territory? --[[User:Jgt|Jgt]] ([[User talk:Jgt|talk]]) 19:32, 13 October 2017 (UTC)--[[User:Jgt|Jgt]] ([[User talk:Jgt|talk]]) 19:33, 13 October 2017 (UTC)

I'm surprised Randall didn't suggest cleaning up Point Roberts as well [https://en.wikipedia.org/wiki/Point_Roberts,_Washington]. [[Special:Contributions/141.101.107.174|141.101.107.174]] 14:33, 13 October 2017 (UTC)
: Presumably the graphic designers are okay with that, since it maintains the 49th Parallel as a nice, tidy border. [[User:Wwoods|Wwoods]] ([[User talk:Wwoods|talk]]) 20:18, 13 October 2017 (UTC)

I'm shocked he didn't support fixing the Idaho/Wisconsin/Montana/Oregon border. That top part should be either given to Montana, or split between Washington and Oregon... I wonder if he left out certain things in order to avoid offending certain groups of people. Like suggesting that Rhode Island and Connecticut should probably be one state, or that Vermont and New Hampshire should be as well. [[User:Kashim|Kashim]] ([[User talk:Kashim|talk]]) 17:03, 13 October 2017 (UTC)

Some of the suggestions are ironic, for example Michigan's upper peninsula actually used to be part of the Wisconsin territory, but it was ceded to Michigan in exchange for the port of Toledo being ceded to Ohio. "why does Florida get Alabama's coastline" is actually because Alabama got part of Florida's coastline so it wouldn't be landlocked. The bit of Nevada that he wants to fix it so Nevada has territory along the Colorado River [[Special:Contributions/162.158.75.250|162.158.75.250]] 17:18, 13 October 2017 (UTC)

Nobody seems to have noticed that Delaware's curved northern border has been flattened (removing Wilmington). [[Special:Contributions/108.162.238.83|108.162.238.83]] 21:31, 13 October 2017 (UTC)

One significant thing about this map is that, under this map, Hillary Clinton may have won the 2016 election. Citations needed, but I've seen it said that if the Upper Peninsula were moved from Michigan to Wisconsin and the Florida Panhandle were moved to Alabama, Clinton would have won Michigan and Florida, giving her an Electoral College majority. I don't think the Upper Peninsula has enough population to cost Michigan an electoral vote, and I think Florida would lose two electoral votes, putting Clinton exactly at the 270 needed to win. Perhaps the changes around Colorado and Nevada would make a difference, although there were also five faithless Clinton electors who might have voted for her if it would have made a difference. [[Special:Contributions/108.162.219.4|108.162.219.4]] 01:45, 14 October 2017 (UTC)

* There's a tool out there that allows you to at least approximate these changes (you can move counties from one state to another. It's not perfectly straight lines.) http://kevinhayeswilson.com/redraw/ The changes that are potentially electorally-significant with respect to 2016 were: The Upper Peninsula to Wisconsin, the Florida panhandle largely to Alabama, the expansion of DE, expansion of RI, cleanup of WV/MD, and shifting of Long Island*. (Almost all the other changes occur in very unpopulated areas and involve states that were not particularly close in the last election.) I get a 277-261 Clinton victory on this map. As you note, the Upper Peninsula and Florida Panhandle shifts do change the outcomes in the remaining portions of MI and FL respectively. The change to WV and MD does not appear to change either state's results (I assigned Wheeling to Ohio, which only makes Ohio slightly redder). Expanding Delaware does not quite flip it red - the Maryland Eastern Shore and Virginia bay shore are not sufficient to change DE, although it became an extremely close race - Clinton won by 2,000 votes out of 1.4 million in the expanded state of Delmarva, so if Wilmington becomes part of PA, it probably moves DE and its now 4 electoral votes to Trump (273-265 in that scenario). The NYC area however is the catch here - depending on how it's sliced, it could cause Upstate New York to flip red and therefore flip the overall map back to a Trump victory. (New York north of the northern border of Westchester County is a Red State!). It doesn't appear to matter whether NYC itself ends up in CT, NJ, or divided between the two - adding a blue city to a blue state doesn't change the outcome much, aside from potentially varying the electoral vote sizes. The tool doesn't allow you to add a new state, but the State of Long Island's 2 extra EVs from a Senate seats would not change the overall outcome of the election either - if Westchester is part of Long Island State, Trump wins - if it remains in New York State, Hillary wins. As Westchester County Goes, so goes the White House --[[Special:Contributions/172.68.132.59|172.68.132.59]] 05:25, 18 October 2017 (UTC)

Good curve! The curve is called the Georgia Bight, or less euphoniously, the South Atlantic Bight. [[Special:Contributions/162.158.63.76|162.158.63.76]] 03:34, 14 October 2017 (UTC)

"'''Align to Grid'''" refers to the option to have icons snap to a grid on a Windows desktop. The idea is that the states become "aligned" like icons on a desktop. [[User:FakeCrash|FakeCrash]] ([[User talk:FakeCrash|talk]]) 17:59, 14 October 2017 (UTC)
:More likely, since this has been drawn up by graphic designers, it refers to functionality in most design/drawing tools that allows you to drag elements into the drawing and have them snap to a notional grid, so that they align nicely with previously added elements.[[Special:Contributions/162.158.155.32|162.158.155.32]] 11:11, 18 October 2017 (UTC)

It would be really useful if this could link to somewhere that described why the various panhandles and oddities exist. [[Special:Contributions/162.158.154.247|162.158.154.247]] 21:04, 14 October 2017 (UTC)

:https://en.wikipedia.org/wiki/How_the_States_Got_Their_Shapes [[User:Silverpie|Silverpie]] ([[User talk:Silverpie|talk]]) 21:26, 15 October 2017 (UTC)

They should be called geo-graphic designers [[User:Jaalenja|Jaalenja]] ([[User talk:Jaalenja|talk]]) 06:53, 15 October 2017 (UTC)

Randall had no references to Trump here. Get over it.
I mean really. Why does everybody think everything about the country has to do with Trump winning? [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 14:24, 15 October 2017 (UTC)

For the sentence: "Many U.S. residents will be made to live in new states, and thus be required to pay different taxes and obey different state laws, and even root for different sports teams." It should be expanded to explain that people are indeed required to root for sports teams in the state they live in⸮ --[[Special:Contributions/172.68.133.234|172.68.133.234]] 21:11, 15 October 2017 (UTC)

The map looks great, but you didn't include all 50 states.[[Special:Contributions/162.158.58.123|162.158.58.123]] 05:36, 16 October 2017 (UTC)

[https://img
ur.com/a/Tnjts I tried my hand at creating this map] [[Special:Contributions/162.158.255.112|162.158.255.112]] 01:23, 16 October 2017 (UTC)

In the "explanation" column of the grid the entry for Rhode Island says "Expanding Rhode Island eastward would reduce the number of land borders it has to two [...]" This confused me a great deal, and I triple-checked to confirm that Rhode Island currently has two land borders, so how would making it bigger reduce the number (which is currently two) to two? [[Special:Contributions/108.162.237.190|108.162.237.190]] 04:15, 16 October 2017 (UTC)

• Original writer - my bad for poor writing. I had the fact that Rhode Island's current border with Massachusetts has two clear lines on the mind: an east-west border to RI's north and a north-southish border to RI's east, with the latter being erased under the DT's proposals.

A description of the change to the eastern Massachusetts/New Hampshire border is missing.

The border between the Province of Québec and the States of New York and Vermont should also be straightened and aligned on the 45th parallel and, while we're at it, extended all the way to the Atlantic Ocean. The Northeastern border would then be a nice straight line, like the Northwestern border. New Hampshire would lose its extreme Northern tip (not a big deal), and Maine all of its Northern territory (which is mostly uninhabited anyway).

• He missed an opportunity regarding the {{w|Erie_Triangle}}.

T for Texas, T for Tennessee: There is an actual [Horrors] OMISSION, given that he is correcting a surveying error in Tennessee, he should also correct the surveying error that put the New Mexico-Texas state line about 1 xkcd line-width too far west (as scaled on the map), unnecessarily expanding Texas.

With regards to the Alaskan panhandle section - to the best of my knowledge (and based on a quick online search) the capital of Alaska has always been in Juneau. It certainly has never been in Anchorage. There were several referendums over the past four decades to move the capital to Anchorage or near Anchorage; however, most were defeated. Also, the two (I think it was two?) that passed, were effectively defunded in the legislature.
Also, most of us Anchoragites (damn, we need a better name for ourselves) would be more than happy to give Juneau to Canada... some of us would pay them to take it.

In the vein of "Give X to Canada," [https://en.wikipedia.org/wiki/Point_Roberts,_Washington Port Roberts] needs addressing. Nobody else really cares enough to make it happen. [[Special:Contributions/108.162.246.239|108.162.246.239]] 05:43, 20 October 2017 (UTC)

As a Wyomingite, I strongly object to the 'Align to Grid' changes. Not because I mind Jackson being lost, but because Idaho and Montana have been laying claim to Yellowstone for years. We can't let them actually have it![[Special:Contributions/172.68.34.70|172.68.34.70]] 05:22, 25 October 2017 (UTC)
:The Wyoming align to grid changes move Evanston over to Utah, and Jackson Hole over to Idaho. Given that Wyoming is already the least populous state by a pretty decent margin, I think it would make sense to just split the remaining land between Colorado and Montana, continuing the arbitrary squiggle that was previously extended to remove Yellowstone. Colorado would become a much taller and slimmer state. While we're at it we could merge the Dakota's into one state as well. [[User:Stickfigurefan|Stickfigurefan]] ([[User talk:Stickfigurefan|talk]]) 16:56, 4 June 2019 (UTC)

I think the border between Idaho and Montana is already, for the most part, an arbitrary squiggle.[[User:Jkshapiro|Jkshapiro]] ([[User talk:Jkshapiro|talk]]) 06:26, 24 June 2018 (UTC)

In "Align to Grid", those aren't "arbitrary squiggles", those are cross-out lines—he's just trying to move the existing straight lines. [[Special:Contributions/108.162.238.125|108.162.238.125]] 13:53, 30 January 2020 (UTC)

If the curve changes, we could reclaim land to fix it. Easy as pie. [[Special:Contributions/162.158.179.166|162.158.179.166]] 14:13, 10 May 2022 (UTC)

2617: Maps

2022-05-10T02:02:33Z

172.70.85.211:

{{comic
| number = 2617
| date = May 9, 2022
| title = Maps
| image = maps.png
| titletext = OpenStreetMap was always pretty good but is also now *really* good? And Apple Maps's new zoomed-in design in certain cities like NYC and London is just gorgeous. It's cool how there are all these good maps now!
}}

==Explanation==
{{incomplete|Created by a BOT - Please change this comment when editing this page. Do NOT delete this tag too soon.}}

Actually first for once. [[Special:Contributions/172.70.85.211|172.70.85.211]] 02:02, 10 May 2022 (UTC)

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

{{comic discussion}}

Talk:2604: Frankenstein Captcha

2022-05-06T06:03:57Z

172.70.85.211:

Don't forget it's canon the Frankenstein is the name of the Monster https://www.explainxkcd.com/wiki/index.php/1589:_Frankenstein

The other squares contain things that might also be ambiguously named:

There is tortoise/turtle ship/boat/yacht monster Napolean/Nelson

puddle/pond/lake girl/woman magma/lava squash/pumpkin/gourd/..

Frankenstein (sandwich?) (stop sign?) monster

Rocket/spaceship(Or planet/dwarf planet?) (couple?) (traffic light?) monster.

I can't think of any other term for the sandwich, the couple, or the traffic signals. Are these a call back to the self driving car captcha https://xkcd.com/1897/

[[Special:Contributions/162.158.159.125|162.158.159.125]] 16:28, 8 April 2022 (UTC)

:That's neither Nelson nor Napoleon but rather Link from the Legend of Zelda series. He has the shield with a Triforce symbol on it, the hat that's pointed in the back, and a sword that's surprisingly recognizable as the Master Sword despite xkcd's low detail art style.
[[Special:Contributions/108.162.245.43|108.162.245.43]] 16:43, 8 April 2022 (UTC)

I suspect some of the other squares are common “well-actually” topics, eg. a pumpkin/squash is actually a fruit. The “puddle” is a mirage. Row 2 column 2 has a 9 drawn in their hair… a Franken-nine? — Alex

--[[Special:Contributions/162.158.2.23|162.158.2.23]] 16:38, 8 April 2022 (UTC)

The astronomical body might be a meteoroid? [[Special:Contributions/172.70.114.77|172.70.114.77]] 16:56, 8 April 2022 (UTC)
:Oh wait, missed the heart crater. nvm that's gotta be Pluto [[Special:Contributions/172.70.230.75|172.70.230.75]] 16:57, 8 April 2022 (UTC)

The sandwich is probably due to pedantry over 'is [x] a sandwich' debates. [[Special:Contributions/172.70.250.67|172.70.250.67]] 17:04, 8 April 2022 (UTC)
:In that case, it should have been a hot dog. ;D
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 17:09, 8 April 2022 (UTC)
:Seems likely. Also reminds me of https://xkcd.com/2301/ [[Special:Contributions/172.70.134.237|172.70.134.237]] 17:18, 8 April 2022 (UTC)

Could the lake/pond tile actually be a fata morgana - given the desert setting implied by the sun and the pyramids? [[User:Captain Nemo|Captain Nemo]] ([[User talk:Captain Nemo|talk]]) 17:13, 8 April 2022 (UTC)
:What lake/pond? There is no water there, man. I think you're just seeing an illusion, created by heat ripples in the air. (I'm kidding; just trying to keep up the "mirage".)
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 17:24, 8 April 2022 (UTC)

The current explanation does not mention the Title Text, nor does it explain the paraphrased quote. I believe the original quote mentions "a line in the sand"? 
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 17:11, 8 April 2022 (UTC)

:There's also the classic turn of phrase "There's a thin line between ConceptA and ConceptB" which is what I thought of when I read that. [[User:MAP|MAP]] ([[User talk:MAP|talk]]) 19:19, 8 April 2022 (UTC)

#a tomato is the gold standard for uncertainty in pronunciation
#the sandwich's definition is both precise and vague: nerd fight! Hotdog? Burrito? Pizza? Doughnut?
#in the 1931 the little girl does not run away but is, er, cared for by the monster. the flower is not pictured. --[[User:Misterstick|Misterstick]] ([[User talk:Misterstick|talk]]) 17:26, 8 April 2022 (UTC)

What if the planet ''contains'' Frankenstein (either the monster or the doctor) and you just can't tell at this resolution??! 19:51, 8 April 2022 (UTC)
:The planet also might be ''named'' Frankenstein. Or an asteroid. There isn't one yet, but maybe in the future?
:[https://space.fandom.com/wiki/List_of_named_asteroids_(F-K)#Fr Closest match for name] is "10246 Frankenwald"

A bit disappointed Randall didn't take the opportunity to include the 1972 Edgar Winter Group album "They Only Come Out at Night", which contains the track "Frankenstein." [[Special:Contributions/172.70.131.176|172.70.131.176]] 18:51, 8 April 2022 (UTC)

The turtle may be a reference to "turtle rifle", a series of GAN exercises resulting in producing objects that neural networks recognize as something completely else. A famous one was a turtle-shaped toy, which looked quite like a normal turtle to a human eye, but a characteristic pattern on its shell made neural networks to classify it as a rifle.

Based on the standard levels of pedantry, I am surprised that no-one yet has pointed out that we are not supposed to click on ONLY the correct images. Taking the union of both Frankenstein sets should then be accepted (unless we faced union-bashers in the Frankenstein-basher crowd).
:The instructions use standard CAPTCHA language, "only" is understood (otherwise a bot could just click all boxes and the test would be defeated). [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 22:26, 8 April 2022 (UTC)

But I saw no picture of a [https://reddwarf.fandom.com/wiki/Frankenstein cat]... [[Special:Contributions/172.70.86.44|172.70.86.44]] 22:25, 8 April 2022 (UTC)

Also, in my experience, CAPTCHAs that ask for "Click all squares with <whatever>" on a non-refreshing grid of otherwise independent images - which I often-enough encounter in this very site - tend to assume exactly three squares are correct. (e.g. it asks for "all tractors", and there are two tractors and some non-tractor vehicle like a road-roller, then it doesn't matter if *I* think that's not actually a tractor, it won't let me past until I've clicked the road-roller). The rules are different for refreshing images (click an image's square, it presents a new image, until eventually every square that had previously been one-or-more picture(s) of the target-type are now all irrelevent to click) or a gridded single-scene (I haven't worked that one out fully... if it's asking for Traffic Lights, do I just need to do the squares ''entirely'' containing such light units/only those with the 'light' part of the units/every single square with even the barest edge of the frame around the lights/all squares even with just the poles/wires suspending the lights up off the ground... sometimes it seems to like what I do, sometimes it retests me, and I don't know if it's unhappy with my choice or so absolutely happy with my choice that it desperately wants me to help the Algorithm just that little bit more). '''*cough*''' Anyway. What I'm saying is, if I was seriously trying to answer this comic's example, I'd be looking for exactly three Frankenstein squares of one (dubious) kind or another. [[Special:Contributions/172.70.86.44|172.70.86.44]] 22:25, 8 April 2022 (UTC)
:I've seen plenty of this type of CAPTCHA with fewer than 3 correct tiles. Unless I'm not human enough to recognize all the matches.... [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 22:29, 8 April 2022 (UTC)
:I think you both just proved you are robots. Humans are too dumb to do this level of analysis. [[Special:Contributions/108.162.241.9|108.162.241.9]] 03:04, 9 April 2022 (UTC)
:My (limited) experience with CAPTCHA is it doesn't matter what tiles you click, as long as you don't take too long to finish.(which can happen if you spend a lot of time squinting at the images or pondering semantical variations)[[Special:Contributions/172.70.178.33|172.70.178.33]] 23:29, 2 May 2022 (UTC)
"Knowledge is Knowing Frankenstein isn’t the Monster, Wisdom is Knowing Frankenstein is the Monster" - https://commons.emich.edu/ac/vol3/iss1/4/ [[Special:Contributions/108.162.241.9|108.162.241.9]] 02:56, 9 April 2022 (UTC)

*I have to mention the "lost ending" of ''Frankenstein'' which is found at https://imgur.com/gallery/bCGEw . --[[Special:Contributions/172.70.130.125|172.70.130.125]] 03:36, 9 April 2022 (UTC)

May be worth noting that the traffic light's three coloured circles are all shaded black. In some countries (I know I've seen someone I trust saying it's true in the USA and UK), the law specifies that you must treat a broken traffic light (or one which you reasonably believe to be broken; such as if it's not lit up) as a stop sign. Does this mean you'd click it in a CAPTCHA that asks for stop signs? [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 09:04, 9 April 2022 (UTC)

I was today years old when I learned that "ship" and "boat" aren't literally interchangeable like "eggplant" and "aubergine". [[Special:Contributions/172.70.131.216|172.70.131.216]] 09:22, 9 April 2022 (UTC)
:The way I understood it is that a ship carries boats – think of a cruise liner or cargo ship with lifeboats, or a naval vessel with longboats or the captain's gig – but a boat, like a rowboat, speedboat, or personal watercraft, does not. [[User:RAGBRAIvet|RAGBRAIvet]] ([[User talk:RAGBRAIvet|talk]]) 16:26, 9 April 2022 (UTC)
::I learned it as being that a ship needs somewhere proper to land (like a pier or a proper dock), while a boat you can bring close enough to the shore and jump off; or run it up the beach. Guess people have different definitions. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 17:57, 9 April 2022 (UTC)
:Ask yourself this: If the person in charge of that vessel told me to call him Captain, would I think he was a pretentious ass? If no, it's a ship.[[Special:Contributions/108.162.238.150|108.162.238.150]] 18:14, 10 April 2022 (UTC)

I wonder if any of those vegetables would count as "Frankenstein foods". --[[Special:Contributions/172.70.85.211|172.70.85.211]] 13:38, 9 April 2022 (UTC)
:That was my initial assumption when I saw it (on my phone) and couldn't tell what they were [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 17:57, 9 April 2022 (UTC)

Some other possible things that could be on such a Captcha: Big Ben (a bell inside Elizabeth Tower), Metroid (an alien creature that the bounty hunter Samus repeatedly encountered), and the Pink Panther (a stolen diamond pursued by Inspector Clouseau).[[Special:Contributions/172.70.135.32|172.70.135.32]] 20:38, 9 April 2022 (UTC)

Hang on...a tiled-image CAPTCHA has no 'correct' answer? How am I just hearing this now? [[User:Yorkshire Pudding|Yorkshire Pudding]] ([[User talk:Yorkshire Pudding|talk]]) 21:37, 9 April 2022 (UTC)

I see an octagon containing STOP, but no square containing FRANKENSTEIN. I think that makes this particular captcha unsolvable. [[User:These Are Not The Comments You Are Looking For|These Are Not The Comments You Are Looking For]] ([[User talk:These Are Not The Comments You Are Looking For|talk]]) 01:01, 10 April 2022 (UTC)

I have to suggest an alternate interpretation: CAPTCHAs are used as a way to provide sample data for machine learning AI. A situation like in the comic implies that there is a reason that an AI would need to be trained to recognise Frankenstein (presumably the monster), perhaps because he's real and on the loose, hence the dread. [[Special:Contributions/172.69.34.84|172.69.34.84]] 06:47, 10 April 2022 (UTC)
:I am amused by this possibility. It also plays on the term CAPTCHA by suggesting that the monster is on the loose and needs to be CAPTURED.[[Special:Contributions/172.70.178.33|172.70.178.33]] 23:29, 2 May 2022 (UTC)
Really dark take: the people are all part of Frankenstein, it's just that their pictures were taken before their deaths. --[[User:Vdizz|Vdizz]] ([[User talk:Vdizz|talk]]) 05:08, 11 April 2022 (UTC)

== GPT-3's opinion ==

I just asked OpenAI's latest GPT-3 model at https://beta.openai.com/playground with default settings thusly:

:;What does Frankenstein look like?

:Frankenstein is a large, muscular creature with green skin and long, black hair. He has large, white eyes and a flat, square head. His mouth is large and filled with sharp teeth. He has long, powerful arms and legs.

:;What does Victor Frankenstein look like?

:Victor Frankenstein is a tall, thin man with dark hair and eyes. He is very intelligent and has a strong interest in science.

So the point of this is that if you spend millions of dollars to train an English language interaction model based on the authoritative texts available to contemporary venture capitalists, "Frankenstein" is considered to be the monster, not its creator.

Note you can't really do this kind of instant inquiry with Google Trends or Google Books Ngrams. [[Special:Contributions/172.69.33.145|172.69.33.145]] 03:59, 11 April 2022 (UTC)

Don't forget that in certain regions (well, maybe just South Africa) a stoplight is called a robot. [[Special:Contributions/172.69.68.202|172.69.68.202]] 15:23, 11 April 2022 (UTC)

[[1263: Reassuring]]. [[Special:Contributions/172.68.132.206|172.68.132.206]] 04:39, 12 April 2022 (UTC)

I am so amazingly disappointed that one of the captcha images is not a treacherous depiction of a pipe. {{unsigned}}
:"Ceci n'est pas un canal de communication FIFO simplex"? [[Special:Contributions/172.70.91.36|172.70.91.36]] 20:02, 12 April 2022 (UTC)

isn't it referencing things that have been named after or called Frankenstein (a turtle, an heirloom tomato variety, a sandwich, a hairstyle, etc.)?
[[Special:Contributions/108.162.237.9|108.162.237.9]] 21:54, 15 April 2022 (UTC)

Hmm... "(That's not a thing even though the surrounding text written by same author is accurate. I don't doubt the person who wrote it thinks this about normal captchas, but even sophisticated users do not, and likely won't fail a single captcha by not doing this.)", to explain one particular [https://www.explainxkcd.com/wiki/index.php?title=2604:_Frankenstein_Captcha&curid=25132&diff=264841&oldid=264431 (de-)edit]. I didn't write that bit, but I ''did'' write the "Also, in my experience, CAPTCHAs that ask for..." further up this Talk page, and as such I found it a reasonable interpretation of my experience. Not going to reinstate it, but just want to register my resemblence to the remark. Carry on, though... As you were... [[Special:Contributions/172.70.85.211|172.70.85.211]] 06:03, 6 May 2022 (UTC)

Category talk:Pages using the "citation needed" template

2022-05-04T10:30:27Z

172.70.85.211: As the responder (172.70.162.155) in the conversation, now that someone else has nicely moved our conversation I think I can take the liberty of removing *both* our (sotto-voce) regrets for our original non-optimal comment locations. ;).

Wouldn't it be a better idea for a category of comics (notice comics, not pages) not using the "citation needed template"... oh and a category of non-comic pages using the template? idk. [[Special:Contributions/172.70.175.178|172.70.175.178]] 20:11, 3 May 2022 (UTC)Bumpf
:Might be a bad idea to have the set of all non-CNed pages (comic or otherwise), because it should not be a cue to visit them all and disqualify them by revoking the state of absence.
:And I'm not sure how the backend of a Wiki server can be persuaded to properly present "all pages that match this but ''don't'' match this other thing", in a rigorous manner. Also one that doesn't fall foul of Russell's Paradox, potentially, unless self-membership is rigorously pre-filtered out as even a potential option.
:As to "non-comics that use it", if you go to the very last page of the list, below, you should see the end of the number-starting articles and the few (not insignificant) remaining pages that have got {{template|Citation needed}} in them, despite not being proper comic-pages.
:Oh, except for the very first thing you should see below. The oddity that a Category page that uses the template must apparently be considered a subcategory (though technically a direct member, not one by category membership, unless I've missed something) interests me. I must actually inspect a Wiki source-code at some point, to see if the devs commented or even coded the handler with awareness of this possibility. (That and Russell!) [[Special:Contributions/172.70.162.155|172.70.162.155]] 21:36, 3 May 2022 (UTC)

2614: 2

2022-05-04T10:22:23Z

172.70.85.211: /* Transcript */ A possible mispaste/keyboard fumble that crept in during Revision as of 03:03, 4 May 2022. Seems to have no actual purpose, so removing.

<noinclude>:''This page refers to the comic named "2". For comic #2, see [[2: Petit Trees (sketch)]].''</noinclude>
{{notice|'''WARNING:''' A large percentage of ExplainXKCD's pages were recently vandalized by one user's bot script, which has been stopped. ([[explain_xkcd:Community_portal/Admin_requests#Vandalism|Discussion]] and [[explain_xkcd:Crap|information]].) Because of this, the number of comics above may be slightly inaccurate at the moment.}}
{{comic
| number = 2614
| date = May 2, 2022
| title = 2
| image = 2.png
| titletext = It's like sigma summation notation, except instead of summing the argument over all values of i, you 2 the argument over all values of 2.
}}

==Explanation==
{{incomplete|Created by A VERY JEALOUS NUMBER ₃½ⁿ₇₇₇ⅥⅣ₆⁸⁴⁴½⅔⅜ↆ↉↉∂, WHO DEMANDS TO HAVE THEIR OWN WEBCOMIC NEXT - Please change this comment when editing this page. The titletext needs to be worked in there, but I think I got everything else in some sort of order, pending general improvements. Do NOT delete this tag too soon.}}

This demonstrates the different ways in which the number 2 can be typeset in various scientific fields. Whilst these typefaces are used with any number, using the number 2 in this instance provides a clear illustration of where adding numbers can signify either a feature of a concept (such as the number of electrons in an atom) or a mathematical operation on it (such as raising a value to it's second power).

The dotted box represents any character (a number, letter or bigram of letters, as appropriate to the various signifiers). All the other notation consists only of the digit 2, with occasional additional punctuation, in various locations in relation to this character. Each of these is labelled as to what its 'purpose' might normally be with respect to the general term, in the following fashions:
;Regular Math
:Precedes the term. "2x" indicates two times the value of ''x'' in normal {{w|algebra|algebraic}} use that should be familiar for many people.
;Physics
:A preceding superscript. "2H" would indicate the particular {{w|isotope}} of Hydrogen with the atomic weight of two, i.e. deuterium, which is most often encountered when working with the atomic level of matter where the total number of neutrons and protons in the atom is important. It can also represent tetration, which is iterated exponentiation.
;Chemical Physics
:A preceding subscript, "2He" indicates the atomic number of an atom, which is the number of protons it contains, and thus a guide to the number of electrons its unionised form usually has and hence meaningful in its potential chemical interactions with other atoms. This should be invariant for any particular named element, but is usually given simultaneously with the presuperscripted mass number where it can be indicative of the applicable nuclear physics. {{w|Chemical Physics}} is a subdiscipline of physics and chemistry and **must never** be confused with {{w|Physical Chemistry}}. It can also represent pentation, which is iterated tetration.
;Regular Math or Footnotes
:A trailing superscript is typical of a {{w|Exponentiation|power value}}, in this case "x²" would be ''x'' multiplied by a second copy of itself, and a fairly typical mathematical standard.
:Additionally, superscripted numbers are one common way to mark words in a line of text in a way to refer to a {{w|Note (typography)|footnote}}, typically placed at the bottom of the page, with additional information that would not be appropriate or easily comprehendable to edit into the main text itself. The ambiguity between footnotes and exponents was used in [[1184: Circumference Formula]]
;Chemistry
:A trailing subscript is used in chemistry to indicate a multiple of the element (or group of elements, in brackets) in a {{w|chemical formula}}. "H2O" indicates two hydrogen atoms bond with a single oxygen atom in a molecule of water.
;Matrices! ("2,2")
:Extending the trailing subscript with a comma-separated value usually indicates a multidimensional array (e.g. establishing a 2-by-2 square of numbers, or this particular position in such an array), which is in the realms of {{w|Matrix (mathematics)|matrix mathematics}}. This is a little bit beyond 'everyday algebra' for many people, as seemingly indicated by the exclamation of the mere mention of matrices!
;The Physicists Are At It Again ("2;2")
:This label encompasses a mark that turns the prior comma into a semicolon, as part of the trailing subscript. This is a common notation for the {{w|Covariant derivative}} of a tensor field, which is commonly used in the mathematics of general relativity.
;Either High School Math Function or Incomprehensible Group Theory
:The number 2 in parentheses that follow a term would normally be the argument to a {{w|Function (mathematics)|function}}. For example, "f(2)" means that you should take the value 2, and find the result if manipulated by the predefined function ''f''. It is generally taught as part of algebraic mathematics at {{w|Secondary school|High School}}.
:In {{w|group theory}}, however, the number 2 in parentheses could indicate a cyclic subgroup or ideal generated by two or a special case of cycle notation for elements of symmetry groups used to mean an element that keeps 2 fixed. This may be somewhat beyond High School level.
;Oh no. Whatever this is, it's cursed.
:A symbol centered underneath another symbol is normally reserved for doing summations, where the big symbol is Σ, or some other operation applied to a sequence of numbers. It does not make sense to have a single number there. As with [[2529: Unsolved Math Problems|other things]] where something appears to have gone wrong in Randall's comic universe, the explanation for this particular anomaly is that it is 'Cursed'.
:The usage mentioned in the alt text is an operation (Σ, summation) over a variable, usually indicated by a letter such as i, where the operation is performed over all values of the variable (i.e. you Σ the argument over all values of i). In the "2" case, the alt text says "you 2 the argument over all values of 2" (i.e. the Σ operation has been replaced by the "2" operation and the i variable has been replaced by the "2" variable). 2 is usually not an operation, though the definition of 2 under {{w|Church_encoding#Church_numerals|church encoding}} is a function that takes in and produces functions. However, 2 is not a variable (and definitely not both at the same time).
: Things being cursed is a common trope within recent XKCD comics, which have mentioned items including [[2332:_Cursed_Chair|Cursed chairs]] and [[:Category:Cursed_Connectors|cursed connectors]]. This notation is one of the few occasions where the supernatural have demonstrable implications on science and mathematics for those foolhardy enough to use it.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[An apparent generalisation of a scientific expression consisting of a dotted rectangular 'box' outline, left empty, and various commonly-themed symbology around it:]

:[as normal text, to the left of all the rest:] 2
:[superscript to the immediate left of the box:] 2
:[subscript also to the immediate left of the box:] 2
:[superscript to the immediate right of the box:] 2
:[subscript also to the immediate right of the box:] 2;2 [i.e. separated by a semicolon]
:[as normal text, to the right of almost all the rest:] (2) [i.e. enclosed in standard parentheses]
:[smaller subscript, centered immediately beneath the 2 within the parentheses:] 2

:[Further details are drawn in grey tone, around or near various of the elements of the expression:]
;[Captions above the numbers]
:[with an arrow pointing to the leftmost 2:] Regular Math
:[with an arrow pointing to the leftwards superscript 2:] Physics
:[with an arrow pointing to the rightwards superscript 2:] Regular math or footnotes
:[with an arrow pointing to the parenthetical 2 at the right:] Either high school math functions or incomprehensible group theory

;[Captions below the numbers]
:[with an arrow pointing to the leftwards subscript 2:] Chemical Physics
:[with an arrow pointing to just the rightwards subscript 2:] Chemistry
:[with an arrow pointing to a distorted grey ring snaking around only the comma of the semicolon and the following 2 of the rightmost subscript:] Matrices!
:[with an arrow pointing to a larger grey ring that passes fully around the whole semicolon and final 2 of the rightmost subscript:] The physicists are at it again
:[with an arrow pointing to the small 2 placed below the parenthetical 2:] Oh no. Whatever this is, it's cursed.

{{comic discussion}}
[[Category:Math]]
[[Category:Physics]]
[[Category:Chemistry]]
[[Category:Comics featuring Cursed Items]]

2593: Deviled Eggs

2022-05-04T00:05:48Z

172.70.85.211: Undo revision 234345 by X. K. C. D. (talk) - vandalism

{{comic
| number = 2593
| date = March 14, 2022
| title = Deviled Eggs
| image = deviled_eggs.png
| titletext = The foil on the toothpick represents the blue flash.
}}

==Explanation==
A {{w|deviled egg}} is a dish created by cutting a hard-boiled egg into halves and replacing the yolk with a paste frequently made using the yolk itself, additional ingredients such as {{w|mustard}} and {{w|mayonaise}}, and topped with a red spice (usually {{w|paprika}}). Importantly, the paste has a larger volume than the original yolk because of the added ingredients (and probably some air) into the originally homogonous yolk substances. Randall Munroe parodies the dish by creating several alternative versions of the dish for other professions using word plays on the name of the dish.

;Chef - Deviled egg
The original dish with the excess paste piled above the egg white.
;Landscaper - Leveled egg
Many landscaping projects involve leveling irregular ground surfaces.{{Citation needed}} A landscaper may prefer to serve their deviled egg with a leveled flat surface. (This happens to resemble a normal hard-boiled egg cut in half.)
;Designer - Beveled egg
{{w|Bevel}}s are a design pattern of creating non-perpendicular surfaces between adjacent edges. A designer may prefer to serve their egg with the edge of the white beveled to give their eggs a more modern, aesthetically pleasing look.
;Physicist - Demon egg
This deviled egg is designed to look like the {{w|Demon Core}} which was a sub-critical plutonium sphere manufactured during the {{w|Manhattan Project}} to investigate the properties of {{w|Critical_mass|criticality}}. The Demon Core consisted of three parts: two plutonium-gallium hemispheres and a ring designed to keep neutron flux from "jetting" out of the joined surface between the hemispheres during implosion. The set of plutonium pieces got their name from the 2 {{w|criticality_accident|criticality incidents}} that occurred when scientists were investigating this property. The first accident resulted in the death of {{w|Harry Daghlian}}. In the second incident, experimenters covered the core with two neutron reflecting shells separated only by a handheld screwdriver. (No, really.) The screwdriver slipped, causing the core to become completely covered by the neutron reflecting shell, bringing the core past its criticality limit. A large amount of radiation caused the subsequent death of physicist {{w|Louis Slotin}}. The dome of the boiled egg and the toothpick resemble the configuration of the experiment.

The demon core was also referred to in [[1242: Scary Names]].

The title texts refers to {{w|ionized-air glow}}, a blue light emitted by air submitted to an energy flux from radiation and seen during the [https://physics.stackexchange.com/a/56722 incidents involving the demon core].

For a detailed explanation of the Demon Core, Kyle Hill produced an [https://www.youtube.com/watch?v=aFlromB6SnU Youtube Documentary regarding the Demon Core. ]

==Transcript==
{{incomplete transcript}}
:[The comic consists of four variations of deviled eggs.]

:[A typical deviled egg, with half of the white part of a hard-boiled egg and a paste of yolk in a rough cone. The paste is speckled with red dots.]
:Chef
:Deviled egg

:[A deviled egg, except the paste has been flattened to be level with the white.]
:Landscaper
:Leveled egg

:[A deviled egg, except the edge of the white has bevels.]
:Designer
:Beveled egg

:[A deviled egg, except the paste is now two hemispheres, one set in (and level with) the white and the other on top with a toothpick wedged between the two hemispheres at the left egg keeping them separated. The toothpick has a small piece of blue foil wrapped around the edge of the toothpick.]
:Physicist
:Demon egg

{{comic discussion}}

[[Category:Comics with color]]
[[Category:Food]]
[[Category:Physics]]

1433: Lightsaber

2022-04-29T00:21:48Z

172.70.85.211: Still no.

{{comic
| number = 1433
| date = October 13, 2014
| title = Lightsaber
| image = lightsaber.png
| titletext = A long time in the future, in a galaxy far, far, away, astronomers in the year 2008 sight an unusual gamma-ray burst originating from somewhere far across the universe.
}}

==Explanation==
This comic references a [http://www.youtube.com/watch?v=WDnoczxzQyg scene] from the third theatrically-released ''{{w|Star Wars}}'' movie, ''[[wikia:c:starwars:Return of the Jedi|Return of the Jedi]]'', wherein [[wikia:c:starwars:Darth Vader|Darth Vader]] confronts his son, [[wikia:c:starwars:Luke skywalker|Luke Skywalker]], who had recently surrendered to [[wikia:c:starwars:Galactic Empire|Imperial]] soldiers. In the movie, Vader notes that Luke has constructed [[wikia:c:starwars:Luke Skywalker's lightsaber|a new lightsaber]] following the loss of his [[wikia:c:starwars:Luke skywalker#Lightsabers|original]] during their [[wikia:c:starwars:Duel on Cloud City|duel on Cloud City]] (Luke Skywalker's original lightsaber actually having been [[wikia:c:starwars:Anakin skywalker|Anakin Skywalker's]] second).

Lightsabers are often jokingly referred to as "laser swords" by fans (note that the official French-language translation of Star Wars actually calls them "laser sabers"), and this comic points out that a real laser would not have any way of stopping and would therefore continue forever, making this particular interpretation silly. (The ''Star Wars'' writers cleverly fail to state what exactly a lightsaber's blade is made out of, although this point makes it unlikely to be a laser.) Once Darth Vader turns on the light saber, it goes offscreen and presumably continues in that direction forever, causing much mayhem as it blazes through the stars. Hull breaches are a popular trope in science-fiction, despite curiously being almost entirely absent from the Star Wars films.

The title text refers to {{w|GRB 080319B}}, an unusual gamma ray burst in 2008, the afterglow of which was briefly visible to the human eye. It implies that the source of this burst was a light saber in the Star Wars story, which took place "a long time ago in a galaxy far, far away" according to the {{w|Star Wars (film)|Star Wars}} {{w|Star Wars opening crawl|opening crawl}}.

Luke Skywalker and Darth Vader have had a similar conversation before in [[1397: Luke]]. In that version Luke wishes for Vader not to turn it on, as stated in the title text. He should probably have said this here in this comic!

==Transcript==
:[Luke Skywalker and Darth Vader are talking. Vader holds the handle of a powered-off lightsaber.]
:Vader: '''''I see you have constructed a new lightsaber.'''''
:[Vader turns it on. The beam of the lightsaber continues upward out of the frame.]
:Lightsaber: Snap-Hisss
:[Vader looks up toward where the beam is pointing.]
:[Vader looks back at Luke.]
:Vader: '''''Where does it end?'''''
:Luke: Doesn't.
:Intercom (out of view): ''Hull breach all along sector five!!''

{{comic discussion}}
[[Category:Star Wars]]
[[Category:Physics]]

2611: Cutest-Sounding Scientific Effects

2022-04-26T00:23:14Z

172.70.85.211: /* Explanation */ ...forgot the comma, when resolving the conflict!

{{comic
| number = 2611
| date = April 25, 2022
| title = Cutest-Sounding Scientific Effects
| image = cutest_sounding_scientific_effects.png
| titletext = The Stroop-YORP number of a scientific paper is how many of the 16 finalist names (sans 'effect') it manages to casually sneak into the text.
}}

==Explanation==
{{incomplete|Created by the Cutest Effect of All Time - Please change this comment when editing this page. Do NOT delete this tag too soon.}}

Randall has compiled a {{w|Tournament bracket|single-elimination tournament bracket}} for a knock-out competition between 16 different scientific effect names that Randall considers cute-sounding. As of now, he is determining the result in a [https://twitter.com/xkcd/status/1518701311763570689 series of Twitter polls].

Below are explanations for what each of the 16 effects are:

;{{w|YORP effect}}: The YORP effect is the effect of sunlight on an asteroid with variations of albedo, which can increase its rotation rate, perhaps until it spins itself apart.
:An acronym of the names Yarkovsky, O’Keefe, Radzievskii and Paddack, who were instrumental in its discovery.
;{{w|Nocebo effect}}: An effect in which a recipient of medication who believes that it will have negative side-effects is more likely to experience those negative side-effects, whether they can be really caused by the medication or not. Opposite of the {{w|placebo effect}}, which focuses on positive side-effects that arise beyond the true efficacy of a given treament.
:'Placebo' derives from "I shall please", while 'Nocebo' comes from "I shall harm".
;{{w|Woozle effect}}: If a study gets repeatedly cited and otherwise disseminated, then people will start to believe it regardless of whether it has any evidence behind it. And if there is not any evidence, it becomes an urban myth.
:Named after a Winnie-the-Pooh story in which Winnie-the-Pooh and Piglet try to catch an imaginary animal called a woozle, and accidentally follow their own tracks in circles.
;{{w|Stroop effect}}: The Stroop effect (referenced in [[1531: The BDLPSWDKS Effect]]) is a psychological phenomenon in which it is easier to name the visual color of a word when the word refers to its own color, than when the word refers to a different color.
:i.e that saying that '''Red''' is red is easier than to say that '''Blue''' is green.
;{{w|Pockels effect}}: A phenomenon where an electric field passed through a medium can cause the medium's refractive index to depend upon the polarization and propagation direction of the refracted light, a property known as {{w|birefringence}}.
;{{w|Cheerios effect}}: A phenomenon where objects floating in a liquid appear to attract or repel each other.
:Named after the cereal Cheerios, which are an everyday demonstration of this phenomenon because many eat Cheerios in a bowl of milk.
;{{w|Hot chocolate effect}}: A phenomenon where the sound created by tapping a cup of hot liquid rises in pitch as a soluble powder is added.
;{{w|Perky effect}}: An experiment in which participants were asked to visualize an object while staring at a screen on which the outline of that object was subtly projected. Participants believed the projected shape to be only a product of their imaginations.
;{{w|Bouba/kiki effect}}: An observation that people, despite different native languages, will relatively consistently assign names with certain sounds to blobby or spiky shapes, suggesting the association of sound and shape is non-arbitrary.
;{{w|Cutaneous rabbit effect}}: A phenomenon where, when tapped on one part of the body in rapid succession and then switching to another, the subject feels the tapping at locations in between the two.
:For example, if rapidly tapping the wrist then switching to the elbow, the subject will subjectively feel as if they are being tapped between the wrist and elbow, when they are not.
;[https://www.investopedia.com/terms/s/smallfirmeffect.asp Small firm effect]: An economic theory that small firms usually perform better than larger ones
;{{w|Little–Parks effect}}: A phenomenon where a fluctuating magnetic field passed through a superconductor can slightly suppress its superconductivity, inducing small fluctuations in its electrical resistance.
:When juxtaposed against the "small firm effect", as in the bracket, one might get the impression that it is somehow related to urban architecture or civil engineering.
;{{w|Dr. Fox effect}}: A disputed theory that student evaluations of their teachers are likely unreliable because they are largely based on the teacher's charisma instead of the quality of their content.
;{{w|Oddity effect}}: A theory that when fish assemble in shoals (large social groups), any that stand out appearance-wise will be attacked by a predator, explaining why shoals tend to have similar-looking members.
;{{w|Butterfly effect}}: The butterfly effect is the sensitivity of chaotic systems to small changes in initial conditions. The weather system of Earth is chaotic, and so an arbitrarily small change in air patterns (such as could be caused by the flapping of a butterfly's wing) could ultimately change the weather for the whole world.
;{{w|Popcorn effect}}: A phenomenon exhibited by crushed ore placed on a vibrating screen for separation in mineral processing, in which larger particles tend to bounce higher than smaller particles.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
:[A tournament bracket tree is shown with 16 scientific effect names each on the left and right side. From both sides toward the middle the brackets reduce to eight, then four, two, and one line where the latter join to a rectangle in the middle.]

:[Left side:]
:Yorp effect - Nocebo effect
:Woozle effect - Stroop effect
:Pockels effect - Cheerios effect
:Hot chocolate effect - Perky effect

:[Right side:]
:Bouba/kiki effect - Cutaneous rabbit effect
:Small firm effect - Little parks effect
:Dr. Fox effect - Oddity effect
:Butterfly effect - Popcorn effect

{{comic discussion}}

294: Bookstore

2022-04-21T21:08:11Z

172.70.85.211: Was this vandalism? Can't be bothered to trawl the History

{{comic
| number =294
| date =July 27, 2007
| title =Bookstore
| image =bookstore.png
| titletext =You can search it if you want, but you may want to skip the memories of your mom.
}}

==Explanation==
[[Cueball]] starts reading a book off the shelf as he considers buying it, but gets so engrossed in it that he accidentally reads the entire thing, eliminating his reason for buying it in the first place. He quietly puts it back and turns to leave the store, only to have the book (which exists in his brain as information) set off the store's anti-theft sensor. This is a satire of copyright as it pertains to digital copies, because when you download a game or music file (or read a book, in this case), you are merely making an identical copy of the source material.

The title text suggests that if the security guard wants to do a brain search, he might want to skip over all the presumably sexual encounters Cueball has had with the security guard's mom, thus inducing a 'yo mama' joke.

==Transcript==
:[Cueball is standing in a bookstore, looking at a book.]
:Cueball [thinking]: This book looks interesting. Maybe I'll buy it.

:[Cueball reads the book; a clock appears above.]

:Cueball [thinking]: Oops, I read the whole thing.
:Cueball [thinking]: I'll just quietly put it back and go.

:[Cueball walks through a security scanner to exit the bookstore.]
:''BEEP BEEP BEEP''

:Voice from off-frame: Hey! Your brain set off the sensor!
:Cueball: I, uhh...
:Voice from off-frame: You have a book in there, don't you!
:Cueball: Crap.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Your Mom]]

Talk:2605: Taylor Series

2022-04-20T19:17:51Z

172.70.85.211: Undo revision 230806 by Z-brown (talk) Undo an obviously accidental repastenof everything, but inserting what I think was meant to be added...

I should point out that Taylor Series expansions can end - for polynomials [[Special:Contributions/172.70.114.157|172.70.114.157]] 17:23, 11 April 2022 (UTC)
:Pics or it didn't happen. [[Special:Contributions/172.68.132.206|172.68.132.206]] 04:45, 12 April 2022 (UTC)
:Tried to improve the text, including polynomial functions and approximation. Sebastian --[[Special:Contributions/172.68.110.121|172.68.110.121]] 18:53, 12 April 2022 (UTC)

Most Physicists only like seasons 1 and 2. [[User:Fephisto|Fephisto]] ([[User talk:Fephisto|talk]]) 17:44, 11 April 2022 (UTC)
: I feel it really jumped the shark in the third term. --[[Special:Contributions/172.69.69.182|172.69.69.182]] 19:29, 11 April 2022 (UTC)
:: Yeah, it does get a bit repetitive. It feels like the writers just started following a formula. [[User:Fephisto|Fephisto]] ([[User talk:Fephisto|talk]]) 19:37, 11 April 2022 (UTC)

Non-mathematician here: what I don't get (and would appreciate having explained) is why he chose this specific instance of an {{w|Series_(mathematics)|infinite series}}. Is there something special about a Taylor series that makes it work best for this joke? Some deeper pun here that "Taylor Series" brings, over just using "(Laurent|Fourier|Dirichlet|Infinite) series" or even "Zeno's Paradox"? --[[Special:Contributions/172.69.69.182|172.69.69.182]] 19:44, 11 April 2022 (UTC)

:Taylor series is approximation of arbitrary function. Fourier serie is also approximation of arbitrary function, although in different way. Those others are something completely different, though. For example, Taylor serie is not DEFINED as infinite - it just usually is. Saying that Laurent series is infinite is like, well, sure it is, it's defined that way, saying that about Taylor series approximating specific function is actually nontrivial statement. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 00:36, 12 April 2022 (UTC)
::Pet peeve: Series, not serie. There is no such word as “serie” in English. “Series” is both plural and singular. [[Special:Contributions/108.162.246.178|108.162.246.178]] 10:43, 15 April 2022 (UTC)

:I feel like he could have worked in at least one Taylor Swift pun
::I thought Taylor series referred to Liz's husbands? (The gag comes far better in German, due to the double meaning of "Glied".) [[Special:Contributions/141.101.105.119|141.101.105.119]] 08:35, 12 April 2022 (UTC)

DuckDuckGo's search on "taylor series expansion taken to extremes" is remarkably unsatisfying, the first result being https://www.mathsisfun.com/algebra/taylor-series.html which nonetheless may be of use in the explanation. [[Special:Contributions/172.68.132.206|172.68.132.206]] 04:42, 12 April 2022 (UTC)

Can this be a reference to the Neverending Story? There the protagonist wishes that the books he love would, well, never end. --[[User:JezebelCeasedToExist|JezebelCeasedToExist]] ([[User talk:JezebelCeasedToExist|talk]]) 05:30, 12 April 2022 (UTC)

I deleted the following passage:
:; It could also reference the term, in office, of US President {{w|Zachary Taylor}}, who died after serving fifteen months, or the political career of {{w|Charles_Taylor_(Liberian_politician)|Charles Taylor}}, whose first term ended in civil war and exile.

Does anyone believe that those theories of the joke could have been made intentionally? [[Special:Contributions/172.69.134.131|172.69.134.131]] 08:21, 12 April 2022 (UTC)
: I actually added that sentence. When someone talks about "the Taylor term", I specifically think of Zachary Taylor's term in office. The idea of a dead man continuing to a second term is amusing. Admittedly, Charles Taylor was seriously unlikely,but I included it because the joke could also apply. [[User:Cwallenpoole|Cwallenpoole]] ([[User talk:Cwallenpoole|talk]]) 12:52, 12 April 2022 (UTC)
:: I don’t know about Chuck Taylor’s terms but he made some excellent sand shoes.[[Special:Contributions/108.162.246.178|108.162.246.178]] 10:47, 15 April 2022 (UTC)

Rather than explaining the pun in the title text as referring to cancelling a TV series after the first season, which is a little weak because it misses the pun on the word "term". A better explanation would have the title text make a pun on a college course, i.e. "The college course, 'The Taylor series', should have been canceled after the first term." where 'term' is commonly used for the duration of a college class. This fits the context of the comic much better than a TV show. The TV show pun would possibly work if there was a TV series called "Taylor", but I don't think there was one. [[User:Rtanenbaum|Rtanenbaum]] ([[User talk:Rtanenbaum|talk]]) 13:00, 12 April 2022 (UTC)
:But we don't talk about cancelling courses after N terms, while this is a very common phrase regarding TV series. And television uses the word "series". [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 13:35, 12 April 2022 (UTC)
::I think this is specifically referring to the common scenario where a TV series has a strong, well-liked, self-contained first series, which is then spoilt by the financial imperative to make follow-up series which artificially stretch the concept beyond its limits. As opposed to the implication of the current explanation - that it should have been cancelled because the first series wasn't any good.[[Special:Contributions/162.158.34.221|162.158.34.221]] 09:32, 13 April 2022 (UTC)

Are we entirely sure there's *not* a Taylor Swift joke here? I mean, is there some lyric like "I love this $X$ and I wish it would never end!", where $X$ is something like "night" or "feeling" or whatever? [[User:Kenahoo|Kenahoo]] ([[User talk:Kenahoo|talk]]) 03:03, 13 April 2022 (UTC)

:''I've been spending the last eight months''
:''Thinking all love ever does''
:''Is break and burn, and end''
:''But on a Wednesday in a cafe''
:''I watched it begin again''
: — also references James ''Taylor'' [[User:Z-brown|Z-brown]] ([[User talk:Z-brown|talk]]) 19:07, 20 April 2022 (UTC)

For the want of a letter ('e' vs. 'o'), the joke could have been made instead about the ever-expanding (20 years!) [https://www.schlockmercenary.com "Schlock Mercenary" web comic by Howard Tayler.] [[User:These Are Not The Comments You Are Looking For|These Are Not The Comments You Are Looking For]] ([[User talk:These Are Not The Comments You Are Looking For|talk]]) 03:56, 18 April 2022 (UTC)

Talk:2609: Entwives

2022-04-20T19:10:52Z

172.70.85.211:

This seems like one of the earliest-released comics in recent history [[User:Dextrous Fred|Dextrous Fred]] ([[User talk:Dextrous Fred|talk]]) 14:00, 20 April 2022 (UTC)

There seemed to be two versions of the title text; on mobile, there is a youtube link visible, but this is not present on my chrome desktop view [[User:Dextrous Fred|Dextrous Fred]] ([[User talk:Dextrous Fred|talk]]) 14:05, 20 April 2022 (UTC)

The mouseover text in android devices is this youtube link - [[https://www.youtube.com/watch?v=mt2qCjL6-n4]] https://www.youtube.com/watch?v=mt2qCjL6-n4 [[User:DefectedWBC|DefectedWBC]] ([[User talk:DefectedWBC|talk]]) 14:18, 20 April 2022 (UTC)

Is LotR the lowest scoring major motion picture on the {{w|Bechdel test}}? [[Special:Contributions/172.70.206.95|172.70.206.95]] 14:37, 20 April 2022 (UTC)

Unlikely, depending on how you define major motion picture.

As pointed out in YouTube’s comment section, the video seems to be a joke, not ''actually'' the only female interaction in the films. [[User:Chortos-2|Chortos-2]] ([[User talk:Chortos-2|talk]]) 14:49, 20 April 2022 (UTC)

Gender imbalance among readers and viewers of lotr as well. [[Special:Contributions/172.70.230.53|172.70.230.53]] 14:51, 20 April 2022 (UTC)

In response to Chortos-2 comment, I would think a slight edit for accuracy along the following lines -- instead of "a video showing" change to "a video that purports to show". As they discuss, the point still stands, but the added accuracy would hurt, would it? [[Special:Contributions/172.70.114.251|172.70.114.251]] 15:39, 20 April 2022 (UTC)newbie

I feel like it's weird that nobody's brought up that this is an Ent comic on 4/20. For context, reddit.com/r/trees (the weed subreddit) has an in joke where they call themselves ents, basically. [[User:Bazzherb|Bazzherb]] ([[User talk:Bazzherb|talk]]) 15:44, 20 April 2022 (UTC)

So who is the third hobbit supposed to be? --[[Special:Contributions/162.158.203.38|162.158.203.38]] 15:56, 20 April 2022 (UTC)
:With the caveat that (by movie standard reference) the hair colours are inverted — there is one dark-haired hobbit and three light(er)-haired ones — I'd say Pippin - if he's the taller one of the sidekick pair like I think he is, rather than Merry. But I can't guarantee the first two are Frodo and Sam (or which is which is which) because fairer-haired Sam is taller than dark- (and spiky-)haired Frodo in the reference cast photos I've just checked. (The necessary on-film rescaling/standing-in-a-hole of non-midget actors to play hobbits/dwarves might complicate these group tableaus!) Perhaps they are all Hobbits Of Another Story, coincidentally in a fellowship with another generic Human, Dwarf and Elf. Or else drawn more faithfully to the book (which I have yet to check) than the film adaptation? [[Special:Contributions/172.70.85.177|172.70.85.177]] 16:30, 20 April 2022 (UTC)

Considering Arwens and Ents age, I would actually suspect that yes he totally knows her. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 18:19, 20 April 2022 (UTC)
:My first thought was that, especially with both races having an interest in trees... But then I decided that their opposing views of trees (habitat vs livestock) might have encouraged a natural racial separation, or at least less likely to socially mix over the millenia. [[Special:Contributions/172.70.85.211|172.70.85.211]] 19:10, 20 April 2022 (UTC)

2608: Family Reunion

2022-04-19T07:25:10Z

172.70.85.211: Undo revision 230715 by Stilloes (talk) I only understand the main Incomplete Tag change, and and that's just a joke.st a

{{comic
| number = 2608
| date = April 18, 2022
| title = Family Reunion
| image = family_reunion.png
| titletext = Grandma says that because of differences in primate and feline lifespans, the cat is actually my 17,000,000th cousin 14,000,000 times removed.
}}

==Explanation==
{{incomplete|Created by THE GIRL YOU DIDN'T KNOW WAS YOUR RELATIVE (WHOOPS) - Please change this comment when editing this page. Do NOT delete this tag too soon.}}

Because all humans are descended from a {{w|Mitochondrial Eve|common ancestor}}, every human is, at some point, related to every other human, albeit distantly. Similarly, all life forms on Earth are presumed (with good reasons) to be descended via a single {{w|Last universal common ancestor|common ancestor}}, and thus ''all'' life forms are distantly related. This makes every interaction with another life-form, technically, a family reunion, if not in the traditional sense.

The general English definition of a {{w|cousin}}, which is a person sharing an ancestor who is not a direct parent of either party, can be qualified by two numbers. There is the ''n''th-ness of the relationship (the fewest generations you need to go beyond one's parentage, "a first cousin" implies that a grandparent is the key link) - for example, [[Cueball|this Cueball's]] relation to [[White Hat]] is via a great-grandparent, whilst that with [[Hairbun]] is through a great-great-great-great-great-great-great-great-grandparent. A "removed" number is any difference in this number between the two individuals, such that a child of a direct cousin invokes a "once removed" relationship. You would normally only qualify "first cousin" if this fact is considered important, and "zero times removed" would also be considered implicit.

As pointed out in the title text, cat lifespans (or, more importantly, inter-generational breeding cycles) are somewhat different from those of humans. Although they would have still been very similar immediately after the divergence from the appropriate MRCA, the differences will have built up to a generational-count displacement of a similarly extreme nature. i.e. that while the shared ancestor is Cueball's 17-million-or-so-Great Grandparent, the cat is in turn the 31-million-or-so-Great Grandchild. Exactly how accurate, or even precise, Randall considers these numbers is unknown, but it is the kind of fact that we know he likes to research and use expert opinion for.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[Megan, White Hat, Cueball, Hairy, a 2nd Megan (Danish?), a cat, Hairbun, a chair, and a potted plant on a cabinet are "standing" in a line. White Hat is holding a cup and Hairy has his hands to the side. There are arrows pointing to each of the living creatures.]

:14th cousin [Megan]
:2nd cousin [White Hat]
:Me [Cueball]
:12th cousin [Hairy]
:35th cousin [Megan #2]
:17,000,000th cousin [cat]
:9th cousin [Hairbun]
:50,000,000,000th cousin [potted plant]

:[Caption below the panel:]
:Really, ''every'' gathering is a family reunion.

{{comic discussion}}
[[Category:Comics featuring Megan]]
[[Category:Comics featuring White Hat]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Hairy]]

[[Category:Comics featuring Hairbun]]
[[Category:Cats]]
[[Category:Biology]]

1093: Forget

2022-04-17T11:41:09Z

172.70.85.211: 2028 removed opinion. 2043 redefined Bush.

{{comic
| number = 1093
| date = August 10, 2012
| title = Forget
| image = forget.png
| titletext = 'Baby Got Back' turned 20 this year. My favorite nostalgia show is VH1's 'I Love The Inexorable March of Time Toward the Grave That Awaits Us All.'
}}

==Explanation==
The median age in {{w|USA}} is currently about 37 years. Assuming that you must be at least five years old to remember a cultural event later, this means that anything that happened more than thirty-two years ago is remembered by a minority of people today. This applies to any event prior to 1980, so here in 2012, the majority of Americans are too young to remember the Seventies. However, according to census estimation the median will raise in the future, so instead of a 32 years gap between event and the moment when most people can't remember it, the gap becomes 35 years (implying a median of some 40 years).

'''2013: The Carter presidency''' {{w|Jimmy Carter}} was the {{w|President of the United States}} from 1977-1981. He lost all popularity after he was viewed as mishandling several crises during his presidency, including the {{w|Three Mile Island accident}}, the {{w|Iran hostage crisis}}, and the "{{w|stagflation}}" of the late 1970s. According to Wikipedia, his decisions to reinstate registration for the draft and his decision to boycott the {{w|1980 Summer Olympics}} in Moscow (over the 1979 Soviet invasion of Afghanistan) helped contribute to his defeat in the 1980 Presidential campaign.

'''2014: The Reagan shooting''' References the 1981 {{w|Reagan assassination attempt|assassination attempt}} on the then American president, {{w|Ronald Reagan}}.

'''2015: The Falkland Islands War''' This is in reference to the {{w|Falklands War|brief outbreak of hostilities}} between the {{w|UK}} and {{w|Argentina}} over the {{w|Falkland Islands|Falkland Islands (Islas Malvinas)}} located off the shore of Argentina claimed by both but controlled by the UK. Even to this date, tensions remain high over the ownership of these islands, and while many people alive today weren't alive to witness it, it nevertheless remains present in the collective psyche of both nations.

'''2016: ''Return of the Jedi'' release''' ''{{w|Return of the Jedi}}'' was the 3rd film in the original ''Star Wars'' trilogy, released in 1983.

'''2017: The first Apple Macintosh''' The {{w|Macintosh}} was a line of computers created by {{w|Apple Inc.|Apple}}, first introduced in 1984, with the {{w|Macintosh 128K}}.

'''2018: New Coke''' References a public relations blunder that the Coca-Cola corporation undertook in attempting to reformulate its cola recipe, the new formula called {{w|New Coke}} popularly. The public backlash so shook the company that they reintroduced the original recipe as {{w|Coca-Cola Classic}} within 3 months. New Coke was eventually rebranded from Coca-Cola to Coke II, and then discontinued. Coca-Cola Classic has quietly been rebranded back to simply Coca-Cola, as it originally was. The "New Coke" introduction is considered one of the biggest PR blunders from a major company ever.

'''2019: Challenger''' The {{w|Space Shuttle Challenger|Challenger}} was a {{w|Space Shuttle orbiter}}, which was launched in 1986, but {{w|Space Shuttle Challenger disaster|exploded}} 72 seconds into its flight, killing everyone aboard, including {{w|Christa McAuliffe}}, a teacher selected to be the first teacher in space.

'''2020: Chernobyl''' Refers to the 1986 meltdown of a {{w|Chernobyl|nuclear power plant}} in the {{w|Ukranian SSR}} (then a part of the Soviet Union). The meltdown forced the nearby city of {{w|Pripyat}} to be abandoned, and it remains a ghost town today.

'''2021: Black Monday''' Refers to the 1987 {{w|Black Monday (1987)|day}} of the largest one-day {{w|stock market}} drop in history.

'''2022: The Reagan presidency''' {{w|Ronald Reagan}} was an American president from 1981 to 1989, and was a generally well received president known for ending the Cold War, oversaw the {{w|Iran–Contra affair}}, {{w|Invasion of Grenada|invading Grenada}}, and issuing forth a number of new {{w|Reaganomics|economic policies}}.

'''2023: The Berlin Wall''' Refers to the {{w|Berlin Wall|barrier}} surrounding the Anglo-French-controlled part of {{w|Berlin}}. It was erected by the {{w|East Germany|East German}} Government in 1961 to stop illegal emigration to {{w|West Berlin}} (an enclave of {{w|West Germany}}) after the end of the Second World War. After a friendly revolution in 1989, emigration to West Berlin (and West Germany in general) was granted suddenly and very surprisingly again on November 9, 1989. The following rush of people to the Wall from East (to cross the border) and from West (to welcome friends and relatives) in that night coined the figurative "Fall of the Wall", preceding the actual reunion of Germany in 1990 and (almost) complete demolition of the Wall.

'''2024: HammerTime''' Refers to a refrain in {{w|MC Hammer|MC Hammer's}} 1990 hit song {{w|U Can't Touch This}}; [[Randall Munroe]] makes reference to this song elsewhere in his comics, too (specifically [[108: M.C. Hammer Slide]] and [[210: 90's Flowchart]]).

'''2025: The Soviet Union''' Refers to a country emerging after the end of {{w|World War I}}. It became the cold-war adversary of the United States after the end of {{w|World War II}} and only collapsed in 1991.

'''2026: The LA Riots''' Refers to the {{w|1992 Los Angeles riots|massive riots}} occurring at the release of the verdict acquitting the officers accused of the {{w|Rodney King}} beatings in 1992.

'''2027: Lorena Bobbit''' Refers to the {{w|John and Lorena Bobbitt|woman}} who {{w|emasculated}} her husband in 1993.

'''2028: The Forrest Gump release''' ''{{w|Forrest Gump}}'' was a 1994 drama starring {{w|Tom Hanks}} as a mentally disabled man, telling his spectacular life story. The movie had a highly successful release, and some consider it one of the greatest films of all time.

'''2029: The Rwanda Genocide''' Refers to the 1994 {{w|Rwandan genocide}}, where an estimated 800,000 people were killed.

'''2030: OJ Simpson's Trial''' The {{w|O. J. Simpson murder case|O.J. Simpson trial}} was a famous criminal case during which {{w|O.J. Simpson}}, a professional football player, was {{w|acquitted}} of the murder of {{w|Nicole Simpson}} and {{w|Ronald Goldman}}. He was later arrested and jailed for other crimes, including armed robbery and kidnapping.

'''2031: Clinton's reelection''' {{w|Bill Clinton}} was the American president from 1993 to 2001. He won his second term in the {{w|United States presidential election, 1996|1996 presidential election}}. During his second term, he faced controversy during an {{w|impeachment}} trial, for which he was acquitted, and a large number of pardons he made on his last day of office. Clinton was a generally favoured president, exiting his presidency with a high approval rate.

'''2032: Princess Diana''' {{w|Princess Diana}} was a famous {{w|Commonwealth}} princess who made headlines after her 1997 {{w|Death of Diana, Princess of Wales|death}} in a car crash.

'''2033: Clinton's impeachment''' In 1998, the American {{w|Congress}} voted to {{w|Impeachment of Bill Clinton|impeach}} then-president Clinton, based on allegations that he {{w|Lewinsky scandal|lied}} about relations with a {{w|Monica Lewinsky|White House intern}}. He was later acquitted.

'''2034: Columbine''' Refers to the 1999 {{w|Columbine High School massacre}}, where 13 people were killed by a {{w|Eric Harris and Dylan Klebold|pair of shooters}}.

'''2035: Forgot About Dre''' Refers to the {{w|Grammy}} winning 2000 song, "{{w|Forgot About Dre}}," by the rapper {{w|Dr. Dre}}. In it, Dre complains that his accomplishments have been purposefully ignored and forgotten; ironically, at some point in the future Dre's complaints about being forgotten will, themselves, be forgotten.

'''2036: 9/11''' Refers to the {{w|September 11 attacks}} in 2001, where terrorists crashed two planes into the {{w|World Trade Center (1973–2001)|World Trade Center}} towers, in {{w|New York City}}. Two other planes crashed that day: one into the {{w|The Pentagon}}, and one in a field outside of {{w|Shanksville, Pennsylvania}} (presumably on its way to crashing into the Capitol Building).

'''2037: VH1's I love the 80s''' ''{{w|I Love the '80s (U.S. TV series)|I Love the '80s}}'' was a 2002 nostalgia TV series by {{w|VH1}}. This will make the 1980s doubly forgotten; not only will people not remember the decade, they will not remember the famous retrospective of people remembering the decade.

'''2038: A time before Facebook''' Refers to the online social media site, {{w|Facebook}}, launched in 2004.

'''2039: VH1's I love the 90s''' ''{{w|I Love the '90s (U.S. TV series)|I Love the '90s}}'' was a TV series airing in 2004.

'''2040: Hurricane Katrina''' {{w|Hurricane Katrina}} was a devastating 2005 hurricane that hit {{w|New Orleans}}, killing almost 2000 people and causing 81 billion dollars in damage.

'''2041: The planet Pluto''' {{w|Pluto}} is a {{w|dwarf planet}} in our solar system. Up until 2006, Pluto was considered to be a planet.

'''2042: The first iPhone''' {{w|Apple}}'s first iPhone was released in 2007.

'''2043: The Bush presidency''' {{w|George W. Bush}} was the American president from 2001 to 2009. He was criticized for the wars on {{w|War in Afghanistan (2001%E2%80%93present)|Afghanistan}} and {{w|Iraq War|Iraq}}, poor handling of Hurricane Katrina, and seeing the United States enter a recession. His approval peaked after the 9/11 attacks, but had fallen to historical lows by the end of his second term, making him one of the least liked US presidents.

'''2044: Michael Jackson''' Refers to the {{w|Michael Jackson|pop singer}} who died of drug overdose in 2009.

'''2045: Trying to say Eyjafjallajökull''' Is a reference to a volcano in {{w|Iceland}} that {{w|Eyjafjallajökull#2010 eruptions|erupted}} in 2010. The eruption threw volcanic ash several kilometres up in the atmosphere, which led to air travel disruption in northwest Europe for six days.

'''2046: The Arab Spring''' Refers to the {{w|Arab Spring|wave of revolutions}} that began in late 2010, where many Arabic nations overthrew leaders and started civil wars, with many nations converting to democracies.

'''2047: Anything embarrassing you do today''' Refers to the fact that in 35 years, the majority of Americans will not have been around on this date. However, it is to be noted that it would have to be something ''very'' embarassing for anyone more than people around or friends to notice. Usually, embarassing actions by an individual (non-celebrity) that aren't notable in some way don't end up being noticed, much less on the news.{{Citation needed}}

The title text is in reference to the vastly over-saturated programming on VH1 dedicated to the history of the TV universe.

==Transcript==
:'''When Will We Forget?'''
:Based on US Census Bureau ''National Population Projections''
:Assuming we don't remember cultural events from before age 5 or 6

:By this year: The majority of Americans will be too young to remember:
:2012: The seventies
:2013: The Carter presidency
:2014: The Reagan shooting
:2015: The Falkland Islands war
:2016: ''The return of the Jedi'' release
:2017: The first Apple Macintosh
:2018: New Coke
:2019: ''Challenger''
:2020: Chernobyl
:2021: Black Monday
:2022: The Reagan presidency
:2023: The Berlin Wall
:2024: HammerTime
:2025: The Soviet Union
:2026: The LA Riots
:2027: Lorena Bobbit
:2028: The ''Forrest Gump'' release
:2029: The Rwanda Genocide
:2030: OJ Simpson's Trial
:2031: Clinton's reelection
:2032: Princess Diana
:2033: Clinton's impeachment
:2034: Columbine
:2035: ''Forgot About Dre''
:2036: 9/11
:2037: VH1's ''I love the 80s''
:2038: A time before Facebook
:2039: VH1's ''I love the 90s''
:2040: Hurricane Katrina
:2041: The planet Pluto
:2042: The first iPhone
:2043: The Bush presidency
:2044: Michael Jackson
:2045: Trying to say ´´Eyjafjallajökull``
:2046: The Arab Spring
:2047: Anything embarrassing you do today

==Trivia==
The very popular YouTuber Vsauce put this chart in a video called “This Is Not Yellow”, and it got almost twenty million views.

{{comic discussion}}

[[Category:Charts]]
[[Category:Comics to make one feel old]]
[[Category:Volcanoes]] 
[[Category:Stock Market]]
[[Category:Star Wars]]
[[Category:Comics featuring Ronald Reagan]]

1360: Old Files

2022-04-15T11:45:49Z

172.70.85.211: /* Files and Folders */ +be, and ZIP Disk also reserved

{{comic
| number = 1360
| date = April 25, 2014
| title = Old Files
| image = old_files.png
| titletext = Wow, ANIMORPHS-NOVEL.RTF? Just gonna, uh, go through and delete that from all my archives real quick.
}}

==Explanation==
This comic came out the day after [http://news.sky.com/story/1248397/andy-warhol-originals-found-on-floppy-disk Sky News published the story] of original {{w|Andy Warhol}} artwork, created in 1985 on an {{w|Amiga 1000}}, which was recovered from recently found floppy disks.

[[Cueball]] is shown literally digging through a pile of old files; which is a metaphor for looking through old files on his computer. The layers of the pile are arranged much like geological rock formations where older strata are deeper down than younger layers. The files are in concentric layers because each directory is embedded in the previous directory. Therefore, the "Documents" folder contains an "Old Desktop" folder, which contains a folder with files recovered from an older system, which itself contains a "My Documents" folder, which contains a folder with files copied from a {{w|Zip Disk}} from high school. The result is that files from high school have survived in his present-day machine. These older folders serve as a time capsule of sorts, storing old files from {{w|AOL}}, NYET, and {{w|Kazaa}}. These files are meant to be analogous to the fossils and artifacts found in lower, older rock layers.

The sizes of the files decrease as Cueball goes deeper, since data storage has gotten cheaper over time. When the Zip Drive first came out, it cost $200 USD (plus $20 per 100 MB floppy). As of 2019, $200 could buy you at least an 8 TB portable external hard drive. In the 1990s, during AOL's heyday, 10+ GB hard drives were prohibitively expensive and a terabyte of data was unimaginable to most users.

Deep down, Cueball discovers several files he is surprised about, including a poetry file which embarrasses him as he does not remember writing poetry.

In the title text, he mentions also finding an "{{w|Animorphs}} Novel", which may be a text copy of one of the original books or a fan fiction of the ''Animorphs'' series (his reaction of quickly eradicating it may either be to prevent him being caught with a presumably-illegal copy of an Animorphs book or as a result of embarrassment at his fan fiction - the former is less likely than the latter considering some of the other files mentioned, so it is most likely a fan fiction). The series was released between 1996 and 2001, consistent with the fact that these files were created during Cueball/[[Randall|Randall's]] high school years. The series was extremely popular at the time. Animorphs has already been mentioned in the title text of [[1187: Aspect Ratio]], and later it was the main joke in [[1380: Manual for Civilization]] and [[1817: Incognito Mode]].

===Files and Folders===
The folders and files in detail:

'''Documents''' (47 GB): A large folder containing many of [[Cueball]]'s personal files.
*''misc.txt'': A miscellaneous {{w|text file}}, which could contain anything; possibly just various notes that Cueball is keeping.

*''Video projects'': As video files can take up a lot of space and video projects tend to use a lot of them, this likely makes up a considerable portion of the 47 GB.

'''Old desktop''' (12 GB): A backup from a former computer.
*''{{w|Facebook}} pics'': Pictures that were intended to be added to Facebook (and/or ones which were downloaded *from* Facebook).
*''Pics from other camera'': Unknown pictures from a second camera.
*''Temp'': Temporary folders generally contain cached files and files that are used temporarily to install programs. A folder named "Temp" might also be created by a user to store unimportant text or image files, not intending or caring to give it a more meaningful or specifically explanatory name.
*''Misc {{w|Portable Document Format|PDF}}s'': PDFs are often used for documentation, but could be any collection of digitized books or other documents.
*''{{w|MP3}}'': MP3 is a widely used format for digital audio files.

'''Recovered from drive crash''' (4 GB): When a {{w|Hard disk drive|hard drive}} crashes, some or all data may be recovered.
*''Temp'': Temporary files.
*''Work misc'': Unknown work related projects.
*''{{w|Audiobook|Audio books}}'': Recordings of books being read out loud.

'''My Documents''' (570 MB): {{w|Windows XP}} user accounts came with a "My Documents" folder that was widely used for storing personal files. The items in this archive came from the era when {{w|Windows XP}} was popular.
*''Downloads'': The default download folder for most browsers of the time.
*''{{w|Kazaa}} shared'': Kazaa is a defunct peer-to-peer file sharing program. The "shared" folder is shared with other members.
*''AYB'': {{w|All your base are belong to us|ALL YOUR BASE are belong to us}} is an internet {{w|Meme|meme}} inspired by a bad translation from ''{{w|Zero Wing}}''. Also referenced in [[286: All Your Base]].
*''{{w|Escape Velocity Override|EV Override}}'': An {{w|Apple Macintosh}} video game, released in 1998.
*''[http://rephial.org/ Angband]'': A game named after a fictional stronghold created by {{w|J. R. R. Tolkien}}.
*''{{w|GIF}}s'': An image format widely used for transparent or animated images.
*''{{w|Fight Club}}.wmv'': A movie. As feature movies are typically compressed to 700 megabytes, and this folder only contains 570 MB ''in its entirety'', including 94 MB explicitly in a further sub-folder, this one file must be significantly smaller. It could be of very low quality (e.g. resolution and/or frame-rate), truncated (after a prior failed copy) or even a fake download designed to [https://www.2-spyware.com/fake-codecs-that-drop-widely-spread-malware fool unwary recipients].
*''{{w|Elasto Mania}}'': A physics-simulation game that claims to show real physics.
*''{{w|AOL Instant Messenger|AIM}} Direct Connect files'': Files transferred via AOL Instant Messenger.
*''{{w|4chan}}'': An image-board where users can upload pictures anonymously. Randall impulsively saves pictures from there. This entry is something of an anomaly, the rest of the files at this level were most notable around 1998 to 2001 while 4chan was only launched at the end of 2003. Since this board frequently contains images you wouldn't want to be caught looking at, this folder may be buried to hide it.
*''{{w|ICQ}} logs'': Logs from an instant messaging program introduced in 1996 and no longer commonly used in North America.

'''High school {{w|Zip drive|Zip disk}}''' (94 MB): The most popular form of {{w|superfloppy}}, introduced in 1994 with a capacity of 100 MB.
*''{{w|Korn}} MIDI'': Korn is an American {{w|nu metal}} band formed in 1993. {{w|MIDI}} is a protocol for communication with electronic musical instruments. The result tends to be sounds of low quality (but it heavily depends on how MIDI is played).
*''Photos3'': This is a folder of old photos.
**''{{w|Prom}}'': Pictures taken at prom.
*''lovenote.txt'': An old text file of a {{w|love letter}}, probably to a classmate in high school. Possibly referencing [[340: Fight]].
*''{{w|Gorillas (video game)|Gorillas}}.bas'': A game written in {{w|BASIC}}, to be run on {{w|QBasic}}, and supplied with MS-DOS.
*''Dream.txt'': Some private dreams.Possibly a reference to [[269|269: TCMP]]
*''James.txt'': Perhaps [[James]] is a friend of Randall, and the same as the one who came up with [[107|xkcd #107]].
*''{{w|AOL}}'': An early online and internet service, founded in 1985 and popular in the 1990s.
**''{{w|Citadel (software)|Citadel}}'' - A {{w|BBS}} and email platform that was widely used in the 1980s and early '90s.
*''{{w|QBasic}}'': An {{w|Integrated development environment|IDE}} released by {{w|Microsoft}} in 1991, which was used to write and run computer programs in the BASIC language.
*''NYET'': ''NYET'' was a {{w|Tetris}}-like game for MS-DOS, released in 1988.
*''Jokes.txt'': An old text file of jokes.

'''AAAFILES''' (9.4 MB): Some of [[Cueball]]'s oldest documents, likely prefixed with "AAA" to put the folder at the top of an alphabetically-sorted list.

'''TXT''' (850 K): Old text files, which include poetry he didn't remember writing.

==Transcript==
[Cross-sectional view of what look vaguely like stratigraphic layers underground. A crevice leads down through these concentric layers to a cave-like cavity in the middle, where Cueball is going through the deepest, most central, and incidentally smallest of the files. Above, Megan stands at "ground level", looking down into the crevice.]

:Megan: You OK down there?

:'''Documents''' (47 GB)
::misc.txt
::Video projects
:'''Old desktop''' (12 GB)
::Facebook pics
::Pics from other camera
::Temp
::Misc PDFs
::MP3
:'''Recovered from drive crash''' (4 GB)
::Temp
::Work misc
::Audio books
:'''My Documents''' (570 MB)
::Downloads
::Kazaa shared
::AYB
::EV Override
::Angband
::GIFs
::FIGHT CLUB.wmv
::Elasto Mania
::AIM Direct Connect files
::4chan
::ICQ logs
:'''High school Zip disk''' (94 MB)
::Korn MIDI
::Photos3 (Prom)
::lovenote.txt
::Gorilla.bas
::Dream.txt
::James.txt
::AOL (Citadel)
::QBasic
::NYET
::Jokes.txt
:'''AAAFILES''' (9.4 MB)
:'''TXT''' (850 K)
:Cueball (deep inside the AAAFILES section looking at his txt files): Oh my god. I wrote '''poetry'''.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Animorphs]]
[[Category:Comics featuring James]]
[[Category:Fight Club]]

2606: Weird Unicode Math Symbols

2022-04-14T05:21:32Z

172.70.85.211: /* Explanation */

{{comic
| number = 2606
| date = April 13, 2022
| title = Weird Unicode Math Symbols
| image = weird_unicode_math_symbols.png
| titletext = U+2A0B ⨋ Mathematicians need to calm down
}}

==Explanation==
{{incomplete|Created by SNAKES OVER THERE - Please change this comment when editing this page. Do NOT delete this tag too soon.}}

This comic proposes joke explanations for various unicode symbols with obscure or no known uses.

{| class="wikitable"
|+ Symbols
|-
! Codepoint !! Symbol !! Unicode Name !! Actual use !! Randall's meaning || Explanation
|-
| U+29CD || ⧍ || Triangle with Serifs At Bottom || No standard use,{{citation needed}} but resembles half of the {{w|Hobo#Hobo signs and graffiti|Hobo sign}} for "Rich people live here" (the other half being a top hat)[https://www.logodesignlove.com/hobo-signs-and-symbols] || Shark || May look like a shark fin sticking out of the water.
|-
| U+23E7 || ⏧ || Electrical Intersection || Indicates where wires branch off || Traffic circle || May look like a {{w|roundabout}}.
|-
| U+2A33 || ⨳ || {{w|Smash product}} || Result of dividing two {{w|product spaces}} || ''Hashtag'' (obliquely transcribed!) || Looks somewhat like the {{w|Number sign|hash}} symbol (#) – commonly used for indicating tags called {{w|hashtag}}s in social media – turned by 45 degrees.
|-
| U+2A7C || ⩼ || Greater-Than with Question Mark Above || Used in proofs to indicate a greater-than relation that should exist but hasn't been proven yet (non-rigorous) || Confused alligator || One metaphor used when teaching inequality signs in primary school is that the sign looks like an alligator mouth "eating" the larger number.
|-
| U+299E || ⦞ || Angle with S Inside || Plural for the angle symbol (∠) [https://www.quora.com/Unicode-How-is-the-s-in-triangle-glyph-used-in-mathematics][https://www.birdvilleschools.net/cms/lib2/TX01000797/Centricity/Domain/1114/Homework%20Helper%20Unit%203%20ch%209-10.pdf] rarely used || Snack || May look like a mouth eating an S, where the S symbolizes some snack food.
|-
| U+2A04 || ⨄ || {{w|Arity|N-ary}} Union Operator with Plus || Disjoint union[https://books.google.com/books?id=531cAgAAQBAJ&pg=PA165&lpg=PA165&dq=%E2%A8%84&source=bl&ots=oYXkMNXP-T&sig=ACfU3U2QvMRBkD7uVG0OSumKI0JQtjTIKA&hl=en&sa=X&ved=2ahUKEwios862ypL3AhWXVTABHTnQALQQ6AF6BAgKEAM] (joining two sets that have no elements in common) || Drink refill || Looks like a cup with a plus to indicate adding drink to the cup.
|-
| U+2B48 || ⭈ || Rightwards Arrow Above Reverse Almost Equal To || Pairs with ⭂ but does not appear to be in regular use || Snakes over there || Looks like two squiggles to represent snakes and an arrow indicating the direction where they may be found.
|-
| U+225D || ≝ || Equal To By Definition || Indicates an equation where the left side is to be defined as the right side[https://www.reddit.com/r/math/comments/1z1mty/can_someone_please_explain_the_equal_to_by/] usually used in proofs to indicate the sought definition has been reached || Definitely, for sure || "Def" is understood as "definitely"; the equal sign looks like a double underline, indicating heavy emphasis.
|-
| U+237C || ⍼ || Right Angle with Downwards Zigzag Arrow || No purpose is known[https://ionathan.ch/2022/04/09/angzarr.html]; speculation includes "Y axis continues downward" and "diode with a gate". || Larry Potter || Looks like the letter "L" and a lightning bolt. {{w|Harry Potter (character)|Harry Potter}} is known for having a lightning bolt-shaped scar on his forehead. The character {{w|Legal_disputes_over_the_Harry_Potter_series#Nancy_Stouffer|Larry Potter}} figured in a fraudulent legal claim against J.K. Rowling.
|-
| U+2A50 || ⩐ || Closed Union with Serifs and Smash Product || Indicates that a collection of topological spaces is {{w|Union-closed sets conjecture|closed}} when taking arbitrary unions and smash products, for use in a serif font. That is, if you take the union of any collection of topological spaces in the collection (even uncountably many), or the smash product of them, the result will also be in that collection. This is apparently important because the sets can't be isomorphic (one cannot be rearranged to be exactly the other) [https://mathoverflow.net/questions/196084/counterexample-for-associativity-of-smash-product] || Spider caught with a cup and index card || Spiders or other bugs found within someone's house or workspace may be caught with a glass and something flat, often a card or a magazine, to be released outside.
|-
| U+2A69 || ⩩ || Triple Horizontal Bar with Triple Vertical Stroke || Decorative{{citation needed}} || ℍ𝕒𝕤𝕙𝕥𝕒𝕘 || Hash symbol with one extra vertical and horizontal line, or perhaps a hash symbol which has been accidentally double-struck or overprinted.
|-
| U+2368 || ⍨ || APL Functional Symbol Tilde Diaeresis || Indicates that the {{w|negation|logical not}} operation should be performed on each of the symbols that follow || :/ || Looks like a confused or disappointed face. Randall's use is in fact common among {{w|APL (programming language)|APL}} programmers in the comments, as documented [https://aplwiki.com/wiki/APL_Orchard#Emoticons here].
|-
| U+2118 || ℘ || Script Capital P || An eccentric, Gothic-esque capital Roman P first used by Weierstrass for his self-named "p-function." This symbol is universally used for the {{w|Weierstrass Elliptic Function|p-function}} and apparently has no name except "Weierstrass-p." It is reminiscent of ∂, a stylized cursive d used for partial differentials or ∫, a stylized long s used for integrals. || Snake || This symbol coils around like a long snake, with a tapering-off tail on one end and a small "head" on the other.
|-
| U+2AC1 || ⫁ || Subset with Multiplication Sign Below || Indicates that one set is subset of another by means of the cross product || User experience (written perpendicularly) || Looks like the letters "Ux" sideways; Ux is a common abbreviation for {{w|user experience}}.
|-
| U+232D || ⌭ || {{w|Cylindricity}} || A symbol used in geometric dimensioning and tolerancing (GD&T) to represent a parameter called "cylindricity" which describes the statistical deviation of an ensemble of surfaces from a reference cylinder. [https://cimquest-inc.com/metrology-minute-cylindricity/ example use] || Rolling dough between your hands to shape it into a ball || Looks like two flat hands (perhaps like stick-figure arms) rolling a ball between them. Rolling dough between one's hands to make it into a ball is an important step in making many kinds of pastry.
|-
| U+2A13 || ⨓ || Line Integration with Semicircular Path Around Pole || Very rare symbol for half of a closed {{w|Contour integration|contour}} or {{w|Line integral|line}} integral which contains the {{w|Origin (mathematics)|origin}} in its interior. Contour integrals which circle the origin are very important in complex analysis. If such an integral were split into two parts, each could be represented by this symbol.
Might be mistaken for ⨔ (Integral not including the {{w|Zeros and poles|pole}}) [https://math.stackexchange.com/questions/2299363/where-is-the-%E2%A8%93-integral-symbol-defined]
|| Integral that avoids a bee on the whiteboard || Looks like an {{w|integral}} symbol with a bump that goes around a dot, as if a professor was drawing an integral on a whiteboard but did not want to disturb a bee that had landed right in the path of their marker.
|-
| U+2A0B (title text)|| ⨋ || Summation with Integral || The sum of the sum of the discrete elements (∑) and the integrals (∫)over the connected pieces. This symbol requires context to be meaningful but could occur, for instance, when computing probabilities using mixed distributions.
[https://twitter.com/fermatslibrary/status/1308743505309822977 see also]
|| Mathematicians need to calm down || Since the two symbols combined are kinds of summation the symbol seem unnecessary at first glance. The comment given may make fun of mathematicians' tendency to form increasingly complex expressions in their work.
|-
|}

This comic may have been inspired by [https://ionathan.ch/2022/04/09/angzarr.html this blog post], which went viral (in a limited sense) the same day the comic was published.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

[Title:] Weird Unicode math symbols

[Subtitle:] And their meanings

{|
| U+29CD || ⧍ || Shark
|-
| U+23E7 || ⏧ || Traffic circle
|-
| U+2A33 || ⨳ || Hashtag [the text is slanted counterclockwise]
|-
| U+299E || ⦞ || Snack
|-
| U+2A04 || ⨄ || Drink refill
|-
| U+2B48 || ⭈ || Snakes over there
|-
| U+225D || ≝ || Definitely, for sure
|-
| U+237C || ⍼ || Larry Potter
|-
| U+2A50 || ⩐ || Spider caught with a cup and index card
|-
| U+2A69 || ⩩ || [The word "hashtag" but with extra horizontal and vertical lines]
|-
| U+2368 || ⍨ || :/
|-
| U+2118 || ℘ || Snake
|-
| U+2AC1 || ⫁ || [The words "user experience" rotated counterclockwise 90 degrees]
|-
| U+232D || ⌭ || Rolling dough between your hands to shape it into a ball
|-
| U+2A13 || ⨓ || Integral that avoids a bee on the whiteboard
|}

{{comic discussion}}
[[Category:Unicode]]
[[Category:Math]]
[[Category:Harry Potter]]

Talk:2604: Frankenstein Captcha

2022-04-09T13:38:22Z

172.70.85.211: Another meaning of Frankenstein

2593: Deviled Eggs

2022-04-07T12:49:36Z

172.70.85.211: /* Transcript */ Wrong typo fixed

{{comic
| number = 2593
| date = March 14, 2022
| title = Deviled Eggs
| image = deviled_eggs.png
| titletext = The foil on the toothpick represents the blue flash.
}}

==Explanation==

{{incomplete|Created by a SUBCRITICAL EGG - Please change this comment when editing this page. Do NOT delete this tag too soon.}}

A {{w|deviled egg}} is a dish created by cutting a hard-boiled egg into halves and replacing the yolk with a paste frequently made using the yolk itself, additional ingredients such as {{w|mustard}} and {{w|mayonaise}}, and topped with a red spice (usually {{w|paprika}}). Importantly, the paste has a larger volume than the original yolk because of the added ingredients (and probably some air) into the originally homogonous yolk substances. Randall Munroe parodies the dish by creating several alternative versions of the dish for other professions using word plays on the name of the dish.

;Chef - Deviled egg
The original dish with the excess paste piled above the egg white.
;Landscaper - Leveled egg
Many landscaping projects involve leveling irregular ground surfaces.{{Citation needed}} A landscaper may prefer to serve their deviled egg with a leveled flat surface. (This happens to resemble a normal hard-boiled egg cut in half.)
;Designer - Beveled egg
{{w|Bevel}}s are a design pattern of creating non-perpendicular surfaces between adjacent edges. A designer may prefer to serve their egg with the edge of the white beveled to give their eggs a more modern, aesthetically pleasing look.
;Physicist - Demon egg
This deviled egg is designed to look like the {{w|Demon Core}} which was a sub-critical plutonium sphere manufactured during the {{w|Manhattan Project}} to investigate the properties of {{w|Critical_mass|criticality}}. The Demon Core consisted of three parts: two plutonium-gallium hemispheres and a ring designed to keep neutron flux from "jetting" out of the joined surface between the hemispheres during implosion. The set of plutonium pieces got their name from the 2 {{w|criticality_accident|criticality incidents}} that occurred when scientists were investigating this property. The first accident resulted in the death of {{w|Harry Daghlian}}. In the second incident, experimenters covered the core with two neutron reflecting shells separated only by a handheld screwdriver. (No, really.) The screwdriver slipped, causing the core to become completely covered by the neutron reflecting shell, bringing the core past its criticality limit. A large amount of radiation caused the subsequent death of physicist {{w|Louis Slotin}}. The dome of the boiled egg and the toothpick resemble the configuration of the experiment.

The demon core was also referred to in [[1242: Scary Names]].

The title texts refers to {{w|ionized-air glow}}, a blue light emitted by air submitted to an energy flux from radiation and seen during the [https://physics.stackexchange.com/a/56722 incidents involving the demon core].

For a detailed explanation of the Demon Core, Kyle Hill produced an [https://www.youtube.com/watch?v=aFlromB6SnU Youtube Documentary regarding the Demon Core. ]

==Transcript==
{{incomplete transcript}}
:[The comic consists of four variations of deviled eggs.]

:[A typical deviled egg, with half of the white part of a hard-boiled egg and a paste of yolk in a rough cone. The paste is speckled with red dots.]
:Chef
:Deviled egg

:[A deviled egg, except the paste has been flattened to be level with the white.]
:Landscaper
:Leveled egg

:[A deviled egg, except the edge of the white has bevels.]
:Designer
:Beveled egg

:[A deviled egg, except the paste is now two hemispheres, one set in (and level with) the white and the other on top with a toothpick wedged between the two hemispheres at the left egg keeping them separated. The toothpick has a small piece of blue foil wrapped around the edge of the toothpick.]
:Physicist
:Demon egg

{{comic discussion}}

[[Category:Comics with color]]
[[Category:Food]]
[[Category:Physics]]

2602: Linguistics Degree

2022-04-07T12:42:32Z

172.70.85.211: It's the words (thus wiktionary), not the things that are referred to (for the two that could be wikipediaed). And someone has described the things in-explanation, now.

{{comic
| number = 2602
| date = April 4, 2022
| title = Linguistics Degree
| image = linguistics_degree.png
| titletext = You'd think 'linguistics' would go to someone important in the field, but it's actually assigned to a random student in Ohio who barely graduated and then went into automotive marketing.
}}

==Explanation==
{{incomplete|Created by a JACKALOPE SLURPING UP A BASSOON, GRADUATED BACHELOR OF SCIENCE WITH A GUARDIANSHIP OF 'EXPLAIN' - Please change this comment when editing this page. Do NOT delete this tag too soon.}}
[[Hairbun]] hands [[Megan]] a linguistics degree, and informs her she is now "in charge of" the word '{{wiktionary|bassoon}}.' Watching this, [[Ponytail]] and [[Cueball]] compare the words they were assigned when ''they'' got their linguistics degrees, '{{wiktionary|jackalope}}' and '{{wiktionary|slurp}}' respectively. Ponytail thinks bassoon is a cool word but thinks her own is better, whereas Cueball is not satisfied with his word. A bassoon is a woodwind musical instrument with a double reed, while a jackalope is a mythical creature, a ''jackrabbit'' crossed with an ''antelope''.

It is never clarified what being "in charge of" a word entails. It could mean being in charge of keeping track of the word, or having actual authority over the use of the word, which is unlikely as normally [[1726|language use cannot be dictated by a single person]]. Also, no specific university has control over all of linguistics as far as we know, so it would require every university capable of giving people linguistics degrees to co-operate, so nobody is assigned the same word. Any well-educated member of the linguistic community will know what is being suggested is impossible hence why they are the only ones aware of how important it is.

The title text merely furthers how seemingly random the entire situation is. The word "linguistics" was assigned to a "random student in Ohio who barely graduated and then went into automotive marketing", who we can assume isn't very important to the field of linguistics.{{Citation needed}} But this means that no one is actually taking care of this important word, since it must be assumed that the student is no longer interested in linguistics.

The idea of individuals having a guardianship of an idea or concept has appeared in science fiction. For example, in {{w|Fahrenheith 451}} characters have memorised books to save them from book-burning and... spoiler-stuff.

==Transcript==
:[Megan, who is wearing a graduation cap, receives a degree which is handed to her by Hairbun. They are standing on a podium with Ponytail and Cueball standing below as onlookers.]
:Hairbun: Congratulations on the degree! Your word is "Bassoon."
:Ponytail: Oh nice! Not as cool as my "Jackalope," but still not bad.
:Cueball: You all are lucky. I'm stuck with "Slurp."

:[Caption below panel:]
:Every linguistics degree comes with one word that you're put in charge of.

{{comic discussion}}

[[Category:Language]]
[[Category:Comics featuring Hairbun]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring Cueball]]
[[Category:Characters with Hats]]

Talk:256: Online Communities

2022-04-05T09:54:59Z

172.70.85.211:

I'm gonna try and put together some sort of explanation at all for this one. A couple of things I could use help on in terms of location if people want to chip in: series of tubes within myspace; the Icy North; the islands bounded by the Ocean of Subculture, Sea of Memes, and P2P Shoals; and the location of some of the tiny islands around the map (e.g. why is the Lonely Island near friendster, Google's Volcano Fortress off the IRC Isles, etc.). Thanks in advance!! [[User:Amurfalcon|Amurfalcon]] ([[User talk:Amurfalcon|talk]]) 20:30, 10 December 2013 (UTC)
:I've found Googling some of the more obscure things and half-readable things helps a lot. It's how I got Xu Jinglei. [[Special:Contributions/141.101.99.219|141.101.99.219]] 17:03, 20 December 2013 (UTC)
The Lonely Island may be a reference to the comedy band of the same name. Shortly before this map was made they blew up after appearing on SNL. I do not know if this is relevant to its location on the map. [[User:CloverOtsworth|CloverOtsworth]] ([[User talk:CloverOtsworth|talk]]) 00:03, 8 October 2019 (UTC)

Can someone remove that stray line break before "A larger version..."? It irks me and I don't know how to get rid of it.

;bay of trolls

Might this be a reference to bay of pigs? [[Special:Contributions/173.245.48.135|173.245.48.135]] 03:58, 31 December 2013 (UTC)
:Possibly, but, well, it'd be rather speculative to include it, and there's [http://en.wikipedia.org/w/index.php?title=Special%3APrefixIndex&prefix=Bay+of&namespace=0 lots] of other "Bay of X" places, e.g. Bay of Fundy. [[Special:Contributions/141.101.99.235|141.101.99.235]] 05:46, 16 January 2014 (UTC)

; Map of the Internet

I don't know if or how much this art was inspired by this comic, but if you like 256 you'll love the [http://jaysimons.deviantart.com Map of the Internet]. ''— [[User:Tbc|tbc]] ([[User talk:Tbc|talk]]) 16:14, 6 January 2015 (UTC)''

"World of Warcraft ... based on a previously-existing RPG series" i'm not sure about this statement. The first thing that most people think about would be Warcraft but that's not an RPG series (they are strategy games) unless we are considering it so for the minimal RPG elements in Warcraft 3. Perhaps it's referencing an other series (maybe Diablo) or I'm missing something and since i'm far from an expert in either WOW or xkcd i'll let someone else decide if it should be changed (a possible minimal change would be changing "RPG series" to either "game series" or "video game series"). [[Special:Contributions/188.114.111.125|188.114.111.125]] 07:49, 5 November 2016 (UTC)

There's no explanation of the "anthropomorphic dragons" bit. I mean, I'm sure many of us know what it means (wink wonk), but some may be confused. [[Special:Contributions/108.162.246.33|108.162.246.33]] 03:31, 8 November 2016 (UTC)

what is a one-syllable way to say "practical" or "practicals"? [[User:New editor|New editor]] ([[User talk:New editor|talk]]) 07:05, 5 April 2022 (UTC)
:As a noun? I suppose "prop(s)" fits that ("a practical effect", as supposed to a special one, for something in a movie scene). Or "skill", in context of what a practical ability is. Or "test" (i.e. a "practical exam"), if you think "trial" is >1 syllable (I say 1.5!)... As a non-noun, never pluralised in any context I can think of and I'm short of 1-syllable answers, but I'm sure a visit to a dictionary+thesaurus site would help greatly. But I'm now wondering why anyone even asked this question here... Perhaps I need to reread the page for long-forgotten context? [[Special:Contributions/172.70.162.5|172.70.162.5]] 09:51, 5 April 2022 (UTC) - addendum: Ahah! The compass rose! Lemme think more about the word. Or let others find your question, equipped with an innately more at hand answer...