explain xkcd - User contributions [en]

Talk:3102: Reading a Big Number

2025-06-13T21:26:41Z

Angel:

avrayter [[User:Avrayter|Avrayter]] ([[User talk:Avrayter|talk]]) 12:27, 13 June 2025 (UTC) how do you add links

Is the final character a 6, or is it a theta? [[Special:Contributions/2A02:F6E:A36E:0:F0F1:E624:A18C:EDC2|2A02:F6E:A36E:0:F0F1:E624:A18C:EDC2]] 14:05, 13 June 2025 (UTC)
: The across line is curvy, so most likely a "6". [[User:SDSpivey|SDSpivey]] ([[User talk:SDSpivey|talk]]) 14:14, 13 June 2025 (UTC)

I would have to fire any programmer that output hex in lowercase (or put commas in triplets for hex). [[User:SDSpivey|SDSpivey]] ([[User talk:SDSpivey|talk]]) 14:14, 13 June 2025 (UTC)
: You may be firing about half of the programmers then :) I don't think there is a rule here, both forms are common, but I guess that there are holy wars to fight. [[Special:Contributions/90.73.80.27|90.73.80.27]] 15:41, 13 June 2025 (UTC)

r/unexpectedfactorial Randall Monroe, shame on you!

Surely this is just one line of a CSV file... [[Special:Contributions/86.144.197.52|86.144.197.52]] 15:51, 13 June 2025 (UTC)
: That is actually a strong justification!! I'd like to see the headers, tho xD
: Also an unusual and possibly broken CSV. 000 values are uncommon (they are usually just 0), and the " (or <nowiki>''</nowiki>) may be used for quoting. There is no way to tell how it will parse as CSV is not a well defined format. There is a standard, RFC 4180, but it is not always followed. [[Special:Contributions/90.73.80.27|90.73.80.27]] 18:03, 13 June 2025 (UTC)
: could be CSFWV = comma-separated-and-fixed-width-values where the values are also 0-padded so that it works in both their CSV parsers and their fixed-width parsers for compatibility. [[Special:Contributions/74.202.210.170|74.202.210.170]] 19:19, 13 June 2025 (UTC)

Remember, kids: always end your strings with a NUL [[Special:Contributions/93.36.184.28|93.36.184.28]] 15:56, 13 June 2025 (UTC)

By my reckoning, if you set a 78RPM record playing, and waited for it to have spun the amount of arcseconds specified (by that point in the "number", you'd be waiting a tad over 7 ''billion'' times the current age of the universe. I might have erred by a magnifude or three (forgot if I divided number of days down to get number of years, etc, and I much prefer to work with Long Scale billions, so maybe I did it slightly wrong when working with the inferior kind), but... Well, it doesn't really matter ''quite'' so much, I suspect. ;) [[Special:Contributions/82.132.246.216|82.132.246.216]] 17:11, 13 June 2025 (UTC)

I remember, years ago, seeing calculators using single quotes as thousands-separators. But never a double-quote. Interestingly, the C++ standard (as of the 2014 release) permits single-quote characters as an arbitrary digit separator for numeric literals. They are ignored by the compiler, but can be useful for making code more readable (e.g. every 3 decimal digits or every 4 hex digits). See also https://en.cppreference.com/w/cpp/language/integer_literal.html. [[User:Shamino|Shamino]] ([[User talk:Shamino|talk]]) 19:02, 13 June 2025 (UTC)

Apart from the quotation mark, this still matches [my hex number regex](https://stackoverflow.com/a/76696505/6743127). [[User:Fabian42|Fabian42]] ([[User talk:Fabian42|talk]]) 19:22, 13 June 2025 (UTC)

Oooh, looks like an IPv9 address, but they're using ',' instead of '🕴️' to separate triplets for some reason. The clusters with an extra leading 0 indicate that they're in octal instead of base64. -- [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 21:26, 13 June 2025 (UTC)

Talk:3063: Planet Definitions

2025-03-14T18:12:04Z

Angel:

The one currently posted has Pluto highlighted in the second box and not highlighted in the first box. Too hard to tell if it's trolling or a genuine mistake. :-D

And the first one also has a moon hilighted instead I think?? [[Special:Contributions/162.158.126.5|162.158.126.5]] 15:59, 14 March 2025 (UTC)

:Was about to write the same. The coloring in the first two lines arund Pluto seem wrong (or mistankingly switched). --[[Special:Contributions/172.71.222.246|172.71.222.246]] 16:17, 14 March 2025 (UTC)

the coloring of Pluto does look inverted in the two first lines, they probably got switched by mistake--[[Special:Contributions/172.71.90.43|172.71.90.43]] 17:28, 14 March 2025 (UTC)

This, this is the hill I will die on. I was radicalised by this paper: [https://arxiv.org/abs/2110.15285 Moons Are Planets: "Scientific Usefulness Versus Cultural Teleology in the Taxonomy of Planetary Science"]
In short; planets are what planetary scientists study. Round things with the *good stuff*: atmospheres, oceans, volcanoes (of lava or water ice) (see diagram page 53).
Pluto, Titan, Ceres, Io and Europa are all in the sweet spot where you're not so small you're just a lump of rocks who happen to be stuck together into a lump, and not so large you're just a mostly undifferentiated mass of fusing hydrogen/helium plasma.
And it's consistent with our pre-20th Century understanding of what a planet is, whereas the IAU definition is trying to preserve 19th Century astrology. An amazing read and a strong recommend for anyone who cares about this subject. [[Special:Contributions/172.69.79.138|172.69.79.138]] 16:45, 14 March 2025 (UTC)

Does this sort of count as pi-related for pi day? [[User:TomtheBuilder|TomtheBuilder]] ([[User talk:TomtheBuilder|talk]]) 17:04, 14 March 2025 (UTC)
:he doesn't do themed comics anymore 😔 [[User:CalibansCreations|'''Caliban''']] ([[User talk:CalibansCreations|talk]]) 17:12, 14 March 2025 (UTC)

I was somewhat disappointed to get to the end of the table without seeing either an astrology or Sailor Moon joke. -- [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 18:12, 14 March 2025 (UTC)

Talk:3048: Suspension Bridge

2025-02-08T19:18:49Z

Angel:

What if a car doing one of the fun jumps lands on a car that didn't do a fun jump? Should we mandate that every car does a fun jump for this reason (and yay, fun jump!)? [[Special:Contributions/198.41.227.115|198.41.227.115]] 22:08, 7 February 2025 (UTC)
: Radar speed management, vehicles are only let on the bridge if their expected land point is between the vehicles around them. [[Special:Contributions/172.68.55.80|172.68.55.80]] 22:48, 7 February 2025 (UTC)
:Carrot/stick question. If they do a jump, they get their toll refunded on the far side of the bridge. Maybe give them double refund if they do a flip. [[Special:Contributions/172.69.246.135|172.69.246.135]] 04:07, 8 February 2025 (UTC)

Do suspension bridges still work when built this way? Those pilings look much easier to sway to me. Maybe they are just buried a little more securely. [[Special:Contributions/172.68.55.80|172.68.55.80]] 22:48, 7 February 2025 (UTC)
:Yep! With "classic" suspension bridges (like the Golden Gate Bridge), there is no fixed connection between the deck and the towers. With differring loads and temperatures the deck can move up and down about 30cm at tower level (and almost 2 netres at midpoint). Some modern bridges do ise a fixed connection or hinge between deck and tower. [[User:IIVQ|IIVQ]] ([[User talk:IIVQ|talk]]) 12:58, 8 February 2025 (UTC)

This looks a lot like a {{w|stressed ribbon bridge}}. [[Special:Contributions/172.69.64.132|172.69.64.132]] 22:59, 7 February 2025 (UTC)

This ''exact'' proposal, the [https://poly-bridge-2.fandom.com/wiki/Dangling_Road 'dangling road'], is actually The Meta in Poly Bridge 2. Poly Bridge 3 tried to tweak the numbers to make this strat less effective, but a variant of it continues to persist to this day. (This probably goes in the trivia section, because it seems like Randall came to this concept from first principles.) [[Special:Contributions/172.71.151.65|172.71.151.65]] 01:07, 8 February 2025 (UTC)

:I came to the comment section to see if somebody already said that. The other thing I would have said is I wonder if RCE reads XKCD… if not, I think someone should ask him to do a blind reaction to this comic. I'd love to see his response :) -- [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 19:18, 8 February 2025 (UTC)

It's funny to me, there's a level in Jak II for the PS2 that's literally just this idea: for whatever reason the city's central palace is held up by five suspension bridge-esque wires, and one level has you crawling along wire #4 to get inside the palace (the catch? The wires are covered in security robots) [[Special:Contributions/172.71.159.7|172.71.159.7]] 01:54, 8 February 2025 (UTC)

I like the fact that vehicles are clearly on flexible cables, not some rigid material formed into a catenary shape. There's a truck between the two towers that is visibly depressing the cable it's riding. [[User:Nitpicking|Nitpicking]] ([[User talk:Nitpicking|talk]]) 03:57, 8 February 2025 (UTC)
:Happy happy joy joy. {{w|Tacoma_Narrows_Bridge_(1940)|No dogs allowed on this bridge}}. [[Special:Contributions/162.158.42.87|162.158.42.87]] 04:35, 8 February 2025 (UTC)

If you add a downward pressure to a rope that's significantly stronger than it's normal tension, you end up with a [https://en.wikipedia.org/wiki/Catenary#Suspension_bridge_curve parabola] [[Special:Contributions/162.158.137.212|162.158.137.212]] 17:47, 8 February 2025 (UTC)

Talk:3028: D&D Roll

2024-12-25T08:50:25Z

Angel:

Dice comic. [[Special:Contributions/172.69.22.181|172.69.22.181]] 04:09, 24 December 2024 (UTC)

And in a pinch, d4s can be used as caltrops. --[[Special:Contributions/172.71.147.210|172.71.147.210]] 05:22, 24 December 2024 (UTC)

I am willing to bet good money that every D&D comic that features the game's name inside the title will either [[explain_xkcd:Community_portal/Admin_requests#RSS_Feed_Broken|break the RSS Feed]] or [[User:TheusafBOT]]. '''[[User:42.book.addict|42.book.addict]][[User talk:42.book.addict|Talk to me!]]''' 10:17, 24 December 2024 (UTC)
:Ah, that's why we never got a good explanation about the one with the D&D players dialling in over AT&T to roleplay S&M sessions while eating M&Ms and drinking A&W. [[Special:Contributions/172.70.90.4|172.70.90.4]] 13:22, 24 December 2024 (UTC)
::Is this the same issue that causes the page title to be rendered as "D Roll"? [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 08:50, 25 December 2024 (UTC)
If the D20 is large enough (>30 cm?) and its full volume is made of a heavy metal or alloy, like iron, steel or gold, one can just use it as a "blunt weapon" (that is, the weight is used against the enemy). [[Special:Contributions/172.70.39.208|172.70.39.208]] 17:01, 24 December 2024 (UTC)

Second XKCD on D&D in a few months... I think some cartoonish picked up a new hobby recently. [[User:Ralfoide|Ralfoide]] ([[User talk:Ralfoide|talk]]) 18:25, 24 December 2024 (UTC)

Talk:2901: Geographic Qualifiers

2024-03-02T12:48:39Z

Angel:

Related to this comic [[1368]]

According to Atlas Obscura, the world's largest squirrel statue is 14 feet tall, in Cedar Creek, Texas. https://www.atlasobscura.com/places/ms-pearl-the-worlds-largest-squirrel-statue [[User:Nitpicking|Nitpicking]] ([[User talk:Nitpicking|talk]]) 03:06, 2 March 2024 (UTC)

There are two African families of squirrels that have range into the Southern Hemisphere, the {{w|Xerini}} and {{w|Protoxerini}}. Yes, I checked Wikipedia. [[User:Nitpicking|Nitpicking]] ([[User talk:Nitpicking|talk]]) 03:10, 2 March 2024 (UTC)

Australia has large number of “Big Things”. These are big sculptures / novelty architecture that are scattered over the country. These include things like the Big Cow, The Big Penguin and the Giant Koala. The Koala at 14 meters high is bigger then the fictional squirrel statue.

Since there may be as many as 600 of these things across Australia, the qualification is not as odd as it may sound at first. (https://en.wikipedia.org/wiki/Big_things_(Australia) )

Including the pedestal, the statue's height is approximately six Cueballs, which means Cueball is over ~6 2/3 feet tall. But it would make more sense to me for the record to exclude the pedestal, as the pedestal is not a likeness of a squirrel or a skateboard; in that case, Cueball is well over 10 feet tall.[[Special:Contributions/172.71.150.213|172.71.150.213]] 06:13, 2 March 2024 (UTC)

“Why, that’s the second biggest monkey head I’ve ever seen!” - [[Special:Contributions/172.69.6.195|172.69.6.195]] 08:28, 2 March 2024 (UTC)

Someone should probably link Grice's maxims here. https://en.m.wikipedia.org/wiki/Cooperative_principle
[[Special:Contributions/172.68.26.2|172.68.26.2]] 09:37, 2 March 2024 (UTC)

I once heard a friend, commenting after a rather chaotic pub crawl, "That's the most drunk I've ever been while off duty." It was part of a running joke about how seriously his employer took their NDAs; he used to act like any information even remotely related to his job (such as whether he'd ever been blackout drunk at work) was top secret. Other examples included "I've never seen 'Groundhog Day' while off duty before" or "This is the best bbq chicken I ever tasted while off-duty" -- [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 12:48, 2 March 2024 (UTC)

Talk:2773: Planetary Scientist

2023-05-09T11:32:57Z

Angel:

https://xkcd.com/1258/[[Special:Contributions/172.70.38.127|172.70.38.127]] 02:14, 9 May 2023 (UTC)

The latest edit to this page adds a name for the clerk, "Rumplesoyskin". Is this an in-joke I'm not familiar with, or vandalism? [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 11:32, 9 May 2023 (UTC)

Talk:2753: Air Handler

2023-03-24T09:15:31Z

Angel:

I called the device an Air Handler in the transcript, but should we change that? [[User:E'); DROP TABLE users;--|E'); DROP TABLE users;--]] ([[User talk:E'); DROP TABLE users;--|talk]]) 5:11, 23 March 2023 (UTC)

"It is not particularly usual to directly monitor the number of bees in an air-stream" - understatement of the week :o) [[Special:Contributions/172.68.210.41|172.68.210.41]] 05:46, 23 March 2023 (UTC)
:And statements like these are the reason why explainxkcd is so great :D [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 11:06, 23 March 2023 (UTC)

I think the transcript is complete, will be deleting unless someone proves otherwise in four hours. [[User:E'); DROP TABLE users;--|E'); DROP TABLE users;--]] ([[User talk:E'); DROP TABLE users;--|talk]]) 11:50, 23 March 2023 (UTC)

Some of these parameters have an ideal range (temperature, humidity, pressure), but others should be minimized (dust, smoke, odors, number of bees). Well, not into the negative range, but I think you'll understand me! ~ [[user:megan|Megan]] she/her [[user talk:megan|talk]]/[[special:contribs/megan|contribs]] 23:44, 23 March 2023 (UTC)

:Well, if there are config files, you can just set the range to be from 0 to 0. Then again, this is Black Hat... [[Special:Contributions/198.41.238.10|198.41.238.10]] 03:15, 24 March 2023 (UTC)

This immediately got me wondering how it would deal with excess bees. It's not like you can filter them out as they pass through the device. It'd have to launch some kind of tiny flying robot to attack them or something. And then if there's too few bees, well… Let's just say I was pretty confident that the title text would use the word "drones" at least twice. -- [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 09:15, 24 March 2023 (UTC)

Talk:2675: Pilot Priority List

2022-09-22T09:16:29Z

Angel:

Who else googled 'words ending with ate' and had an extra chuckle at what could have been? My favorites: circumnavigate, excommunicate, disarticulate. [[Special:Contributions/172.70.175.30|172.70.175.30]] 05:08, 22 September 2022 (UTC)
:I was disappointed not to see 'conjugate' on the list. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 09:16, 22 September 2022 (UTC)

How about 'exterminate'? [[User:MarquisOfCarrabass|MarquisOfCarrabass]] ([[User talk:MarquisOfCarrabass|talk]]) 05:13, 22 September 2022 (UTC)
: My thoughts exactly! (Note: I moved your signature up) [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 07:19, 22 September 2022 (UTC)

What categories does this kind of list belong in. I guess Randall has made similar lists before? Should there be a category for this kind of comics, that do not easily belong in any other. I added Food category because of the cake, but that was just for the title text... Also if anyone has a better link to a good picture of a layered cake, as [https://3brothersbakery.com/product/wedding-white-chandelier-tier/ the one currently] in the title text explanation please add that. But it is a good picture resembling the airspace diagram inverted very much --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 08:53, 22 September 2022 (UTC)
:I can see that for instance this comic with a list, [[1957: 2018 CVE List]], has been added to the [[:Category:Charts]]. In that case this comic should also, but to me this is not really a chart. Maybe a Category:Lists would work? Should it be "lists" rather than "list"? Not native English speaker. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 08:56, 22 September 2022 (UTC)
::Other list comics (Feel free to add to mine without signature):
:::[[2525: Air Travel Packing List]]
:::[[1011: Baby Names]]
:::[[1957: 2018 CVE List]]
:::[[887: Future Timeline]]
:::[[]]

Afterate - enjoy a waffer-thin mint.[[Special:Contributions/172.70.162.155|172.70.162.155]] 09:07, 22 September 2022 (UTC)

Countdown in header text

2022-05-04T00:03:44Z

Angel: Undo revision 232681 by X. K. C. D. (talk) - reverting vandalism

{{comic
| date = January 10, 2022
| title = Countdown in header text
| image = Countdown_in_header_text_full_animation.gif
| before = The [https://www.explainxkcd.com/wiki/images/2/21/Countdown_in_header_text_clock_migration.gif countdown] lasted 21 days and only the last image appeared in the header text after the end on 2022-01-31. It will also not be a permanent part of the header, but be removed once the xkcd Header text is changed again.
| ldomain = www
| lappend =
| extra = yes
}}
{{TOC}}

==Explanation==
*On January 10th 2022, [[Randall]] added a countdown in the top right corner of the [[xkcd Header text]] on {{xkcd}}.
**It turned out that it was a countdown to the reveal of Randall's new book [https://xkcd.com/what-if-2/ what if? 2] which was announced at the end of the countdown.
***The full title: What If? 2: Additional Serious Scientific Answers to Absurd Hypothetical Questions
***The Hardcover version is released September 13, 2022.
***A follow up on his first book based on his blog [[what if?]]
*The comic [[2575: What If? 2]] was released moments after the counter reached zero.
**A comic entirely devoted to promote the book.
***And then the [[xkcd_Header_text#2022-01-31_-_What_if.3F_2|header changed]] to promote the book directly.
*The counter began while the comic [[2565: Latency]] was up.
**First the xkcd Header text was [[xkcd_Header_text#2022-01-08_-_Back_to_standard_text|changed back]] to the [[xkcd_Header_text#Header_text|standard text]] for the first time in almost three years:
***xkcd updates every Monday, Wednesday, and Friday.
**But already while this Friday-comic was still up on the following Monday the [[xkcd_Header_text#2022-01-10_-_Standard_text_with_countdown|countdown]] was added.
***This was thus up when the Monday comic [[2566: Decorative Constants]] was released, drawing more people to the xkcd page.
*The first [[#Archived Versions|archived version]] from [https://web.archive.org/web/20220110183238/https://xkcd.com/ 2022-01-10] read 20d 20h 27m.
**It looks like it started on [https://munvoseli.github.io/xkcd-countdown/ 01-10 17:00 UTC].
***At that time it would have read 20d 21h 59 min. Just two hours and 1 minute short of 3 weeks.
*The countdown reached zero on Monday 2022-01-31 at 15:00 (3:00 PM) {{w|UTC}}, or 10:00 AM in Boston, Randall's home town.
**Seconds was added for the last 10 minutes making the countdown end exactly at 15:00 UTC
***When the seconds counter replaced the day counter at that time the box started [https://www.explainxkcd.com/wiki/images/6/64/Countdown_in_header_text_last_minute_wiggling.gif jiggling around].
*The second day of countdown on [https://web.archive.org/web/20220111153818/https://xkcd.com/ 2022-01-11] a diagonal black bar appeared in the lower left-hand corner of the countdown box and started to move further into the image on following changes to the [[#Images|image]].
**This development called for the creation of this dedicated [[Countdown in header text]] page.
**The line had already moved further into the image at this time, but the latest version will never be available in the web archive.
***This development is reminiscent of the huge comic [[1190: Time]].
***The images was uploaded [https://munvoseli.github.io/xkcd-countdown/ here] on munvoseli's page where comparison of two images and an animation can be seen.
*During the three weeks this page was used to collect [[Countdown_in_header_text#Theories|theories]] of both the image and the countdown.
**Since these are now all either proved wrong or wright, they are only left here below to document how much people though about it.
***They have been collapsed, to not take up too much space, but can be accessed by pressing the link.
*Randall has previously made a comic simply called [[1159: Countdown]].
**However, in that the roles are reversed.
***There we know that the countdown is for (Super Volcano) but not if it will happen soon or very much later.
***Here we know when, and it is rather soon, but not what.

===Blow up by Amazon===
*The day before the countdown reached zero a user found out that:
**'''Amazon revealed the news a day too early.'''
***The book could be found on Amazon on [https://web.archive.org/web/20220130094958/https://www.amazon.com/dp/0525537112 2022-01-30] with the book cover clearly showing the part of the image shown in the box. And thus the surprise was lost on those using this page.
***Here is the page with [https://www.amazon.com/dp/0525537112 what if? 2], the above link shows that the page existed the day before the count down ended.
**A shame for Randall and his fans.
***Although some of his fans had invested a lot of time in trying to solve the puzzle before the countdown ended and were excited by the discovery.

==Images==
*The 136 frames that made up the countdown have been put on this separate page: [[Countdown in header text/images]].
**The images was mainly downloaded [https://munvoseli.github.io/xkcd-countdown/ here] on munvoseli's page.
***On that page it is possible to compare two images, chosen between those released, on that page!
***From 2022-01-14 it has also been possible to see an animation.
****But after the last frame was released a user on this page has kindly provided a gif animation we could add to the top of the page.
**See more details at the top of the image page.
*Other images that also show the clock, compare two images, or show how the page actually looks have been moved to this other page: [[Countdown in header text/other images]].
*After the first thirteen different frames, it was noted that not only did the first three empty frames looks the same (because the diagonal bar was not in the frame yet), but the seventh and the eighth frame where also the same, even though the bar had already begun moving across the frame from the fourth. This could have been on purpose but could also be a mistake.
**However, the images that look the same all have individual addresses on the xkcd server. See more here [[Countdown in header text/images]]
***Later for instance frames 91 and 92 also seem to be exactly the same. Also frame 92 did not upload as part of the roughly four hour schedule, but between two frames that are part of the regular schedule.
***And the second to last frame 135 was also the same as 134, even though they had different names all 136 frames.

===Extra pages for images===
*Two pages has been made to collect images of the countdown:
**One for all the 136 frames:
***[[Countdown in header text/images]]
**And one for other images showing also the countdown clock, and comparison between images etc.
***[[Countdown in header text/other images]]

==Ongoing image description==
*The counter [https://www.explainxkcd.com/wiki/images/2/21/Countdown_in_header_text_clock_migration.gif moved upwards] during most of the countdown, to cover less of the revealed image. See more [[Countdown_in_header_text/other_images#Changing_counter_position|here]]
*Here is a description made as the image progressed, and no one knew what it would turn in to, until the very last few days.
** Frames 1-12: A diagonal line.
** Frame 13: A curve seems to begin at the top left of the line.
** Frame 18: The curve connects the diagonal line with a horizontal line.
** Frame 27-28: A new line appears in the bottom left corner.
** Frame 40-42: The new line turns out to be connected to the horizontal line, forming a corner which is not attached to any other line.
** Frame 49: The "camera movement" direction changes, while the object is still moving upward it stopped moving towards the left side, moving towards the right instead.
** Frame 54: A slight upward curve seems to appear in the right line, the left line seems to have a small bend downwards, though that could at that point just be a straight line that Randall drew without a ruler.
** Frame 60-62: A new line appears in the bottom right corner, it turns out to be a continuation of the first original line which curves upward and has a positive slope at that point of the picture, between about 2 o'clock and 3 o'clock. The downward bend of the left line continues on straight in the same direction, it was probably an intentional bend and not an irregularity in drawing a straight line by hand.
** Frame 63: In the minimum of the right curved line a new line starts appearing, way thinner than the others (which were up to this point all rather part of one line) and going slightly downwards and very much to the left, at an angle somewhere between 8 o'clock and 9 o'clock.
** Frame 67: A possible feature becomes visible at the bottom edge of the image that might resolve the exact nature of the (currently presumed) aircraft, e.g. which particular aerodynamic surface we have been seeing and thus from which particular orientation we are viewing it.
** Frame 68-72 makes it clear this must be an aircraft by showing windows and a door and clearly the tail fin. As late as frame 69 some people argued that the tail fin could have been a wing.
** Frame 73-83 brings a horizontal stabilizer into view.
** Frame 87-89: A new curved line appears on the underside of the (presumed) aircraft, so there either is something behind it or it might not be an aircraft.
** Frame 96-99: An arc is coming into view in the upper right corner, likely the top edge of a cloud.
*** Turned out not to be a cloud.
** Frame 101-106 seems to be some kind of radar on top of the plane, like the one on {{w|Boeing E-3 Sentry}}. Or alternatively this plane is hanging beneath another plane. Not looking at all like {{w|Spaceshiptwo}}, but something similar, which could make this plane a spaceplane?
** Frame 106-114 a new element of the image appears on the right side, it could be the end of a wing. The arch no longer looks like a radar. Could be the tail of a Dinosaur or the cape of someone riding the airplane...
*** a cape is unlikely as it would probably be drawn to flap in the wind. The other element does appear to be a wingtip
*** Could it be [[Cory Doctorow]] flying with the airplane, but much closer to the 'camera'?
** Frame 115-121 makes it clear that the newest addition at the bottom right is the wing tip of the plane. The black curve above the plane still mostly looks like a tail as on a dinosaur or dragon. Could also be a tentacle. Either from an [https://www.explainxkcd.com/wiki/images/b/b5/1608_1038x1094y_Giant_octopus_in_Destroyer.pngv octopus] or from and alien like in [[2572: Alien Observers]]. Of course it could also be a cape, but seems too thick at the end...
** Frame 124 shows something beneath the plane, but already in 125, that makes one of the largest jumps between pictures so far, this is clearly one of the wheels on the landing gear. Also the hind leg of the Dinosaur whose tail has been visible long time is coming in to view. Not certain yet it is a dino (probably a velociraptor), but the leg makes it the number one candidate.
** Frames 126-127 almost confirm the dinosaur theory.
*** And at this time someone spotted the new What if? 2 book on Amazon and it is the Tyrannosaur from the [[what if?]] blog that is now eating a plane rather than being lowered into the Sarlac.
** Frame 134 reveals the last part of the plane, so now the entire plane and T-rex is visible. This was about 6 hours before the countdown ended.
** Frame 135 is identical with 134!
** About ten minutes before the countdown ended the image started to wiggle and as predicted seconds also came in, leaving out the day part of the counter.
** Frame 136 came just after the countdown ended, turning the background red, as it is on the front cover of the book adding the title what if? 2 in white text beneath the plane, which as now been moved to the top of the image since the overlaid count down is now gone.

==Theories==
*'''Amazon revealed the news a day too early!''' - it is Randall's new book [https://www.amazon.com/dp/0525537112 what if? 2] that will be announced at the end of the countdown.
**So it is a book announcement, and the picture is Tyrannosaur eating a plane while in flight.
*Here below are the different theories for what the countdown was for and what the picture was going to reveal from before it was clear what it was.

===The picture===
*Theories about the picture:
**One of the very early theories got it right:
***The second line makes it look somewhat like the tail fin of an aircraft.
'''Click to expand for more theories:'''
<div class="mw-collapsible mw-collapsed leftAlign" style="width:100%">
**From 2022-01-21 it became certain that it was a plane! Passenger plane. Door and windows are visible.
***From 2022-01-22 it became clear that it was the rear end, so it was a tailfin that came into the panel to begin with. Up til the day before it was still a bit uncertain if it could have been a wing.
*** from 2022-01-24 a bottom line has appeared which doesn't fit well with a 'standard' airliner. perhaps the image is deliberately misleading (eg will transform into something else)
*** From 2022-01-26 something looking like a radar like the one on a {{w|Boeing E-3 Sentry}} began emerging in the top right corner.
*** From 2022-01-28 it looks like an elephant's trunk to me.
**What will this lead up to - theories about this.
***It could be an airplane with a banner like in [[1355: Airplane Message]].
****That would very soon be clear as the bottom part of the rear end seems to be coming into view during 2022-01-24, if the direction does not change again.
*****This is now ruled out, since the plane is clearly not towing a banner.
***It could end up landing in a city, perhaps with a skyline pinpointing where Randall will be or move.
****However, unlikely to manage this in real life as the count down ends.
****Also, very unlikely (1 in 60, or even 1 in 3600) that such a landing would occur exactly on the hour.
*****But it could also just be the time when he announces he has moved...
***Maybe Cueball will make a parachute jump, and Cueball could represent a real life Randall, as this could in principle be timed very accurately.
****This is something you would schedule a month or more ahead, want to tell people about in advance, want to make a big deal about on your website, is not quite as bizarre as zero-G and probably more fun {{citation needed}}, could be done with an adventurous wife, explains why it’s the tail of the plane in the image, and (assuming no mechanical, medical, or meteorological problems, a safe assumption), might go something like “on my mark, it’ll be 9:59:56 A.M. in Boston... mark. 3, 2, 1, JUMP!” Maybe it’ll be just Cueball/Randall, but could more likely include Megan representing his wife.
****However, it could very easily be that the weather in January could foil the attempt, or at least the timing.
****The plane appears to be a commercial jetliner, though, rather than the small prop planes used for parachute jumps. Unless, of course, Randall is revealing his real identity has been Wesley Snipes all along
****The plane appears to have its landing gear down, which rules out a parachute jump.
*****At frame 124 it is a bit early to say that the dot beneath the plane is the landing gear, but from 125 it became clear. Also seems like the leg of the dino on the plane has come into vies. The below was written before number 125 came out.
*****Landing gear implies that the aircraft is either taking off or landing, and judging by the plane's nose-up attitude, most likely taking off. Therefore, assuming that the plane is in fact shown seconds after rotation (possibly still on the ground), there is a possibility that the black object could be an airport fixture, perhaps a wind sock in the foreground?
******Well, forget I said that. It's a dinosaur apparently.
*** Perhaps the new item on top of the plane is the tail of a dinosaur? perhaps like the one on the cover of "what if..." book. perhaps it's a new book?
*** There are two flights originating in Boston departing at 09:59 on 1/31/2022: Spirit NK433 to Orlando Florida and Delta DL5696 to Washington D.C.
***Frame 101-106 seems to be some kind of radar on top of the plane, like the one on Boeing E-3 Sentry. Or alternatively this plane is hanging beneath another plane. Not looking at all like Spaceshiptwo, but something similar, which could make this plane a spaceplane?
**** Predicting dinosaur
***** Cross-referencing it with the cover of ''What If?'', this does seem like a xkcd-style dinosaur tail. It could represent Randall, or xkcd as a whole, going somewhere. Or it could just be the cover of a new book.
******Yep, it's a dinosaur.
**** Revising my prior theory: It now looks very much like another aircraft (similar to theory below) but not part of the main aircraft, I think. I would guess it is either an improbable mid-air encounter (like a passenger jet and an ultra-lite) or an equally improbable "launch" of something from the jet (again like an ultra-lite or some other less common or even fictional craft.)
**** Maybe the torch of the Statue of Liberty?
**** The black wave looks like a superhero cape
**** the white element overlapping the fuselage could be the start of the wing-tip these fold up at the ends of many modern aircraft, could mean aircraft is banking left.
***Frame 107-121 the right wing of the plane moves into view. It is still unclear if the black curve is a tail, a cape or a tentacle. But seems like it cannot be another aircraft.
***Has now been resolved.
**Maybe it will be the entire book, or at least include the text 'what if? 2', and that more rapid zoom-out will happen during the last minutes.
***Since the entire plane is revealed with at least two more possible updates, even in 4 hours schedule, something new may certainly be expected to occur before the end of the countdown. This written after frame 134 that revealed the front of the plane.
*The XKCD store currently reports "will be opening soon" [https://store.xkcd.com/] perhaps any announcement will be simultaneous with a store re-launch.

====Early theories====
*Many early theories were generated before the picture was decisively revealed to be a plane...
*It seems after two days and 12 pictures like either something is moving into the frame or that it is a zoom out from a white area of a large picture. Maybe it is the arm of Cueball that will come into view.
*The second line makes it look somewhat like the tail fin of an aircraft.
**Or the wing of an aircraft (left if looking down at it). Perhaps the plane is towing a banner that will fly through the frame.
***After almost a week this looks like the most promising suggestion so far. Now that the direction of the camera movement has changed, we might get to see the rest of the aircraft soon.
****From picture 63, it more and more seems like it was the tail fin of a plane and now we can see the body.
*****It's almost certainly the tail (and now a bit of the rear fuselage) of an aircraft.
******It could just as easily be the left wing and part of the fuselage (showing windows on the right side of an airliner), with the tail fin out of view to the rear, as being the tail fin from an angle where the left wing is out of view behind the fuselage.
*******judging by the relative size of the (presumed) windows, I think it's more likely to be the left wing than the tail fin.
*******Based on the way planes are drawn in [[1868: Eclipse Flights]]. [[1355: Airplane Message]] and [[1669: Planespotting]], plane wings have a point on their edge and tail fins have a flat side, and (if a line is present) a thick line separates wings from the body, whereas thin lines or no lines separate tail fins, so this is a tail fin.
*******In the bottom left there appears to be the top part of a horizontal stabilizer, implying this is the tail.
********It’s a tail fin, that’s finally clear, but that’s the underside of the stabilizer. Which means this would be the best angle to view Cueball/Randall parachuting out of that door, something that would be predictable to the exact minute (barring all kinds of things that could go wrong).
*******Appears to be a door to the left of the windows
*******It could be an airplane with a banner like in [[1355: Airplane Message]]
***Tail of a space shuttle, perhaps?
****While I think Randall would've also drawn in the signature black part of the rudder, the shape fits perfectly
****Timing is close (though not exact) to the Columbia disaster anniversary (2003-02-01 1359 UTC)
***I'm thinking the tail of a Zeppelin.
****Although those normally have longer tail fins.
*Maybe it is some kind of vehicle rolling into frame, like a car?
*Or the word xkcd? (or xkcd 2?)
*Could have been "Hangman", but it looks like it's zooming in on the diagonal instead of continuing to make a gibbet.
*With the new second line appearing in the corner as of frame 28 it looks like it's definitely zooming out of an image. It looks like it could be someone's arm in a running position.
*I think it could also be two legs of a reclining stick person.
*The lines suggest a shark fin and the movement would suggest it swimming across the frame.
**If it was a shark fin, then the most likely candidates would be the first dorsal fin and the pectoral fin, but both end in points rather than edges like in the pictures of the header puzzle. An aircraft tail fin still seems most likely.
*Maybe it's a two-dimensional shape viewed from a weird angle?
**Like a rectangle viewed from a floating, tilted perspective
**Or the top of the k in xkcd
**Or a boat dock?
*The r/xkcd subreddit produced some early theories :
**Cueball's arm
**The letter D, as in "The End"
**A spider's web, in reference to comic 1688
***With the airplane revelation, this reference turned into a meme in the subreddit, where users tried to justify the presence of an airplane shape inside a bigger-scope spider picture
***More generally, "spider" is now jokingly used nearly each time in place of "airplane" during discussions on the sub
****For example, the final image is generally described as "a dinosaur eating a spider"
***Some joke theories included:
****A giant spider flinging airplanes from the sky, as a new potential "What If?"
****The lines are a web and the apparent windows the eyes of a giant spider
****The airplane is a complex-looking spider leg, and 8 of them form a spider
***Another redditor made the airplane part of a dragon's head
</div>
 

===Countdown===
*Theories about the countdown:
**One of the early theories got it right:
***Randall's next book, either the countdown is counting down to the start of promotion or it is released when the countdown ends.
'''Click to expand for more theories:'''
<div class="mw-collapsible mw-collapsed leftAlign" style="width:100%">
*Several have already been mentioned in the discussion:
**Maybe Randall is going on vacation?
**As of now - 22-Jan-2022 7am PST - the countdown disappeared from some users browser. Temporarily (perhaps to make the image cleaner?) or permanently? The countdown was back up soon after. probably a glitch and maybe not for all places or browsers.
**Randall's next book, either the countdown is counting down to the start of promotion or it is released when the countdown ends.
***Usually Randall has made month long [[:Category:Book promotion|book promotions]] before release. So if it is the release day it is a new way to do it. But he will get a lot of attention. If it is just the start of promoting it, people might get disappointed…
****For instance he began promoting his [[xkcd_Header_text#2015-05-14_-_New_book_Thing_Explainer|new book Thing Explainer]] in the header text. That was in May 2015 and the book was first released [https://blog.xkcd.com/2015/05/13/new-book-thing-explainer/ late November 2015]. Most of this time the header text was promoting the book.
***The day before the announcement a user posted a link in the discussion with a book listing for [https://www.amazon.com/dp/0525537112 what if? 2] on Amazon showing more or less the picture revealed at this time, thus ending the debate as to what the image and the countdown was for.
**{{w|James Webb Space Telescope}} (JWST) going into orbit about L2 {{w|Lagrange point}}.
***Randall has already made several comics about the telescope. The latest [[2564: Sunshield]] was released just five days prior to the countdown was started.
***But the telescope will not reach the point but rather go into a large orbit around it, so a precise timer counting down to it seems a bit farfetched.
***On NASA's page on JWST it seems like it will [https://www.jwst.nasa.gov/content/webbLaunch/deploymentExplorer.html#25 go into orbit] 29.5 days after its [[December 25th Launch]], on Christmas Day, so it should have already started the orbit by the 23rd or 24th of January - 8 days before the countdown.
***Also No based on the image.
**{{w|Lunar New Year}}
***In China it starts on February 1st and a [https://yourcountdown.to/chinese-new-year countdown for China] is 8 hours behind.
****The South Korean time zone is UTC+9, hence 14:59 UTC = 23:59 in South Korea, one minute to Feb 1.
*****But it's weird if Randall that has basically never mentioned this holiday suddenly makes a three week countdown for it, and why choose South Korea when most would think of China in this context…?
**Randall will stop making xkcd (Goodbye in the image).
***Hopefully not.
****Agreed, {{tvtropes|PoisonOakEpilepticTrees|to be avoided}}
***It might be a temporary stop (hiatus).
**[https://nationaldaycalendar.com/backward-day-january-31/ National Backward Day]
***This is not a day mentioned on Wikipedia at the time of release of the countdown, so seems unlikely.
**Maybe it will be an announcement of xkcd 2, a new and improved version for… some reason?
***Seems unlikely…
**{{w|Black History Month}}. The {{w|Greensboro sit-ins}} started on Feb 1 1960. Black History Month also begins on February 1st, also in 2022.
***But this countdown stops early on January 31st so seems unlikely.
***However, before changing the Header recently it was about [[xkcd_Header_text#2020-06-03_-_Black_Lives_Matter|Black Lives Matter]] for more than 1.5 years, first ending on December 20th 2021, less than a month before the countdown began. In between that there was a short Christmas sale reminder until a week into 2022. So it could just be another way of reminding of us the issues faced by black people in the US.
****If this was true, I feel like it would be simpler to just change back to the Black Lives Matter text at the top of the screen. Also, it seems increasingly likely as of Jan. 20th that the image is some kind of plane, which doesn't really have much to do with Black History Month (that I know of?)
**The accompanying header says specifically "xkcd updates Monday, Wednesday, and Friday"--maybe the countdown is to the reveal of a new update schedule?
***Very unlikely. This was the standard header for a long time. It was used when Randall had nothing better to say. But with all his books and the trouble in US with elections and BLM, he has used the header as a platform most of the time many years now. So the standard text is rare. But he did return it for two days before adding the count down, making it seem just like normal.
***A guess is that it returned to this, so the header text did not take any focus away from the countdown.
**[[:Category:Red Spiders|Red spider]] attack?
***Un-Likely
**He will become a father - could be a planned C-section.
***As this is unpredictable, and could go wrong, then this would be a dangerous countdown, people can be very superstitious, even if scientist.
**As it currently looks (after a [[1070: Words for Small Sets|few days]] into the countdown) it may be a trip he is taking by plane.
***Maybe going somewhere people could meet him.
****Book tour?
***Moving a long way from home (down under or the like).
****Maybe he's moving to Japan? Could be a plane, and the time zone would fit, at least.
*****Then the countdown would be until when the plane lands, not to midnight.
******What has time zones to do with this clock? It counts down to the same time all over the world, and will reach zero at the same time no matter what time zone you are in.
******Time zones have to do with where it will be midnight when the countdown reaches zero. If it's a countdown to when January ends (a moment before February begins), then it's until that moment in the time zone where the countdown reaches zero at that time.
******* According to my calculations, the timer will coincide with midnight in the UTC+9 time zone, encompassing both Koreas, Japan, and small parts of Russia and Indonesia.
****If it is a plane, then maybe it will land in a new city Randall moves to when the counter ends, and the skyline will be visible...
**Perhaps it's a start to a new series like [[1190: Time]].
***It is already a series that works like Time, so seems unlikely.
**Zero-G flight, really looks like plane to me.
***Could be time he will first go weightless which could be fairly well known except for bad weather
**A parachute jump by Randall. Could be predicted as well as the zero G.
**How about the [https://www.hitc.com/en-gb/2021/09/09/star-trek-picard-season-2-release-date-plot-cast/ new series of Picard]?
***{{w|Star Trek: Picard (season 2)}} is set to run from March 3 2022, which both Wikipedia (link before) and [https://www.imdb.com/title/tt8806524/episodes?season=2 IMDb] agrees upon so bad to miss by more than a month, and what would the plane in the image have to do with this anyway?
***So No!
** The xkcd world tour!! I wish
** I'm beginning to see another part of the picture entering into view, underneath the arc and above the body of the plane. To me, it looks like it could be a leg of sorts (Early bet: it could be a dinosaur)
**Maybe something to do with aliens? Randall posted two comics about aliens secretly observing earth in a row now, could that be related?
** DB Cooper's jump from an airliner was 50 years ago, but not until november
*** Maybe Randall admits that he was DB Cooper all along?
</div>
 

===count-wimRikmef===
* The identifier of the script contains what is probably an acronym, but for what?
** count / wim (?) / Rik (name) & me f(light)
** Or it's just the output of whatever js minimizer was used.
** R = Randall?
** Randall is travelling to Germany? "Wo ist mein Reisepass? Ich komme mit einem Flug"
** "wi" are the initials for the book that's coming out
*** so what could mRikmef be?
** So the first two letters are what if, maybe the R is for Rex, and the f is flight, not sure about the others?
*** "what if" could be a good shout, the dino on the plane reminds me of the cover of the first "what if", and a raptor attack/snakes on a plane crossover would make for some great what-if analysis
* The "img" tag has a misspelled "heigth" attribute. Probably just a typo?

==Archived Versions==
*Here is a list of the versions that has been saved to the web archive during the countdown.
**The counter in that version is written behind the date of the web archive.
**Note that the counter is active on the archived version counting minutes down from the start. Some of the versions almost changing the minutes just after loading. But it will always count from the time given here:
#[https://web.archive.org/web/20220110183238/https://xkcd.com/ 2022-01-10] 20d 20h 27m
#[https://web.archive.org/web/20220110214138/https://xkcd.com/ 2022-01-10] 20d 17h 18m
#[https://web.archive.org/web/20220111011115/https://xkcd.com/ 2022-01-11] 20d 13h 48m
#[https://web.archive.org/web/20220112005828/https://xkcd.com/ 2022-01-12] 19d 14h 1m
#[https://web.archive.org/web/20220113044552/https://xkcd.com/ 2022-01-13] 18d 10h 14m
#[https://web.archive.org/web/20220114010759/https://xkcd.com/ 2022-01-14] 17d 13h 51m
#[https://web.archive.org/web/20220114195624/https://xkcd.com/ 2022-01-14] 16d 19h 3m
#[https://web.archive.org/web/20220115052737/https://xkcd.com/ 2022-01-15] 16d 9h 32m
#[https://web.archive.org/web/20220116074923/https://xkcd.com/ 2022-01-16] 15d 7h 10m
#[https://web.archive.org/web/20220116225217/https://xkcd.com/ 2022-01-16] 14d 16h 7m
#[https://web.archive.org/web/20220118050255/https://xkcd.com/ 2022-01-18] 13d 9h 57m
#[https://web.archive.org/web/20220118195259/https://xkcd.com/ 2022-01-18] 12d 19h 6m
#[https://web.archive.org/web/20220119213308/https://xkcd.com/ 2022-01-19] 11d 17h 26m
#[https://web.archive.org/web/20220120103559/https://xkcd.com/ 2022-01-20] 11d 4h 23m
#[https://web.archive.org/web/20220120235630/https://xkcd.com/ 2022-01-20] 10d 15h 3m
#[https://web.archive.org/web/20220121023331/https://xkcd.com/ 2022-01-21] 10d 12h 26m
#[https://web.archive.org/web/20220121102349/https://xkcd.com/ 2022-01-21] 10d 4h 36m
#[https://web.archive.org/web/20220122002328/https://xkcd.com/ 2022-01-22] 9d 14h 36m
#[https://web.archive.org/web/20220122034744/https://xkcd.com/ 2022-01-22] 9d 11h 12m
#[https://web.archive.org/web/20220122223018/https://xkcd.com/ 2022-01-22] 8d 16h 29m
#[https://web.archive.org/web/20220123153950/https://xkcd.com/ 2022-01-23] 7d 23h 20m
#[https://web.archive.org/web/20220123231820/https://xkcd.com/ 2022-01-23] 7d 15h 41m
#[https://web.archive.org/web/20220124200931/https://xkcd.com/ 2022-01-24] 6d 18h 50m
#[https://web.archive.org/web/20220125064825/https://xkcd.com/ 2022-01-25] 6d 8h 11m
#[https://web.archive.org/web/20220126002713/https://xkcd.com/ 2022-01-26] 5d 14h 32m
#[https://web.archive.org/web/20220126175842/https://xkcd.com/ 2022-01-26] 4d 21h 1m
#[https://web.archive.org/web/20220127173721/https://xkcd.com/ 2022-01-27] 3d 21h 22m
#[https://web.archive.org/web/20220128225119/https://xkcd.com/ 2022-01-28] 2d 16h 8m
#[https://web.archive.org/web/20220129024550/https://xkcd.com/ 2022-01-29] 2d 12h 14m
#[https://web.archive.org/web/20220129232926/https://xkcd.com/ 2022-01-29] 1d 15h 30m
#[https://web.archive.org/web/20220130190609/https://xkcd.com/ 2022-01-30] 0d 19h 53m
#[https://web.archive.org/web/20220131124817/https://xkcd.com/ 2022-01-31] 0d 2h 11m
#[https://web.archive.org/web/20220201000434/https://xkcd.com/ 2022-02-01] The day after (0d -9h -5m / -1d 14h 55m)

{{comic discussion}}

[[Category:Meta]]

2612: Lightsabers

2022-04-27T19:17:49Z

Angel: Undo revision 231291 by 162.158.159.71 (talk) - I'm pretty sure that they're lightsabers, not bungi

{{comic
| number = 2612
| date = April 27, 2022
| title = Lightsabers
| image = lightsabers.png
| titletext = A lot of Jedi romances start with this turning into a Lady and the Tramp spaghetti situation.
}}

==Explanation==
{{incomplete|Created by a LIQUID LIGHTSABER - Please change this comment when editing this page. Do NOT delete this tag too soon.}}
A {{w|lightsaber}} is a beam-like sword weapon used by members of the {{w|Jedi}} order in the {{w|Star Wars}} franchise. This comic shows a lightsaber fight starting between two [[Cueball]]-like Jedi, one already presenting their blade in challenge and the second activating theirs in response. When the first strike is made between the two lightsabers, they seemingly meld together, with a bloop sound, like the beams are made of a liquid. This then causes the two light beams to be stuck to each other. In in-universe "technical documents", lightsabers are said to be made from magnetically-confined plasma, so perhaps the magnetic fields which were projected from each hilt have merged instead of repelling (or presenting as mutually imperveous) as is usually expected.

This scene actually looks a lot like what happens between Harry Potter and Voldemorts wands in the end of the fourth book the {{w|Harry Potter and the Goblet of Fire|Goblet of Fire}}. Here two spells hit each other and connect the two wands, the wand holders then unable to release or disconnect the wands.

In this situation one Jedi tries to shake the beam, maybe to break the bond, but instead the wave travels down the combined beam to also shake the other Jedi's hand-held hilt. When the vibration dies down the other Jedi then tries to deactivate his lightsaber as an attempt to end the connection. But the retraction of the entire double-sized light beam into the handle (as seen in the movies) causes both of the Jedi to be drawn together where they collide together, forcefully enough to render them both unconscious. The connected lightsaber handles lie next to them on the ground.

The title text implies that such events are how {{w|Jedi}} romances start, comparing it to the famous "spaghetti scene" from the 1955 Disney animated movie ''{{w|Lady and the Tramp}}'' where the two titular characters unintentionally kiss after sharing a strand of spaghetti. In the Old Republic, Jedi were forbidden from entering romantic relationships (and discouraged from forming attachments in general), but in the pre-Disney ''Star Wars Legends'' continuity of the Expanded Universe, Luke Skywalker and Mara Jade first met while fighting in the aftermath of the fall of the Empire, and then developed a romantic relationship.

Star Wars is a [[:Category:Star Wars|recurring theme]] on xkcd, and lightsabers have been prominently featured before in, for instance, [[1397: Luke]] and [[1433: Lightsaber]], where the problem with the physics of a light beam as a sword is shown. But in general light does not interact with light as {{w|photons}} are {{w|bosons}} and can thus pass through each other. Interference, yes, but two pure light beams cannot collide and bounce back as when two lightsabers collide. Also as the comic Lightsaber mentioned above shows, there is no compatible real-world way of confining a beam of light, making it stop after about a meter (or anywhere){{Dubious}} - see {{w|Optical cavity}}. So this is another time where [[Randall]] makes a joke about the physics of lightsabers.

==Transcript==
:[Two Cueball like Jedi are engaging each other in a duel using lightsabers over 12 panels of equal size, with sound effects as the only sound. In the first panel the left Jedi has his lightsaber extended holding it in both hand pointing towards the other, who at this time is just turning his lightsaber on.]
:''Tssssss''
:Click

:[Almost same position of the Jedi, but the right Jedi's lightsaber has now extended, making a sound. He is holding it up near his head in both hands]
:''Tsss''

:[Then they run towards each other and swing their lightsabers towards each other, two small arcs indicating the swing of the lightsabers.]

:[The two beams hit each other and connects at the middle in a big bloop of light, with drops of "light" jumping off both above and below the connected lightsabers. Both Jedi still holds on to their handles with both hands. A loud sound comes out of the connection:]
:''Bloop''

:[The Jedi stands still holding their handles. The beam is now forming a bow between the two handles.]

:[The left Jedi violently shakes his handle causing a wave to travel down the beam towards the right Jedi.]
:<big>Shake shake</big>

:[As the left Jedi's end of the beam comes to rest the wave travels all the way the right Jedi's handle causing his hands to shake, although a bit less than the original shake.]
:Shake shake

:[Back to the bow of light between them, but the beam is visibly still shaking, but no wave is traveling any longer.]

:[Same setting but the shaking has stopped. The right Jedi turns his lightsaber off on his handle with a sound:]
:Click

:[The beam of light is retracted quickly into the handle of the Jedi turning his lightsaber off. So quickly that the two Jedi, still holding on to their handles are pulled up in the air and towards each other as the sound of the beam turning off is heard. Lines indicate their movement and shadows on the ground beneath them indicate they are in the air.]
:''Zhhhiiiip''

:[When the beam is completely retracted the two handles collide and so does the heads of the two Jedi with a loud sound. They still hold on to the handle with both hands. They still hand in the air with shadow on the ground beneath them.]
:''<big>Bonk</big>''

:[In the final panel the two Jedi lies unconscious on the ground with their heads towards each other and with their arms stretched out towards each other. The connected handles lies between them.]

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Multiple Cueballs]]
[[Category:Star Wars]]
[[Category:Fiction]]

Talk:2604: Frankenstein Captcha

2022-04-09T17:57:49Z

Angel:

Don't forget it's canon the Frankenstein is the name of the Monster https://www.explainxkcd.com/wiki/index.php/1589:_Frankenstein

The other squares contain things that might also be ambiguously named:

There is tortoise/turtle ship/boat/yacht monster Napolean/Nelson

puddle/pond/lake girl/woman magma/lava squash/pumpkin/gourd/..

Frankenstein (sandwich?) (stop sign?) monster

Rocket/spaceship(Or planet/dwarf planet?) (couple?) (traffic light?) monster.

I can't think of any other term for the sandwich, the couple, or the traffic signals. Are these a call back to the self driving car captcha https://xkcd.com/1897/

[[Special:Contributions/162.158.159.125|162.158.159.125]] 16:28, 8 April 2022 (UTC)

:That's neither Nelson nor Napoleon but rather Link from the Legend of Zelda series. He has the shield with a Triforce symbol on it, the hat that's pointed in the back, and a sword that's surprisingly recognizable as the Master Sword despite xkcd's low detail art style.
[[Special:Contributions/108.162.245.43|108.162.245.43]] 16:43, 8 April 2022 (UTC)

I suspect some of the other squares are common “well-actually” topics, eg. a pumpkin/squash is actually a fruit. The “puddle” is a mirage. Row 2 column 2 has a 9 drawn in their hair… a Franken-nine? — Alex

--[[Special:Contributions/162.158.2.23|162.158.2.23]] 16:38, 8 April 2022 (UTC)

The astronomical body might be a meteoroid? [[Special:Contributions/172.70.114.77|172.70.114.77]] 16:56, 8 April 2022 (UTC)
:Oh wait, missed the heart crater. nvm that's gotta be Pluto [[Special:Contributions/172.70.230.75|172.70.230.75]] 16:57, 8 April 2022 (UTC)

The sandwich is probably due to pedantry over 'is [x] a sandwich' debates. [[Special:Contributions/172.70.250.67|172.70.250.67]] 17:04, 8 April 2022 (UTC)
:In that case, it should have been a hot dog. ;D
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 17:09, 8 April 2022 (UTC)
:Seems likely. Also reminds me of https://xkcd.com/2301/ [[Special:Contributions/172.70.134.237|172.70.134.237]] 17:18, 8 April 2022 (UTC)

Could the lake/pond tile actually be a fata morgana - given the desert setting implied by the sun and the pyramids? [[User:Captain Nemo|Captain Nemo]] ([[User talk:Captain Nemo|talk]]) 17:13, 8 April 2022 (UTC)
:What lake/pond? There is no water there, man. I think you're just seeing an illusion, created by heat ripples in the air. (I'm kidding; just trying to keep up the "mirage".)
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 17:24, 8 April 2022 (UTC)

The current explanation does not mention the Title Text, nor does it explain the paraphrased quote. I believe the original quote mentions "a line in the sand"? 
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 17:11, 8 April 2022 (UTC)

:There's also the classic turn of phrase "There's a thin line between ConceptA and ConceptB" which is what I thought of when I read that. [[User:MAP|MAP]] ([[User talk:MAP|talk]]) 19:19, 8 April 2022 (UTC)

#a tomato is the gold standard for uncertainty in pronunciation
#the sandwich's definition is both precise and vague: nerd fight! Hotdog? Burrito? Pizza? Doughnut?
#in the 1931 the little girl does not run away but is, er, cared for by the monster. the flower is not pictured. --[[User:Misterstick|Misterstick]] ([[User talk:Misterstick|talk]]) 17:26, 8 April 2022 (UTC)

What if the planet ''contains'' Frankenstein (either the monster or the doctor) and you just can't tell at this resolution??! 19:51, 8 April 2022 (UTC)
:The planet also might be ''named'' Frankenstein. Or an asteroid. There isn't one yet, but maybe in the future?
:[https://space.fandom.com/wiki/List_of_named_asteroids_(F-K)#Fr Closest match for name] is "10246 Frankenwald"

A bit disappointed Randall didn't take the opportunity to include the 1972 Edgar Winter Group album "They Only Come Out at Night", which contains the track "Frankenstein." [[Special:Contributions/172.70.131.176|172.70.131.176]] 18:51, 8 April 2022 (UTC)

The turtle may be a reference to "turtle rifle", a series of GAN exercises resulting in producing objects that neural networks recognize as something completely else. A famous one was a turtle-shaped toy, which looked quite like a normal turtle to a human eye, but a characteristic pattern on its shell made neural networks to classify it as a rifle.

Based on the standard levels of pedantry, I am surprised that no-one yet has pointed out that we are not supposed to click on ONLY the correct images. Taking the union of both Frankenstein sets should then be accepted (unless we faced union-bashers in the Frankenstein-basher crowd).
:The instructions use standard CAPTCHA language, "only" is understood (otherwise a bot could just click all boxes and the test would be defeated). [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 22:26, 8 April 2022 (UTC)

But I saw no picture of a [https://reddwarf.fandom.com/wiki/Frankenstein cat]... [[Special:Contributions/172.70.86.44|172.70.86.44]] 22:25, 8 April 2022 (UTC)

Also, in my experience, CAPTCHAs that ask for "Click all squares with <whatever>" on a non-refreshing grid of otherwise independent images - which I often-enough encounter in this very site - tend to assume exactly three squares are correct. (e.g. it asks for "all tractors", and there are two tractors and some non-tractor vehicle like a road-roller, then it doesn't matter if *I* think that's not actually a tractor, it won't let me past until I've clicked the road-roller). The rules are different for refreshing images (click an image's square, it presents a new image, until eventually every square that had previously been one-or-more picture(s) of the target-type are now all irrelevent to click) or a gridded single-scene (I haven't worked that one out fully... if it's asking for Traffic Lights, do I just need to do the squares ''entirely'' containing such light units/only those with the 'light' part of the units/every single square with even the barest edge of the frame around the lights/all squares even with just the poles/wires suspending the lights up off the ground... sometimes it seems to like what I do, sometimes it retests me, and I don't know if it's unhappy with my choice or so absolutely happy with my choice that it desperately wants me to help the Algorithm just that little bit more). '''*cough*''' Anyway. What I'm saying is, if I was seriously trying to answer this comic's example, I'd be looking for exactly three Frankenstein squares of one (dubious) kind or another. [[Special:Contributions/172.70.86.44|172.70.86.44]] 22:25, 8 April 2022 (UTC)
:I've seen plenty of this type of CAPTCHA with fewer than 3 correct tiles. Unless I'm not human enough to recognize all the matches.... [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 22:29, 8 April 2022 (UTC)
:I think you both just proved you are robots. Humans are too dumb to do this level of analysis. [[Special:Contributions/108.162.241.9|108.162.241.9]] 03:04, 9 April 2022 (UTC)

"Knowledge is Knowing Frankenstein isn’t the Monster, Wisdom is Knowing Frankenstein is the Monster" - https://commons.emich.edu/ac/vol3/iss1/4/ [[Special:Contributions/108.162.241.9|108.162.241.9]] 02:56, 9 April 2022 (UTC)

*I have to mention the "lost ending" of ''Frankenstein'' which is found at https://imgur.com/gallery/bCGEw . --[[Special:Contributions/172.70.130.125|172.70.130.125]] 03:36, 9 April 2022 (UTC)

May be worth noting that the traffic light's three coloured circles are all shaded black. In some countries (I know I've seen someone I trust saying it's true in the USA and UK), the law specifies that you must treat a broken traffic light (or one which you reasonably believe to be broken; such as if it's not lit up) as a stop sign. Does this mean you'd click it in a CAPTCHA that asks for stop signs? [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 09:04, 9 April 2022 (UTC)

I was today years old when I learned that "ship" and "boat" aren't literally interchangeable like "eggplant" and "aubergine". [[Special:Contributions/172.70.131.216|172.70.131.216]] 09:22, 9 April 2022 (UTC)
:The way I understood it is that a ship carries boats – think of a cruise liner or cargo ship with lifeboats, or a naval vessel with longboats or the captain's gig – but a boat, like a rowboat, speedboat, or personal watercraft, does not. [[User:RAGBRAIvet|RAGBRAIvet]] ([[User talk:RAGBRAIvet|talk]]) 16:26, 9 April 2022 (UTC)
::I learned it as being that a ship needs somewhere proper to land (like a pier or a proper dock), while a boat you can bring close enough to the shore and jump off; or run it up the beach. Guess people have different definitions. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 17:57, 9 April 2022 (UTC)

I wonder if any of those vegetables would count as "Frankenstein foods". --[[Special:Contributions/172.70.85.211|172.70.85.211]] 13:38, 9 April 2022 (UTC)
:That was my initial assumption when I saw it (on my phone) and couldn't tell what they were [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 17:57, 9 April 2022 (UTC)

Talk:2604: Frankenstein Captcha

2022-04-09T09:04:31Z

Angel:

Talk:2588: Party Quadrants

2022-03-02T23:44:50Z

Angel:

I added a first draft. I'm sure someone can make it better.

I can't be the only person who thinks I'd like to go to that party. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 23:44, 2 March 2022 (UTC)

Talk:2578: Sword Pull

2022-02-08T02:03:44Z

Angel:

I was going to opine that the title text should have said "mini bike" instead of "dirt bike" since the former is usually started by a recoil pull rope and the latter by a kick start. But I guess technically neither one is started by a magic sword so kind of a toss up. [[Special:Contributions/172.70.126.221|172.70.126.221]] 22:48, 7 February 2022 (UTC)Pat
Hope u like my explanation {{unsigned ip|172.70.110.151}}

I though the sword belongs to {{w|Lady of the Lake}} ... -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 23:29, 7 February 2022 (UTC)
:The sword from the stone (proof of lineage/fate) really should be considered differently from the one from the lake ("strange women lying in ponds distributing swords is no basis for a system of government"), but they do tend to be conflated by some versions of the storytelling. The various myths were already that confused/contradictory/clashing centuries ago. (Some versions have Excalibur drawn from the stone to start his destiny, but ultimately then have him (...have a trusted but reluctant knight to) 'return' it to the Lady Of The Lake, from whence it presumably came (before being set in the stone), at the end of his life.)
:But I choose to go with the strand of canon that says that the 'kingmaker' sword was separate, got broken in a personal combat he should not rightfully have fought, and that only after reparations for the incident was he directed to go receive Excalibur, as its replacement, from its watery source.
:Really though, it probably is all a mistelling (and probably very Freudian, in every way!) of what never quite happened anyway. Except for the version where the time-traveller does the setting up of the contest with tidally-powered electromagnets and possibly an unintended recipient of the legend made true... ;) [[Special:Contributions/172.70.85.79|172.70.85.79]] 00:34, 8 February 2022 (UTC)

::I thought Lancelot (possibly one of the others?) received Excalibur as a proof of valor, and chose to pass it on to his king as a sign of respect; no longer the knight whose pride in his own virtue stops him bowing to a higher authority. Guess there's more versions than I know. ''Returning'' the sword I remember; but I thought he originally obtained it second hand, so the Lady accepting the sword back was the final proof that he had been worthy to have it. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 02:03, 8 February 2022 (UTC)

Merlin is a brand of motorcycle produced in Spain from 1980-1984. [[User:KingPenguin|KingPenguin]] ([[User talk:KingPenguin|talk]]) 01:36, 8 February 2022 (UTC)

:Wow, I heard of them but didn't realise the brand was so short-lived. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 02:03, 8 February 2022 (UTC)

Talk:2570: Captain Picard Tea Order

2022-01-20T11:07:23Z

Angel:

...{{w|Builder's tea|Builders}}. I mean, Picard is French and Trek(/Randall) is 'Merican but I suspect it would still be a valid option to give the Ready-Room replicator... [[Special:Contributions/172.70.91.126|172.70.91.126]] 23:31, 19 January 2022 (UTC)

In ''Star Trek: Picard'', Picard is seen requesting "tea, earl gray, decaf". [[Special:Contributions/172.69.68.202|172.69.68.202]] 03:33, 20 January 2022 (UTC)

Presumably infinite tea could be the beverage to accompany [[1099|Endless Wings]]. [[User:Nitpicking|Nitpicking]] ([[User talk:Nitpicking|talk]]) 03:45, 20 January 2022 (UTC)

:I assumed infinite tea was just a bad pun - as in 'To infinite tea and beyond!' [[Special:Contributions/162.158.159.85|162.158.159.85]] 09:12, 20 January 2022 (UTC)

I showed it to a friend an their response was: "[In early 20th century England] they added condensed beef stock to their tea for breakfast", so ''meaty'' tea is very much a possibility. Then they linked some brand promotional materials for "Vimbos: The Prince of Fluid Beef" and "Vimbos: an ox in a teacup". Because I was just about to sign off for the evening, I'm not going to do the due diligence to research, cite, and edit the main article to reflect this discovery--but I thought it should at least be written here to see if others found it interesting enough to add. [[User:Dextrous Fred|Dextrous Fred]] ([[User talk:Dextrous Fred|talk]]) 04:21, 20 January 2022 (UTC)

:{{w|Bovril|Bovril}} is a standard beef tea [[Special:Contributions/172.70.85.79|172.70.85.79]] 07:40, 20 January 2022 (UTC)

:''Meaty'' is also a term that could be used to describe robustly flavoured teas, such as an Assam. Not likely to be used for Earl Grey, though.[[Special:Contributions/162.158.159.85|162.158.159.85]] 09:18, 20 January 2022 (UTC)

The concept of iced tea is not normal, especially as Picard is English. Almost but not quite, totally unlike tea. [[User:Arachrah|Arachrah]] ([[User talk:Arachrah|talk]]) 08:46, 20 January 2022 (UTC)

:Intravenous tea, on the other hand, is an entirely reasonable request. [[Special:Contributions/162.158.159.85|162.158.159.85]] 09:13, 20 January 2022 (UTC)

I kind of think that the explanation should give more emphasis to the fact that the whole comic is basically just a convoluted set-up for the Earl Grey joke.[[Special:Contributions/141.101.98.145|141.101.98.145]] 09:20, 20 January 2022 (UTC)

I disagree that separating the tea into segments would not be possible. You simply need a segmented mug or cup. That would, though, probably prove difficult to drink, unless he used a straw.[[Special:Contributions/141.101.98.145|141.101.98.145]] 09:28, 20 January 2022 (UTC)

While I'm normally the first to jump in on the [citation needed] joke, that would have to be applied to almost every single line of the explanation, so I propose Not Doing That. I accept criticism and counter arguments --[[User:256.256.256.256|Evidently the unfunny person here]] ([[User talk:256.256.256.256|talk]]) 09:45, 20 January 2022 (UTC)

Could the "infinite" also be a reference to the paperclip maker thought experiment - the replicator will consume the universe to get raw materials and energy to make more and more tea. [[Special:Contributions/141.101.98.225|141.101.98.225]] 10:09, 20 January 2022 (UTC)

I liked "verbose". Most software run from a command line has a "-verbose" or "-v" option which causes it to give more information about what it's doing, usually useful for the purpose of debugging. Rather than providing more information about the tea, I expect that "tea, earl grey, verbose" would result in the replicator giving a step-by-step explanation as it looks up the recipe for tea, selects appropriate raw materials (does it use particles from the air or something?), begins replicating, finishes replicating, and tests that the final product is within normal parameters. Of course, this might mean that the replicator runs more slowly while doing this; which could be useful if he's getting tea as an excuse to take a break from an argument of some kind. Perhaps the replicator even has a 'traditional' tea making mode, where it pauses and describes a more conventional method of tea-making as if there were an invisible chef with a kettle and a teapot somewhere just out of sight. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 11:07, 20 January 2022 (UTC)

Talk:Countdown in header text

2022-01-14T11:41:03Z

Angel:

The talk on from [[2565: Latency]] and [[2566: Decorative Constants]] has been moved here by me when I created this page --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:01, 12 January 2022 (UTC)

;From Latency:
What is happening around Feb 1st, there is a countdown that appeared a few hours ago in the upper right corner of the xkcd index. There is also the directory xkcd.com/count-wimRikmef which might be an acronym, if it isnt a countdown package? {{unsigned ip|172.70.130.57}}
:Damn you beat me to it ;-). But I have made a [[2565:_Latency#Trivia|Trivia]] here on this comics page and links to more detail on the [[xkcd Header text]] page. I belie you are a day of, but someone will likely correct me if I'm wrong. As I can see it will be January 31st, 9:59 in Randall's home town Boston.--[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:06, 10 January 2022 (UTC)
::But damned if I can wait. Sure millions will watch the page when it goes to zero! At least it is no April 1st. :-D --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:10, 10 January 2022 (UTC)

;From Decorative Constants
Any idea what's going on with the clock that's counting downwards in the banner? Currently counting down from 20 days 16 hours? [[Special:Contributions/172.70.214.95|172.70.214.95]] 22:08, 10 January 2022 (UTC)
:(Simultaneous edit) What is the days-hours-minutes in the box above the comic referring to? The image itself is dated yesterday, as you can see by saving it. Worst-case-scenario, is this a countdown to the end of XKCD? [[Special:Contributions/108.162.245.223|108.162.245.223]] 22:11, 10 January 2022 (UTC)
:: It's going to hit zero at around midnight on Jan 31st 2022 CST? [[User:SteveBaker|SteveBaker]] ([[User talk:SteveBaker|talk]]) 22:16, 10 January 2022 (UTC)
:::'''Posted this on the previous comics discussion. But lets take it here where there will be more traffic:''' --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 22:44, 10 January 2022 (UTC) -- Copy paste from previous comics discussion:
::::Damn you beat me to it ;-). But I have made a [[2565:_Latency#Trivia|Trivia]] here on this comics page and links to more detail on the [[xkcd Header text]] page. I believe you are a day of, but someone will likely correct me if I'm wrong. As I can see it will be January 31st, 9:59 in Randall's home town Boston.--[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:06, 10 January 2022 (UTC)
:::::But damned if I can wait. Sure millions will watch the page when it goes to zero! At least it is no April 1st. :-D --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:10, 10 January 2022 (UTC)
::::Yeah - you're right - I messed up. So as I type this, it's Jan 10th 2022 at 4pm - 1600 hrs Mountain time - which is 1800 hours EST. At this moment, the countdown reads 20d 16h 0m - so Jan 30th + (18+16) hours = which is Jan 30th + 34 hours - which is Jan 31st + 10am in Boston (EST). [[User:SteveBaker|SteveBaker]] ([[User talk:SteveBaker|talk]]) 23:05, 10 January 2022 (UTC)
:::::Hey great, can see they agree in the link to reddit below. So happy I got it right both in UTC and Boston. It will be 15:59 here in DK. Not 16:00. ;-) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 23:44, 10 January 2022 (UTC)

Counting down to Backwards Day? --[[Special:Contributions/162.158.91.88|162.158.91.88]] 23:28, 10 January 2022 (UTC)
:There's a reddit thread discussing it: https://www.reddit.com/r/xkcd/comments/s0oynl/xkcd_countdown_timer_20d_21h_49m_remaining_until/ I think the most likely guess is that Randall has a new book coming out. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 23:40, 10 January 2022 (UTC)
::Would still seem strange if it came out that day with only promotion before being a count down. But then again, he will have the xkcd communities boiling if he gives no other hint. So every one will see if he promotes a book. Also as they wrote at the time I looked at reddit I do not think it is the end of xkcd, or Webb related. Although Webb was the first I thought about. But I mean even if it came to L2 at that day, it is not going to any specific point but just in orbit. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 23:47, 10 January 2022 (UTC)

::The date fits the idea of it being Backwards Day (https://nationaldaycalendar.com/backward-day-january-31) but what about the choice of time? [[User:SteveBaker|SteveBaker]] ([[User talk:SteveBaker|talk]]) 03:38, 11 January 2022 (UTC)
:::Backwards day... Never head of it until now. Is it big in the US. I mean when looking after dates so obscure they are not mentioned on wikipedia then there are probably lots of things happening on that day? But maybe it is a think in the US? --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 08:48, 11 January 2022 (UTC)
:::: I haven't heard of it until now either, so it is probably one of the bajillions of holidays no one actually cares about, and is unrelated to the countdown. [[Special:Contributions/108.162.221.163|108.162.221.163]] 13:22, 11 January 2022 (UTC)Bumpf

Someone has noticed the image is changing with pixels added at the bottom left corner and is keeping track of it here: https://munvoseli.github.io/xkcd-countdown/ [[Special:Contributions/198.41.238.107|198.41.238.107]] 05:49, 11 January 2022 (UTC)
:Looks like an image is "moving" into the frame because at the moment you can see some white pixel in the lower left, i.e. the black part might end up as a line as part of some comic. [[Special:Contributions/162.158.89.8|162.158.89.8]] 08:31, 11 January 2022 (UTC)
::Thanks used that to pinpoint the start of the countdown. Have added this info to the header text page, and the original trivia. Also just added a line of trivia to this explanation with the link. This was when this comic came out most people noticed the count down. But it did came out while [[Latency]] was up. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 08:43, 11 January 2022 (UTC)
:::Speculating on what it could be, the only thing that makes sense at that angle is a character's arm. 04:47, 12 January 2022 (UTC)

The header changes page says that it's forcing "Friday" to move down to the next line. Not for me. Did he fix it, or is it browser-specific? [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 14:58, 11 January 2022 (UTC)
:It must be browser specific. But i have tried bot the old Internet Explorer, Edge, Chrome and Firefox, and it does it in all cases and zooming does nothing.. Which browser do you use? I have corrected to in some browsers though, in the [[xkcd_Header_text#2022-01-10_-_Standard_text_with_countdown|explanation]] you refer to. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 15:31, 12 January 2022 (UTC)

This is much more likely a count down related to the James Webb Space Telescope. At approximately the day the count down indicates the telescope will be orbiting the L2 gravitational spot.Perhaps most of the mirrors will be approximate place to allow for months of fine tuning. An example of a slightly similar idea is https://www.space.com/nasa-james-webb-space-telescope-next-steps
[[User:Punchcard|Punchcard]] ([[User talk:Punchcard|talk]]) 15:35, 11 January 2022 (UTC)
:I really do not think so. There is nothing special about a specific moment for reaching L2. It will go in orbit around it, but when to day it is there or in orbit is hard to pinpoint. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:13, 12 January 2022 (UTC)
::And after I looked at it, it seems it will reach L2 several days before the countdown. See [[Countdown in header text#Theories]]. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 15:31, 12 January 2022 (UTC)

I think the Countdown should get its own entry. What do we think? [[User:Sure|Sure]] ([[User talk:Sure|talk]]) 16:25, 11 January 2022 (UTC)
: I think it should! What with the count itself, the speculation about what it could mean, and now the slowly arriving image (?) this seems like something beyond either of the two comics since it started! [[Special:Contributions/108.162.219.49|108.162.219.49]] 18:00, 11 January 2022 (UTC)
: I'm surprised it doesn't have one already. This is one of the more unique situations in a long while, more speculation could happen. [[User:Thisfox|Thisfox]] ([[User talk:Thisfox|talk]]) 22:26, 11 January 2022 (UTC)
::I have now created this page and talk page for us to continue the discussion and make dedicated changes about this countdown here. And have moved all discussion from the two pages that had some already (except a few on the first talk page that was also mentioned here. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:13, 12 January 2022 (UTC)

If you take a look at this [[https://xkcd.com/count-wimRikmef/state|link]] it displays this: '''{"img":"72cb154b23f959f908f5dc8eb03069c6df3f0f54aae896a0e7ed27befb2ee639.png","start":"2022-01-10T17:00:00Z","target":"2022-01-31T15:00:00Z","until":"2022-01-11T20:55:38.205303701Z"}''' [[User:Hoodiesandboba|Hoodiesandboba]] ([[User talk:Hoodiesandboba|talk]]) 20:58, 11 January 2022 (UTC)
:To correct your link:
:"...If you take a look at this [https://xkcd.com/count-wimRikmef/state link] it displays..."
:As to where the "72cb154b23f959f908f5dc8eb03069c6df3f0f54aae896a0e7ed27befb2ee639.png" is rooted, I haven't dug into that (or what transforms might be being applied), but it looks like a manipulation of browser states might be able to prematurely reveal it. (I'm on mobile at the moment, and it's significantly more fiddly to poke into the page-scripting and markup than I can be bothered with this moment, but I know what I'd do with a good acreage of screen, mouse control and a proper keyboard to rattle away at. And the combined minds here surely can do even better than myself.) [[Special:Contributions/172.70.91.116|172.70.91.116]] 22:38, 11 January 2022 (UTC)
::The filename is a random number long enough to prevent brute force guessing to find future images. The state-file looks like some information for the javascript script where this URL comes from. I haven't looked into the script that much but from the values I'd say that it's telling when to start doing refreshs (2022-01-10T17:00:00Z) and when to stop doing that (2022-01-31T15:00:00Z). While these values are constant, the third value changes and is ten minutes after the time the page has been requested. I suppose this is telling the script, when to do a refresh of the image load. [[Special:Contributions/141.101.77.16|141.101.77.16]] 11:05, 13 January 2022 (UTC)
:::After some fiddeling, I've found the origin of the filename: It's the SHA-256 hash of the image [[Special:Contributions/141.101.77.16|141.101.77.16]] 11:05, 13 January 2022 (UTC)
::::There's already a note that it would be impossible to brute-force the filenames. But as the images are very similar to each other, would it be feasible to programmatically generate images similar to the last one (extending up and to the right, different variations of the line shape), hash those files, and test to see if they match images on the server? I'd expect it to reduce the number of possibilities by orders of magnitude, but not sure if that's enough to make brute-force attempts feasible and non-destructive. (Also don't know the PNG format well enough to know if an image with the same pixels in it is guaranteed to produce the same bytes in the file across different implementations) -- [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 11:16, 14 January 2022 (UTC)
:::::Hmm… if it was pure black and white, the total number of possible images would be within the realms of sanity to brute force. But add antialiasing and the numbers rapidly become silly. Even if you only allow pixels to change within a certain distance of the previous image, and restrict greys to places between a black and a white, the numbers quickly become absurd. Although that makes me think about making 1-bit versions of all the images so far, predicting a set of "next frame" possibilities at each step, and training a CNN to pick the correct next one; and if it gets accurate enough by the time we get to the present… hmm. How predictable is antialiasing? Do we know the software he's using to create the images; and if so is there a relatively predictable algorithm applied along the edges? [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 11:41, 14 January 2022 (UTC)

I think it counts down to Lunar New Year (the Year of the Tiger), as measured in Korea (the earliest timezone where that is celebrated). Actually, it reaches 0 one minute before the New Year, so maybe it will switch to seconds for the last minute. [[Special:Contributions/172.70.98.75|172.70.98.75]] 05:10, 12 January 2022 (UTC)
:Could be, but why. Randall has never to rarely? mentioned this new year... --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:13, 12 January 2022 (UTC)

I think we are seeing a zoom out of some image. Perhaps it is the arm of Cueball? --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:36, 12 January 2022 (UTC)
:It looks like there's a little curve at the top left of the line entering the frame! This makes the Cueball arm hypothesis more likely. [[User:Sure|Sure]] ([[User talk:Sure|talk]]) 14:18, 12 January 2022 (UTC)
::I also noticed that (and moved your comment up here, as it is kind of a reply to that). Seems like the picture updates every four hours, and that it happened last time at noon UTC today. And thus it will also be at midnight. So 4, 8, 12, 16, 20 and 24. But it is not certain yet and not sure it happened like that the first day or two. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 14:46, 12 January 2022 (UTC)

I have added the first 12 images on this page: [[Countdown in header text/images]] - anyone may help uploading the new ones there. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:43, 12 January 2022 (UTC)
: Thank you! [[Special:Contributions/173.245.52.194|173.245.52.194]] 12:44, 12 January 2022 (UTC)

Does anyone mind if I make a few spelling/grammar corrections to the article? It feels like the kind of thing that could be interpreted as rude, so I wanted to ask first. [[Special:Contributions/172.70.114.167|172.70.114.167]] 13:00, 12 January 2022 (UTC)
:No no please help me with my poor spelling. I'm Danish and not very good at spelling in English. Also anything I write is up for debate and can be changed. Just because I started this page do not give me ownership over it. As long as relevant info is not deleted the entire layout maybe changed. But better to get the page going sooner rather than later.--[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 14:46, 12 January 2022 (UTC)
::Alright!! Thank you so much for all your great work on this page! [[Special:Contributions/172.70.110.151|172.70.110.151]] 18:02, 13 January 2022 (UTC)

I originally put this (without realising it wasn't the Talk page) in the Images sub-page, in response to the revelation it was (very probably) the SHA256 of the image data that was used to name the file:
*When I first looked at it and decided it was an obvious hash (yes SHA256 sounds about right, but nice to know someone's tried it) I personally had hoped it would be a hash of the datetime (plus a salt, maybe, to give it that extra little frisson of difficulty in reverse engineering... ;) ). But if it's as you say I think I'll refrain from getting any rainbow-tables set up and bashing through the possibilities in the rather huge phase-space it could represent. Of course, there must be a look-up table used by the server. It'd be too much to hope for that it's publically exposed though, and totally a rookie-error if it is. (That Randall, and maybe anyone he actually drafted in to implement it to save himself the worry, is surely not going to commit.)
...anyway, bringing it here, as being more conversational than informative. Still thought I should say it, but stupidly long as a comment so maybe I needn't have repasted it again! [[Special:Contributions/172.70.85.79|172.70.85.79]] 03:39, 13 January 2022 (UTC)

(Put this in here as it was before in the explanation --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 12:02, 13 January 2022 (UTC):)
Was going to say it's Hangman, but it looks like it's zooming in on the diagonal instead of continuing to make a gibbet. [[User:Thisfox|Thisfox]] ([[User talk:Thisfox|talk]]) 06:37, 13 January 2022 (UTC)

I read the javascript of the countdown and noticed one thing that i didn't see mentioned anywhere on this page: the countdown text is moving upwards. When the countdown started the text was exactly in the middle of the image and at the end of the countdown the text will be at the top (you can see how it will look by changing the time in your system). The code will also make the text disappear and leave only the image after the countdown goes to zero. [[Special:Contributions/162.158.90.41|162.158.90.41]] 23:52, 13 January 2022 (UTC)

The Greensboro sit-ins started on Feb 1, though the time is different.. But black history month?

Talk:Countdown in header text

2022-01-14T11:16:29Z

Angel:

The talk on from [[2565: Latency]] and [[2566: Decorative Constants]] has been moved here by me when I created this page --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:01, 12 January 2022 (UTC)

;From Latency:
What is happening around Feb 1st, there is a countdown that appeared a few hours ago in the upper right corner of the xkcd index. There is also the directory xkcd.com/count-wimRikmef which might be an acronym, if it isnt a countdown package? {{unsigned ip|172.70.130.57}}
:Damn you beat me to it ;-). But I have made a [[2565:_Latency#Trivia|Trivia]] here on this comics page and links to more detail on the [[xkcd Header text]] page. I belie you are a day of, but someone will likely correct me if I'm wrong. As I can see it will be January 31st, 9:59 in Randall's home town Boston.--[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:06, 10 January 2022 (UTC)
::But damned if I can wait. Sure millions will watch the page when it goes to zero! At least it is no April 1st. :-D --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:10, 10 January 2022 (UTC)

;From Decorative Constants
Any idea what's going on with the clock that's counting downwards in the banner? Currently counting down from 20 days 16 hours? [[Special:Contributions/172.70.214.95|172.70.214.95]] 22:08, 10 January 2022 (UTC)
:(Simultaneous edit) What is the days-hours-minutes in the box above the comic referring to? The image itself is dated yesterday, as you can see by saving it. Worst-case-scenario, is this a countdown to the end of XKCD? [[Special:Contributions/108.162.245.223|108.162.245.223]] 22:11, 10 January 2022 (UTC)
:: It's going to hit zero at around midnight on Jan 31st 2022 CST? [[User:SteveBaker|SteveBaker]] ([[User talk:SteveBaker|talk]]) 22:16, 10 January 2022 (UTC)
:::'''Posted this on the previous comics discussion. But lets take it here where there will be more traffic:''' --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 22:44, 10 January 2022 (UTC) -- Copy paste from previous comics discussion:
::::Damn you beat me to it ;-). But I have made a [[2565:_Latency#Trivia|Trivia]] here on this comics page and links to more detail on the [[xkcd Header text]] page. I believe you are a day of, but someone will likely correct me if I'm wrong. As I can see it will be January 31st, 9:59 in Randall's home town Boston.--[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:06, 10 January 2022 (UTC)
:::::But damned if I can wait. Sure millions will watch the page when it goes to zero! At least it is no April 1st. :-D --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:10, 10 January 2022 (UTC)
::::Yeah - you're right - I messed up. So as I type this, it's Jan 10th 2022 at 4pm - 1600 hrs Mountain time - which is 1800 hours EST. At this moment, the countdown reads 20d 16h 0m - so Jan 30th + (18+16) hours = which is Jan 30th + 34 hours - which is Jan 31st + 10am in Boston (EST). [[User:SteveBaker|SteveBaker]] ([[User talk:SteveBaker|talk]]) 23:05, 10 January 2022 (UTC)
:::::Hey great, can see they agree in the link to reddit below. So happy I got it right both in UTC and Boston. It will be 15:59 here in DK. Not 16:00. ;-) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 23:44, 10 January 2022 (UTC)

Counting down to Backwards Day? --[[Special:Contributions/162.158.91.88|162.158.91.88]] 23:28, 10 January 2022 (UTC)
:There's a reddit thread discussing it: https://www.reddit.com/r/xkcd/comments/s0oynl/xkcd_countdown_timer_20d_21h_49m_remaining_until/ I think the most likely guess is that Randall has a new book coming out. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 23:40, 10 January 2022 (UTC)
::Would still seem strange if it came out that day with only promotion before being a count down. But then again, he will have the xkcd communities boiling if he gives no other hint. So every one will see if he promotes a book. Also as they wrote at the time I looked at reddit I do not think it is the end of xkcd, or Webb related. Although Webb was the first I thought about. But I mean even if it came to L2 at that day, it is not going to any specific point but just in orbit. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 23:47, 10 January 2022 (UTC)

::The date fits the idea of it being Backwards Day (https://nationaldaycalendar.com/backward-day-january-31) but what about the choice of time? [[User:SteveBaker|SteveBaker]] ([[User talk:SteveBaker|talk]]) 03:38, 11 January 2022 (UTC)
:::Backwards day... Never head of it until now. Is it big in the US. I mean when looking after dates so obscure they are not mentioned on wikipedia then there are probably lots of things happening on that day? But maybe it is a think in the US? --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 08:48, 11 January 2022 (UTC)
:::: I haven't heard of it until now either, so it is probably one of the bajillions of holidays no one actually cares about, and is unrelated to the countdown. [[Special:Contributions/108.162.221.163|108.162.221.163]] 13:22, 11 January 2022 (UTC)Bumpf

Someone has noticed the image is changing with pixels added at the bottom left corner and is keeping track of it here: https://munvoseli.github.io/xkcd-countdown/ [[Special:Contributions/198.41.238.107|198.41.238.107]] 05:49, 11 January 2022 (UTC)
:Looks like an image is "moving" into the frame because at the moment you can see some white pixel in the lower left, i.e. the black part might end up as a line as part of some comic. [[Special:Contributions/162.158.89.8|162.158.89.8]] 08:31, 11 January 2022 (UTC)
::Thanks used that to pinpoint the start of the countdown. Have added this info to the header text page, and the original trivia. Also just added a line of trivia to this explanation with the link. This was when this comic came out most people noticed the count down. But it did came out while [[Latency]] was up. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 08:43, 11 January 2022 (UTC)
:::Speculating on what it could be, the only thing that makes sense at that angle is a character's arm. 04:47, 12 January 2022 (UTC)

The header changes page says that it's forcing "Friday" to move down to the next line. Not for me. Did he fix it, or is it browser-specific? [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 14:58, 11 January 2022 (UTC)
:It must be browser specific. But i have tried bot the old Internet Explorer, Edge, Chrome and Firefox, and it does it in all cases and zooming does nothing.. Which browser do you use? I have corrected to in some browsers though, in the [[xkcd_Header_text#2022-01-10_-_Standard_text_with_countdown|explanation]] you refer to. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 15:31, 12 January 2022 (UTC)

This is much more likely a count down related to the James Webb Space Telescope. At approximately the day the count down indicates the telescope will be orbiting the L2 gravitational spot.Perhaps most of the mirrors will be approximate place to allow for months of fine tuning. An example of a slightly similar idea is https://www.space.com/nasa-james-webb-space-telescope-next-steps
[[User:Punchcard|Punchcard]] ([[User talk:Punchcard|talk]]) 15:35, 11 January 2022 (UTC)
:I really do not think so. There is nothing special about a specific moment for reaching L2. It will go in orbit around it, but when to day it is there or in orbit is hard to pinpoint. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:13, 12 January 2022 (UTC)
::And after I looked at it, it seems it will reach L2 several days before the countdown. See [[Countdown in header text#Theories]]. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 15:31, 12 January 2022 (UTC)

I think the Countdown should get its own entry. What do we think? [[User:Sure|Sure]] ([[User talk:Sure|talk]]) 16:25, 11 January 2022 (UTC)
: I think it should! What with the count itself, the speculation about what it could mean, and now the slowly arriving image (?) this seems like something beyond either of the two comics since it started! [[Special:Contributions/108.162.219.49|108.162.219.49]] 18:00, 11 January 2022 (UTC)
: I'm surprised it doesn't have one already. This is one of the more unique situations in a long while, more speculation could happen. [[User:Thisfox|Thisfox]] ([[User talk:Thisfox|talk]]) 22:26, 11 January 2022 (UTC)
::I have now created this page and talk page for us to continue the discussion and make dedicated changes about this countdown here. And have moved all discussion from the two pages that had some already (except a few on the first talk page that was also mentioned here. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:13, 12 January 2022 (UTC)

If you take a look at this [[https://xkcd.com/count-wimRikmef/state|link]] it displays this: '''{"img":"72cb154b23f959f908f5dc8eb03069c6df3f0f54aae896a0e7ed27befb2ee639.png","start":"2022-01-10T17:00:00Z","target":"2022-01-31T15:00:00Z","until":"2022-01-11T20:55:38.205303701Z"}''' [[User:Hoodiesandboba|Hoodiesandboba]] ([[User talk:Hoodiesandboba|talk]]) 20:58, 11 January 2022 (UTC)
:To correct your link:
:"...If you take a look at this [https://xkcd.com/count-wimRikmef/state link] it displays..."
:As to where the "72cb154b23f959f908f5dc8eb03069c6df3f0f54aae896a0e7ed27befb2ee639.png" is rooted, I haven't dug into that (or what transforms might be being applied), but it looks like a manipulation of browser states might be able to prematurely reveal it. (I'm on mobile at the moment, and it's significantly more fiddly to poke into the page-scripting and markup than I can be bothered with this moment, but I know what I'd do with a good acreage of screen, mouse control and a proper keyboard to rattle away at. And the combined minds here surely can do even better than myself.) [[Special:Contributions/172.70.91.116|172.70.91.116]] 22:38, 11 January 2022 (UTC)
::The filename is a random number long enough to prevent brute force guessing to find future images. The state-file looks like some information for the javascript script where this URL comes from. I haven't looked into the script that much but from the values I'd say that it's telling when to start doing refreshs (2022-01-10T17:00:00Z) and when to stop doing that (2022-01-31T15:00:00Z). While these values are constant, the third value changes and is ten minutes after the time the page has been requested. I suppose this is telling the script, when to do a refresh of the image load. [[Special:Contributions/141.101.77.16|141.101.77.16]] 11:05, 13 January 2022 (UTC)
:::After some fiddeling, I've found the origin of the filename: It's the SHA-256 hash of the image [[Special:Contributions/141.101.77.16|141.101.77.16]] 11:05, 13 January 2022 (UTC)
::::There's already a note that it would be impossible to brute-force the filenames. But as the images are very similar to each other, would it be feasible to programmatically generate images similar to the last one (extending up and to the right, different variations of the line shape), hash those files, and test to see if they match images on the server? I'd expect it to reduce the number of possibilities by orders of magnitude, but not sure if that's enough to make brute-force attempts feasible and non-destructive. (Also don't know the PNG format well enough to know if an image with the same pixels in it is guaranteed to produce the same bytes in the file across different implementations) -- [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 11:16, 14 January 2022 (UTC)

I think it counts down to Lunar New Year (the Year of the Tiger), as measured in Korea (the earliest timezone where that is celebrated). Actually, it reaches 0 one minute before the New Year, so maybe it will switch to seconds for the last minute. [[Special:Contributions/172.70.98.75|172.70.98.75]] 05:10, 12 January 2022 (UTC)
:Could be, but why. Randall has never to rarely? mentioned this new year... --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:13, 12 January 2022 (UTC)

I think we are seeing a zoom out of some image. Perhaps it is the arm of Cueball? --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:36, 12 January 2022 (UTC)
:It looks like there's a little curve at the top left of the line entering the frame! This makes the Cueball arm hypothesis more likely. [[User:Sure|Sure]] ([[User talk:Sure|talk]]) 14:18, 12 January 2022 (UTC)
::I also noticed that (and moved your comment up here, as it is kind of a reply to that). Seems like the picture updates every four hours, and that it happened last time at noon UTC today. And thus it will also be at midnight. So 4, 8, 12, 16, 20 and 24. But it is not certain yet and not sure it happened like that the first day or two. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 14:46, 12 January 2022 (UTC)

I have added the first 12 images on this page: [[Countdown in header text/images]] - anyone may help uploading the new ones there. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:43, 12 January 2022 (UTC)
: Thank you! [[Special:Contributions/173.245.52.194|173.245.52.194]] 12:44, 12 January 2022 (UTC)

Does anyone mind if I make a few spelling/grammar corrections to the article? It feels like the kind of thing that could be interpreted as rude, so I wanted to ask first. [[Special:Contributions/172.70.114.167|172.70.114.167]] 13:00, 12 January 2022 (UTC)
:No no please help me with my poor spelling. I'm Danish and not very good at spelling in English. Also anything I write is up for debate and can be changed. Just because I started this page do not give me ownership over it. As long as relevant info is not deleted the entire layout maybe changed. But better to get the page going sooner rather than later.--[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 14:46, 12 January 2022 (UTC)
::Alright!! Thank you so much for all your great work on this page! [[Special:Contributions/172.70.110.151|172.70.110.151]] 18:02, 13 January 2022 (UTC)

I originally put this (without realising it wasn't the Talk page) in the Images sub-page, in response to the revelation it was (very probably) the SHA256 of the image data that was used to name the file:
*When I first looked at it and decided it was an obvious hash (yes SHA256 sounds about right, but nice to know someone's tried it) I personally had hoped it would be a hash of the datetime (plus a salt, maybe, to give it that extra little frisson of difficulty in reverse engineering... ;) ). But if it's as you say I think I'll refrain from getting any rainbow-tables set up and bashing through the possibilities in the rather huge phase-space it could represent. Of course, there must be a look-up table used by the server. It'd be too much to hope for that it's publically exposed though, and totally a rookie-error if it is. (That Randall, and maybe anyone he actually drafted in to implement it to save himself the worry, is surely not going to commit.)
...anyway, bringing it here, as being more conversational than informative. Still thought I should say it, but stupidly long as a comment so maybe I needn't have repasted it again! [[Special:Contributions/172.70.85.79|172.70.85.79]] 03:39, 13 January 2022 (UTC)

(Put this in here as it was before in the explanation --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 12:02, 13 January 2022 (UTC):)
Was going to say it's Hangman, but it looks like it's zooming in on the diagonal instead of continuing to make a gibbet. [[User:Thisfox|Thisfox]] ([[User talk:Thisfox|talk]]) 06:37, 13 January 2022 (UTC)

I read the javascript of the countdown and noticed one thing that i didn't see mentioned anywhere on this page: the countdown text is moving upwards. When the countdown started the text was exactly in the middle of the image and at the end of the countdown the text will be at the top (you can see how it will look by changing the time in your system). The code will also make the text disappear and leave only the image after the countdown goes to zero. [[Special:Contributions/162.158.90.41|162.158.90.41]] 23:52, 13 January 2022 (UTC)

The Greensboro sit-ins started on Feb 1, though the time is different.. But black history month?

Talk:2543: Never Told Anyone

2021-11-19T01:26:32Z

Angel:

Possible alternative explanation: It's a quick one-time two-factor authentication code that is generated with an app like google auth, or sent by sms, and is only valid for a minute or too. A password would still be needed,and therefore it would be almost completely useless.
[[User:Billsmithsmithbill22|Billsmithsmithbill22]] ([[User talk:Billsmithsmithbill22|talk]]) 02:16, 18 November 2021 (UTC) Bill Smith
:That's how I interpreted it, too. Password recovery links are usually very long strings, not just 6 digits. The joke is that the email or SMS with the 2FA code usually warns not to disclose the code, even though it can't be reused. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 02:43, 18 November 2021 (UTC)
:Some Services offer a form of 2FA where they give you a list of 10 one time passwords / back-up codes that are valid indefinitely and are supposed to be printed out, in case access to the phone is lost. The generally romantic atmosphere of the comic makes me feel the number is more like that, especially since she also offers him her password in the alt-text. [[User:Ruffy314|Ruffy314]] ([[User talk:Ruffy314|talk]]) 10:39, 18 November 2021 (UTC)

263827 is prime, is that worthy of a mention? {{unsigned}}
:If you think it is a factor! (...of a semiprime, maybe.) [[Special:Contributions/172.70.90.141|172.70.90.141]] 03:48, 18 November 2021 (UTC)

Could "I never told anyone *this* before" be a wordplay on the fact that it is a one-time code, which means if she told anyone else before it would have been a different one?
[[Special:Contributions/172.68.110.133|172.68.110.133]] 03:55, 18 November 2021 (UTC)

The number here is 263827. In the original Star Wars movie, the trash compactor that the main characters get stuck in is numbered 3263827. Any chance that this is an incredibly obscure Star Wars reference? (I figure since one-time codes are usually six digits, using that full seven-digit number would be a bit of a distraction.) [[User:Ghostelephant|Ghostelephant]] ([[User talk:Ghostelephant|talk]]) 05:01, 18 November 2021 (UTC)
No way that's a coincidence! That is simply too unlikely to be an accident.[[Special:Contributions/172.70.178.123|172.70.178.123]] 08:14, 18 November 2021 (UTC)
:How on earth did you figure this out? Do you just happen to know the number of that trash compactor? And if so, how? And why? For me this comment raises way more questions than the comic did. [[User:Bischoff|Bischoff]] ([[User talk:Bischoff|talk]]) 10:58, 18 November 2021 (UTC)
::Though I'm not as obsessive with Star Wars to know this particular number, I know that the THX 1138 4EB meme pops up again throughout Lucas's later oevre, and (like just the other day) gets co-opted referentially by the Randalls of this world. Forty-odd years of obsession by generations of fans would not leave a single remastered pixel/unremastered grain of footage unanalysed of every last detail. I've personally used "6EQUJ5" as an obscure reference, at times, and had others have known/worked out what I was echoing (even before Google) and that's from a far more transient source... [[Special:Contributions/172.70.90.211|172.70.90.211]] 11:35, 18 November 2021 (UTC)
::: 6EQUJ5 is no longer considered a one time code. In the 70s, it was inexplicable, but since then it has been found again. In fact, it is not considered to have a unique source. [[Special:Contributions/172.70.82.111|172.70.82.111]] 20:20, 18 November 2021 (UTC)

Aren't one time codes also used for Bluetooth pairing? If so, couldn't this be considered a marriage proposal? --[[User:Divad27182|Divad27182]] ([[User talk:Divad27182|talk]]) 13:49, 18 November 2021 (UTC)
:If that's what you consider a proposal, I fear you will have plenty trouble finding a spouse----
:I was thinking of something along those lines. They don't say what service the code is for, so it gave me a kind of weird train of thought like "this is a code that will give you access to ''me'', but only if you use it right away". Was wondering if anyone else was thinking along those lines [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 01:26, 19 November 2021 (UTC)
Can some tell me why this comic is *still* in List of all comics even though it's number 2543, and so should be in the next page (2501-3000) --[[User:GcGYSF(asterisk)P(vertical line)e|GcGYSF(asterisk)P(vertical line)e]] ([[User talk:GcGYSF(asterisk)P(vertical line)e|talk]]) 19:42, 18 November 2021 (UTC)

Talk:2519: Sloped Border

2021-09-24T09:21:14Z

Angel:

I might be old-fashioned, but I've always wanted to live in Mandelbrotistan 3D. [[Special:Contributions/162.158.89.156|162.158.89.156]] 15:49, 23 September 2021 (UTC)

I would make the country's border an Alexander horned sphere. [[Special:Contributions/108.162.221.245|108.162.221.245]] 03:21, 23 September 2021 (UTC)

:Waaait ... how can we define the border to maximize area of both countries? I'm talking non-measurable sets invoking something like {{w|Banach–Tarski paradox}} here ... -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 00:01, 24 September 2021 (UTC)

At least this border doesn't have [https://youtu.be/Mw44wHG4KOc thickness]. --[[User:Angel|Angel]] ([[User talk:Angel|talk]]) 04:48, 23 September 2021 (UTC)
-yet [[Special:Contributions/172.69.55.107|172.69.55.107]] 05:46, 23 September 2021 (UTC)

GIS: Geographic Information System, that are the systems where maps (and the borders) are defined. They won't care much though, because for them the ground information is the relevant one.
Once you get into air, you'll get a problem, because if the border is very sloped, and not in average straight, then an airplane might still be in the airzone of a different country than where it's flying over. Which will cause all kinds of problems, security wise.
Liechtenstein might loose all control over its airspace, yet their inhabitants want safety even from aircraft flying above them.
Can't imagine that going well, but bureaucrazy is that: it creates paperwork when it is not busy enough with the procedures it already created. [[Special:Contributions/172.69.55.107|172.69.55.107]] 05:46, 23 September 2021 (UTC)

Liechtenstein and air control is a bad example for the problems with sloped borders because it's quite often the case that the air space of one country is done by air space controllers of another country. In the case of Liechtenstein this is done by SKYGUIDE in Switzerland that is also doing it for southern parts of Germany (being responsible for the collision of two planes near Überlingen: https://en.wikipedia.org/wiki/2002_%C3%9Cberlingen_mid-air_collision) [[Special:Contributions/162.158.89.156|162.158.89.156]] 06:34, 23 September 2021 (UTC)

Wouldn't sloped borders also have interesting consequences underground when mining, building tunnels etc. ? [[Special:Contributions/162.158.88.239|162.158.88.239]] 08:39, 23 September 2021 (UTC)

I introduced into the explanation a hint of the more precise problem with airborne geometry upon spherical (or, possibly, geodesic) coordinates. The shallower the angle, the more possible that the 'curves with the ground' altitude calculation is to actually wrap itself all the way round the Earth before (presumably), whatever altitude limit there is to make space the same upper edge as International Waters are to horizontal edges. Taking the Liechtenstein case, as above, you could easily enclose them in a 'pyramidal' (or wedged, if not applied from all around them) air-claim by angling over them - ''or'' greatly increase their air-claim over neighbours if the angle is away. With inverse issues for the Mineral Rights issue. You need to agree in advance what happens when angled boundaries hit perpendicular ones, ''and'' whether the 'rhumbs' projected from the border mash together when equidistant points on a crinkly border project their own air-distance line. ''And'' if it is from an agreed surface level datum or local ground level, with the complications that arise from both cases. (Yeah, I originally thought there were about four different bones of contention that need to be ironed out in the codicil on curvature, but I now think there's about six of them needing strict definition, not counting the compound cases which further may need specifying in advance or forever requirev adhoc arbitration.) And none of this even takes account of Relativity and curved ''space'' frame of reference that might very subtly shift whatever reference you just agreed upon, if you let it go high enough. [[Special:Contributions/172.70.34.165|172.70.34.165]] 12:05, 23 September 2021 (UTC)

Should there be a part of the explanation talking about how GIS is already a nightmare? Because the hobby is "_new_ ways to make life a nightmare" [[Special:Contributions/162.158.75.159|162.158.75.159]] 13:35, 23 September 2021 (UTC)
:There should ; I expect it's because the borders are often defined by natural features, which may be very detailed AND changing in time. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 00:06, 24 September 2021 (UTC)

It's not worth wondering: is the boarder sloped across cardinal directions, like East to West, or is it sloped inward or outwards from the country in question? If the latter, outwards will make it like a funnel, meaning country A has greater airspace than its surface area at "ground" level. (Which is another consideration: where does the initial angle begin?) If sloped inwards, well then that country loses a lot of advantage. If it's based on cardinal directions... I do not want to consider how many complications that would create along various sections of the border. [[Special:Contributions/108.162.219.51|108.162.219.51]] 16:55, 23 September 2021 (UTC)

:Also, NERD SNIPE! [[Special:Contributions/108.162.219.51|108.162.219.51]] 16:56, 23 September 2021 (UTC)
:My presumption would be that the line-on-the-ground, however it winds around (e.g. following the centre of a river, the apex of a ridge or the point-to-point (with or without Great Circle adjustment) between two defining nodes) is a sequence of presumed horizontal line segments of arbitrary length, normalised to be parallel to the horizontal at the whatever ground elevation they cross. That line and the perpendicular through that line from the centre of the Earth (the vertical, by all accounts) thus define the third mutually perpendicular line that is the 'slopeward'(/antislopward) baseline. The defined angle indicates the inclination from the vertical on the vertical/slopeward plane.
:Where landforms complicate matters the border rises or falls across contours, or twists and turns with a convex and/or concave groundtrack, the dominant inclined border is that originating from the closest source-point wherever there is potentially conflict.
:If Cueball's border was around an enclave otherwise within his area of control, this would result in a tent-like (but strangely irregular) territorial enclosure (assuming not truncated by the Karman Line 'air limit', or similar). But I think he's content to make this just ''any'' shared border (e.g. the mostly 'straight' US-Canada fifty-whatever-parallel one) which means probably all other territorial limits (in that case, maritime) remain vertical (certainly not similarly leaning, in non-right-prismatic form) and except in a ''very few'' edge cases would end up dominating the slope-vs-vertical intersections.
:As to 'advantage' (except for the territory sloped away from), I don't think there really is one. At best, it makes true geofencing of drones a bit more complicated than saying "don't cross this line; don't go above/below these altitudes" for some doubtless functional reason. For the people in the RHS 'illustrative' sub-image, it seems to have no practical effect other than to identify limbs/other extremities as cross-border in rather more unusual slices of the body than a normal border-straddler would expect. [[Special:Contributions/162.158.159.11|162.158.159.11]] 22:33, 23 September 2021 (UTC)
Hmm, defining the calculation of the slope is tricky indeed. The commenter above suggests that the slope is relative to "vertical". However, the interpretation of "ground level" could deal with "level" meaning the ground slope, not the ground height. In other words, consider the slope on the side of a mountain. Let's suppose that in a local area, with a section of border running north/south, the ground is sloped 30 degrees to the east. Does that mean the 74 degree border is 104 degrees to the east at that point? The ground changing shape (whether due to natural erosion or bulldozers) could change the borders significantly.[[Special:Contributions/108.162.246.220|108.162.246.220]] 00:01, 24 September 2021 (UTC)

Sloped borders wouldn't be so weird, if the 3D component of the borders would follow the same rules as most 2D sea borders would do, which is that the border lies at a line of points equidistant from the coastlines.
If country A is flat and B has a mountain range and the border is at the foot of this mountain range which has a 30° slope, the border would be at a 15° slope inward from being perpendicular (to sea level) leaning in on A. [[Special:Contributions/141.101.77.144|141.101.77.144]] 04:51, 24 September 2021 (UTC)

Borders are usually vertical; what definition of "vertical", though? Some geodetic system? (Which one?) Local plumb line? Something else? [[User:Sabik|Sabik]] ([[User talk:Sabik|talk]]) 06:48, 24 September 2021 (UTC)

Just had the additional thought that this is probably creating additional borders, which will need more treaties. If the sloping border is quite shallow, there's a chance that the country on the left (with more airspace than ground) will now have an airborne border with whatever country is on the far side of the country on the right. And conversely for the mineral rights issue, the country on the right may now have an underground border with whatever country is on the far side of the one on the left. How does international law deal with a border treaty between two countries causing a non-signatory to have an extra border with one of them? Would those countries need to be consulted? --[[User:Angel|Angel]] ([[User talk:Angel|talk]]) 09:21, 24 September 2021 (UTC)

Talk:2519: Sloped Border

2021-09-23T04:48:57Z

Angel:

I would make the country's border an Alexander horned sphere. [[Special:Contributions/108.162.221.245|108.162.221.245]] 03:21, 23 September 2021 (UTC)

At least this border doesn't have [https://youtu.be/Mw44wHG4KOc thickness]. --[[User:Angel|Angel]] ([[User talk:Angel|talk]]) 04:48, 23 September 2021 (UTC)

Talk:2490: Pre-Pandemic Ketchup

2021-07-17T10:39:34Z

Angel:

is this cueball or randall? [[Special:Contributions/173.245.54.235|173.245.54.235]] 15:47, 16 July 2021 (UTC)Bumpf
:It's Randall writing pandemic comics (which aren't nearly as funny or quirky as some of his earlier work). I wouldn't mind it so much if he somehow included the more nerdy/geeky aspects (like maybe something to do with the genome, or with computer science, etc.). [[Special:Contributions/172.68.143.4|127.0.0.1]] 16:34, 16 July 2021 (UTC)
::What's with the weird signature? If you really want to be localhost, I don't think there's anything to stop you registering 127․0․0․1 as a username, but manually entering a signature with a link to the wrong contributions page is a little weird. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 10:39, 17 July 2021 (UTC)

i don't get it. ketchup keeps basically forever. i'd consider a bottle from early 2020 practically fresh. [[Special:Contributions/162.158.92.182|162.158.92.182]] 19:58, 16 July 2021 (UTC)
: I don' think the issue is "freshness", but that Cueball panic bought a "new" or "strange" brand, that they no longer are interested in trying or eating. Compare to the title text "discard the last weird food item". [[Special:Contributions/172.70.98.2|172.70.98.2]] 20:53, 16 July 2021 (UTC)
: Ketchup keeps basically forever when refrigerated. Not everybody does that (though I do). [[Special:Contributions/108.162.245.222|108.162.245.222]] 07:31, 17 July 2021 (UTC)

I even have pre-apprenticeship sugar sprinkles. And I'm currently in my third job. [[User:Fabian42|Fabian42]] ([[User talk:Fabian42|talk]]) 21:48, 16 July 2021 (UTC)

My reading of it is that they ''once'' might have bought that brand (maybe regularly, maybe as a 'try it and see'), and yet for some reason (perhaps through a combination of other people panic buying in the early days, later on just rushing in and out of stores with what is truly wanted, any online/curb-pickup options being more limited or just less compulsive buying without lingering by those oh-so-attractive "end of shelf" consumer-trap displays) it was not bought again as various degrees of lockdowns hit. (It also seems not to have suffered the fate of "we haven't had a proper shop in days, how about if we combine our last tin of soup with those cornflakes and further drench it with whatever random sauces we can find?" first-world-problem desparation. Maybe it was just ''too'' far back in the cupboard, crushed behind the tons of panic-bought toiletroll/etc?). Whatever the full implications of its existence, there's clearly no nostalgia for it. Or a new favourite has been adopted after discovering it as a promoted item by the online shopping site, and this older and less exciting ketchup just aint gonna cut the mustard any more? ...but there's a lot of "if"s and "or"s and "maybe"s in my interpretation, and I have no confidence I'm consistently, or even partially, interpretting it as it was intended to be. [[Special:Contributions/141.101.98.152|141.101.98.152]] 22:03, 16 July 2021 (UTC)

Is it worth mentioning that this appears to be the very kitchen from 2178: Expiration Date High Score? [[User:Nitpicking|Nitpicking]] ([[User talk:Nitpicking|talk]]) 02:18, 17 July 2021 (UTC)

Talk:2480: No, The Other One

2021-06-24T08:37:31Z

Angel:

We might want a table for this comic, with three columns: one for the name of the town, one for which state the copycat is in, and one for the original. We could also add a column for "why the original is well known," but that might be a bit much. [[Special:Contributions/108.162.245.124|108.162.245.124]] 20:38, 23 June 2021 (UTC)
: I agree, this feels like a very table-able comic. Especially to get all the cities and not make readers try to see "hey, did I miss one?" [[Special:Contributions/172.70.117.158|172.70.117.158]] 20:49, 23 June 2021 (UTC)
:: I think the term copy-cat should not be used here, since Lincoln, IL, for instance is older and carries the name longer than Lincoln, NE.--[[Special:Contributions/162.158.88.74|162.158.88.74]] 21:05, 23 June 2021 (UTC)
::: Although the people in Lincoln, UK (also Boston, Washington, Richmond, Plymouth, Newhaven...) might have prior claims - Richmond is an even more interesting case, in fact. And of course I also recognise Lisbon and others. [[Special:Contributions/141.101.98.244|141.101.98.244]] 21:26, 23 June 2021 (UTC)
:::: May I suggest merging the first two columns and just listing [City, State] under "Place name in comic"? [[User:MajorBurns|MajorBurns]] ([[User talk:MajorBurns|talk]]) 21:38, 23 June 2021 (UTC)

In the map there are (at least) three Lincoln, two Jamestown, five Houston... [[User:Vdm|Vdm]] ([[User talk:Vdm|talk]]) 20:52, 23 June 2021 (UTC)
: There is a Jamestown in NY and PA also. I would expect to find a Jamestown in at least half of the states. [[User:Rtanenbaum|Rtanenbaum]] ([[User talk:Rtanenbaum|talk]]) 22:06, 23 June 2021 (UTC)

There seems to be an extra dot in the northeast corner of Colorado - It looks like it might correspond with the Atlanta label, but there is no Atlanta in Colorado. Based on the position of the dot I'm guessing it may correspond to Akron or Yuma.--[[User:MajorBurns|MajorBurns]] ([[User talk:MajorBurns|talk]]) 21:56, 23 June 2021 (UTC)
: Google Maps says there's an Atlanta, Colorado, but it is in the south-east corner of the state, not where the dot is. It looks like it is in the middle of nowhere outside of Springfield. [[User:Blaisepascal|Blaisepascal]] ([[User talk:Blaisepascal|talk]]) 00:42, 24 June 2021 (UTC)

Jersey Shore PA - I just drove from New Jersey across the state of Pennsylvania, and saw the sign for Jersey Shore in the mountains in the middle of PA. What the? Turns out there was a town founded by two brothers from New Jersey called Waynesburg. When a neighboring town wanted to insult them by calling them "Jersey Shore" they went ahead and officially made Jersey Shore the name of the town. [https://en.wikipedia.org/wiki/Jersey_Shore,_Pennsylvania https://en.wikipedia.org/wiki/Jersey_Shore,_Pennsylvania]. I wonder how many people turn off the highway in the middle of PA wanting to go to the Jersey Shore hundreds of miles away. [[User:Rtanenbaum|Rtanenbaum]] ([[User talk:Rtanenbaum|talk]]) 22:06, 23 June 2021 (UTC)

Why no Hollywood, Florida? [https://en.wikipedia.org/wiki/Hollywood,_Florida https://en.wikipedia.org/wiki/Hollywood,_Florida]
: Same reason there's no Richmond, Dublin, or Pittsburg (admittedly, a different spelling), California, just to name some of the closest ones to me. The map would be solid black if it labeled every "other one." [[User:Borglord|Borglord]] ([[User talk:Borglord|talk]]) 01:57, 24 June 2021 (UTC)

..''No'' Springfields? Really? There's gotta be 30+ of them! [[User:Danish|Danish]] ([[User talk:Danish|talk]]) 02:00, 24 June 2021 (UTC)
:The comic doesn't seem to include the duplicates that are fairly well known, like Hollywood, FL. And the prevalence of Springfield is well known due to "The Simpsons". I think Groening chose that name ''because'' it wouldn't be associated with any particular state. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 04:06, 24 June 2021 (UTC)

`The most frequently occurring community name varies through the years. In a past year, it was "Midway" with 212 occurrences and "Fairview" in second with 202. More recently, "Fairview" counted 288 and "Midway" 256. The name "Springfield" is often thought to be the only community name appearing in each of the 50 States, but at last count it was in only 34 states.` https://www.usgs.gov/faqs/what-most-common-citytown-name-united-states [[User:Steve|Steve]] ([[User talk:Steve|talk]]) 02:48, 24 June 2021 (UTC)

The comic has been updated to remove Charlestown and move Salem, CT. The extra dot in Colorado remains, however. The image attachment has been updated, but I think I'm still seeing the cached version. [[User:Orion205|Orion205]] ([[User talk:Orion205|talk]]) 03:47, 24 June 2021 (UTC)

Since so many of the names are duplicated multiple times, shouldn't the title be "No, ''An'' Other One"? [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 04:06, 24 June 2021 (UTC)

I'm surprised he missed Minneapolis, Kansas (about 75 miles west of Manhattan). Though maybe it would've made Kansas too crowded. --[[User:Aaron of Mpls|Aaron of Mpls]] ([[User talk:Aaron of Mpls|talk]])

I'd like to see a map of all these. Lines linking each of the dots to the location of the more famous town. Possibly with lines in different colours connecting to the oldest and largest other ones, where they're not the same as the most famous one. (I suspect a significant number of the "oldest" lines would point off the right edge of the image) [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 08:37, 24 June 2021 (UTC)

Talk:2434: Vaccine Guidance

2021-03-09T10:46:50Z

Angel:

Wow, I'm so early, there isn't even a transcript yet. [[Special:Contributions/162.158.74.139|162.158.74.139]] 04:43, 9 March 2021 (UTC)

Me too - neat (I guess this means I refresh xkcd too often) [[Special:Contributions/172.69.23.55|172.69.23.55]] 04:52, 9 March 2021 (UTC)

My Computer Is Not Able To Transmit Any Malware Via PlainText. I Guess I Can Already Type In All Caps. [[Special:Contributions/141.101.76.80|141.101.76.80]] 07:06, 9 March 2021 (UTC)

I wonder if this comic also plays on the fact that when guidance is issued, people often immediately ask if they can do something not fully covered by it. They are then surprised by speakers response and try again usually resulting in the speaker changing the subject [or ending the chat as in this case]? [[User:Fan2012|Fan2012]] ([[User talk:Fan2012|talk]]) 07:23, 9 March 2021 (UTC)

Shouldn't the second women who speaks be classified as Hairbun and not Ponytail? [[User:Kvarts314|Kvarts314]] ([[User talk:Kvarts314|talk]]) 09:21, 9 March 2021 (UTC)
:The aforementioned reclassification has been achieved. [[Special:Contributions/162.158.159.128|162.158.159.128]] 10:15, 9 March 2021 (UTC)

Is it possible that the title-text is referring to the disease spread via telephones (and their lack of sanitisers) in the Hitch-hiker's Guide to the Galaxy? [[Special:Contributions/162.158.159.128|162.158.159.128]] 10:15, 9 March 2021 (UTC)

Wasn't there a comic in the same vein of "can't wait to do [ridiculous thing] once vaccinated" a while back? Might be worth a mention. [[Special:Contributions/162.158.74.239|162.158.74.239]] 10:18, 9 March 2021 (UTC)
:Found it, it's [[2391:_Life_Before_the_Pandemic|2391: Life Before the Pandemic]]. [[Special:Contributions/162.158.74.239|162.158.74.239]] 10:22, 9 March 2021 (UTC)

I was seriously expecting the title text to be something about riding a horse down the stairs in a family member's house; or possibly about how to get your horse vaccinated -- [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 10:46, 9 March 2021 (UTC)

Talk:2393: Presidential Middle Names

2020-12-03T11:33:53Z

Angel:

I wonder where Hussein comes in in the official rankings. [[User:Orion205|Orion205]] ([[User talk:Orion205|talk]]) 04:16, 3 December 2020 (UTC)

Gamaliel sounds like an Elvish name...[[Special:Contributions/108.162.216.128|108.162.216.128]] 05:03, 3 December 2020 (UTC)
: No, it's a {{w|Gamaliel_Ratsey|highwayman}}. [[Special:Contributions/162.158.155.24|162.158.155.24]] 10:54, 3 December 2020 (UTC)

For the record, this was his paternal grandmother's maiden name. [[User:RAGBRAIvet|RAGBRAIvet]] ([[User talk:RAGBRAIvet|talk]]) 09:18, 3 December 2020 (UTC)

My understanding of the title text is that Hayes was previously in 3rd position, but has been demoted to 4th and no longer appears in the top 3, not that he is at the bottom of the list.[[Special:Contributions/141.101.99.243|141.101.99.243]] 09:39, 3 December 2020 (UTC)
::The title text literally says "The bottom of the list". How can you read that as not meaning "the bottom of the list"??? [[Special:Contributions/141.101.69.153|141.101.69.153]] 10:44, 3 December 2020 (UTC)

I think someone needs to do a survey; maybe run a bracket or something, to see if public opinion matches Randall's list. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 11:33, 3 December 2020 (UTC)

Talk:2389: Unread

2020-11-24T11:34:44Z

Angel:

I have 27,333 unread emails. On the level of "Your email is important to me. Please wait and it'll get read eventually." [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 00:25, 24 November 2020 (UTC)

Oh hai! https://i.imgur.com/FXt1AYq.png lol [[Special:Contributions/172.68.142.195|172.68.142.195]] 10:17, 24 November 2020 (UTC)

This graph seems way off to me. It says 'percentage of messages', so the highest point should be at the far left. At some point, you will have a single message saying "Welcome to WhateverMessagingService", which will initially be unread, therefore 100%. When he's standing at the beginning looking at the icon that says 2 messages, that's probably 2 out of 3, or 2 out of 4. It could be back up at 100% depending on the service (does it auto-delete read notifications?), but it's likely lower than at the start. But for the first few weeks, I'd expect to see a series of tall peaks, gradually getting lower as the number of old read messages slowly increases, with flat valleys inbetween where everything is read. Then as you get into the habit of putting off reading them, the valleys start getting shallower until they swallow the peaks, and you get a slowly rising curve that eventually levels off pretty high.
This graph seems to rise forever at the end, which makes sense for a graph of the ''number'' of messages, but not for a ''percentage''. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 11:34, 24 November 2020 (UTC)

Talk:2377: xkcd Phone 12

2020-10-27T12:44:05Z

Angel:

Is there any way to install the Vengaboys feature on my own phone? It's pure genius
::(Above unsigned comment was clearly being replied to by the following. Tidying up by moving my own signed comment about coatings.) [[Special:Contributions/162.158.158.171|162.158.158.171]] 12:39, 27 October 2020 (UTC)
:Perhaps by taking data from infrared sensors and microphones, an app could automatically start the song? Might have some interesting copyright issues, tho idk how those things work … [[Special:Contributions/162.158.63.124|162.158.63.124]] 23:57, 26 October 2020 (UTC)

If it's coated for easy swallowing, perhaps it's actually a tablet... [[Special:Contributions/162.158.155.54|162.158.155.54]] 22:50, 26 October 2020 (UTC)
:Now officially entered in Explanation. [[Special:Contributions/162.158.158.171|162.158.158.171]] 12:39, 27 October 2020 (UTC)

Disabling the screen is a real feature (though it's called screen curtain on iOS https://support.apple.com/en-ca/HT201443). {{unsigned|108.162.241.70}}

The 600LB magnet doesn't weigh 600 pounds, it's strong enough to hold 600 pounds. And if you used the interlocking feature, and it doesn't explode, you'd never be able to pull the phones apart. [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 01:42, 27 October 2020 (UTC)
:I just looked up 600 lb fishing magnets on Amazon.com. They weigh a couple lbs. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 05:05, 27 October 2020 (UTC)
:From what we've learned about xkcd-Phones so far, I wouldn't be surprised if the magnet actually weights 600 lb. [[Special:Contributions/108.162.229.91|108.162.229.91]] 11:23, 27 October 2020 (UTC)

I would actually buy something with Game Boy Printer compatibility. [[User:Unpopular Opinions|Goodbye, world!]] ([[User talk:Unpopular Opinions|talk]]) 03:49, 27 October 2020 (UTC)

John MacAfee fled Belize (and the Belize police) when he was wanted for questioning as a “person of interest” in the murder of Gregory Viant Faull. I suspect that that is part of why Randal posits an attack from John MacAfee (and defense from Peter Norton, who (unlike John) hasn’t completely lost his mind). I think he is also on the run from Spanish authorities for tax evasion.[[Special:Contributions/173.245.54.136|173.245.54.136]] 04:33, 27 October 2020 (UTC)

:I think there should be some explanation of who these people are. I could assume that they're the founders of the companies of the same name, or look it up, but the explanation should probably mention it. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 12:44, 27 October 2020 (UTC)

Don't many mobile games use shaking as a way to reset or roll the dice? [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 05:04, 27 October 2020 (UTC)
:Also Moto phones use shaking to turn on the flashlight. [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 05:19, 27 October 2020 (UTC)

The tactical helium reserve might prove problematic if [https://www.reddit.com/r/sysadmin/comments/9si6r9/postmortem_mri_disables_every_ios_device_in/ the phone uses MEMS for timekeeping].
:(Great link, but unsigned...) Helium's a wonderful substance. Everyone speaks highly of it! [[Special:Contributions/162.158.158.171|162.158.158.171]] 12:39, 27 October 2020 (UTC)

"Coated for easy swallowing" could be referring to ambiguity between 'tablet (pharmacy)' and 'tablet computer' (which is quite similar to a phone). [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 12:44, 27 October 2020 (UTC)

Talk:2375: Worst Ladder

2020-10-23T00:41:44Z

Angel:

Their ladder is obviously placed somewhere where they all have to walk under it to get into the boardroom. [[Special:Contributions/162.158.158.247|162.158.158.247]] 00:59, 22 October 2020 (UTC)

I find it extremely pleasing that within 20 minutes the XKCD itself in on the front page of Google results [[Special:Contributions/108.162.237.4|108.162.237.4]] 01:09, 22 October 2020 (UTC)

Google searches gonna be skyrocketing for "Worst Ladder". --01:24, 22 October 2020‎ (UTC) 198.41.238.108 (Please sign your comments)
:Can definitely see when the comic was posted [https://trends.google.com/trends/explore?date=now%201-d&q=worst%20ladder]. Maybe we should add a screenshot to the trivia section --[[User:Luckykaa|Luckykaa]] ([[User talk:Luckykaa|talk]]) 07:16, 22 October 2020 (UTC)

Can someone create a category for "business"-related comics? There are quite a few (some related to Beret Guy's businesses, but others just general). [[Special:Contributions/172.69.33.37|172.69.33.37]] 01:31, 22 October 2020 (UTC)

Can someone confirm if this comic is related to Quibi's shutdown announcement? Because if it isn't, then it's one major coincidence. [[User:Aderon|Aderon]] ([[User talk:Aderon|talk]]) 01:50, 22 October 2020 (UTC)
:I'm not entirely sure of the parallels but I'd love them to be in the article--[[User:FrankHightower|FrankHightower]] ([[User talk:FrankHightower|talk]]) 02:07, 22 October 2020 (UTC)

I thought someone had added a practical screenshot of Google's "worst ladder" search, before realising it was one of the inline Google-powered ads, this one 'aptly' for a certain popular online auction site which illustrated various ladders apparently up for sale upon its platform.... [[Special:Contributions/141.101.107.82|141.101.107.82]] 01:55, 22 October 2020 (UTC)
:I tried doing it, but it says I'm not allowed--[[User:FrankHightower|FrankHightower]] ([[User talk:FrankHightower|talk]]) 02:07, 22 October 2020 (UTC)
:: I saw that link (yours?) too, and appreciated it. Now, being just an IP I'm fairly sure I'd not be allowed to upload media to the Explain wiki, but I know it's been possible for others. Like with created highlights of the XKCD Garden, IIRC. But maybe it isn't automatic to all usernames but time/authorisation-prompted, after a certain length of engagement. Maybe the answer lies in the Community Portal, or the question could be asked there if not. [[Special:Contributions/162.158.158.225|162.158.158.225]] 02:46, 22 October 2020 (UTC)

I've got a screenshot of "Worst Ladder" GIS results taken around 02:45 UTC. Would it be worth adding to the wiki, and is there a way to upload it here? [[User:GreatWyrmGold|GreatWyrmGold]] ([[User talk:GreatWyrmGold|talk]]) 02:49, 22 October 2020 (UTC)
:Update: Even searching "worst ladder -xkcd" (which should remove all pages mentioning xkcd) has resulted in the xkcd comic coming up.

I kept feeling like I was missing some more specific reference about what company could possibly find itself replaced by "worst ladder" searches. Like, it's so specific it doesn't feel like "welp, all media companies are SOL because everyone just likes ladders now", it feels like this company was somehow in a niche that was uniquely affected...but I can't imagine what that niche could be haha.[[User:Jerodast|- jerodast]] ([[User talk:Jerodast|talk]]) 03:31, 22 October 2020 (UTC)
:No, I think "worst ladder" is just a stand-in for any random (and absurd) internet hype. I mean, who would ever be interested in watching people randomly pouring buckets of ice water over their heads... [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 06:56, 22 October 2020 (UTC)

I moved the Google Image Search part to the Trivia section. The actual results of such a searhc are imho not relevant for explaining the comic. [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 08:14, 22 October 2020 (UTC)

Also try "worst wheelchair ramps." [[User:Probably not Douglas Hofstadter|Probably not Douglas Hofstadter]] ([[User talk:Probably not Douglas Hofstadter|talk]]) 12:34, 22 October 2020 (UTC)

I thought the reason for the disastrous Home Depot tie-in was the lawsuits that resulted from people buying Worst Ladders (tm) and having accidents. --[[User:Itub|Itub]] ([[User talk:Itub|talk]]) 13:24, 22 October 2020 (UTC)

I find it so jarring to see XKCD mention TikTok. For whatever reason, I associate XKCD with the 'old interenet', which obviously doesn't include TikTok. -neverdroptop 15:46, 22 October 2020 (UTC)
: xkcd may be "old internet," but it's still on the "new internet". Randall Munroe's been around here a while, but he ain't out of touch. [[User:GreatWyrmGold|GreatWyrmGold]] ([[User talk:GreatWyrmGold|talk]]) 16:33, 22 October 2020 (UTC)
:: I consider anything from earlier than the Web as Old Internet, anything post-Eternal September to be New Internet, and in-between is a very interesting time. xkcd at its core (before you also consider its official Twitter/etc accounts) is firmly NI, but also definitely Web 2.0(+) in 'vintage'. But with an OI charm quite often lost in today's electronic biosphere. I don't think there's anything wrong with Randall commenting on the latest (or potentially so) Social Media platforms, or participating. I suppose a usenet://alt.fan.xkcd presence might be a bit ''too'' 'retro', but... now I think of it, why not? [[Special:Contributions/162.158.155.102|162.158.155.102]] 18:00, 22 October 2020 (UTC)

I performed the "worst ladder" search at 19:00 UTC and the top two search results are the XKCD page, followed by this ExplainXkcd page! We're number 2! Mind you that might be a reflection of how often I visit this site. [[User:Nutster|Nutster]] ([[User talk:Nutster|talk]]) 19:02, 22 October 2020 (UTC)
:At this time, explainXKCD is number 1 for my sister, who doesn't visit this site at all, in incognito mode--[[Special:Contributions/108.162.210.212|108.162.210.212]] 19:49, 22 October 2020 (UTC)

:I'm seeing the explainxkcd copy of the image in first place, the one on xkcd in 4th, and the same comic on 3 other sites on the first screen. Didn't realise there were that many popular mirrors. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 00:41, 23 October 2020 (UTC)

User:Angel

2020-07-26T10:28:49Z

Angel: Created page with "Hello World! I noticed some people seem to have user pages, so thought I may as well create one. My name is Angel. Yes, that's my real name. I'm an autistic hiker, antisocial..."

Hello World! I noticed some people seem to have user pages, so thought I may as well create one.

My name is Angel. Yes, that's my real name. I'm an autistic hiker, antisocial roleplayer, depressive troper, wannabe artist, artistic hypnotist, ace kinkster, and three [https://author.to/angelwedge struggling authors]. I really wanted to pothole all those words, but currently don't have enough inspiration. I never quite got over the loss of Google Plus; and these days an occasional comment on a couple of wikis is about the only interaction I get with other people.

I used to occasionally buy ads on the site before I actually contributed, both for my books and for occasional meta humour. I miss Project Wonderful so much (One site I was on would periodically have image memes show up in the ad space to promote wikipedia pages as varied as [[wikipedia:Electrical disruptions caused by squirrels|Electrical disruptions caused by squirrels]] and [[wikipedia:List of lists of lists|List of lists of lists]]. It was funny. Honest.)

Talk:2337: Asterisk Corrections

2020-07-26T10:14:32Z

Angel:

I think the only spot of the title text quote into which "witchcraft" makes a decent sentence is to replace "next": "I'd love to meet up, maybe in a few days? Witchcraft week is looking pretty empty" [[Special:Contributions/173.245.54.161|173.245.54.161]] 01:02, 25 July 2020 (UTC) Me
:I'd go with replacing "meet up". "I'd love to witchcraft, maybe in a few days? Next week is looking pretty empty." [[User:Orion205|Orion205]] ([[User talk:Orion205|talk]]) 01:14, 25 July 2020 (UTC)
:: "I'd love to meet up, witchcraft in a few days? Next week is looking pretty empty." would be the third interpretation [[User:Multiverse42|Multiverse42]] ([[User talk:Multiverse42|talk]]) 01:39, 25 July 2020 (UTC)
::Or it could be "I'd love to meet up, maybe witchcraft a few days?" Munroe really loves to mess with people. [[User:A|A]] ([[User talk:A|talk]]) 01:43, 25 July 2020 (UTC)
::If it can take out a whole sentence, "I'd love to meet up in a few days. [Magic & calendar shredding sounds, first sentence replaced with witchcraft] Next week is looking pretty empty." would be a pretty satisfying way I would do it IRL. My plan canceling capabilities are absolute witchcraft [[Special:Contributions/172.69.71.82|172.69.71.82]] 08:53, 25 July 2020 (UTC)
: Alternatively, witchcraft replaces maybe: "I'd love to meet up, [how about we practice] witchcraft in a few days?" [[Special:Contributions/162.158.75.66|162.158.75.66]] 02:06, 25 July 2020 (UTC)

A splat? I didn't know that. IME it's just the messed up word resurrected to, summon a beech, auto corrected to the same wrong word. BTW the asterisk on an obsolete keyboard looked like a squished spider, thus 'splat.'

Asterisks can replace multiple words, right? Something like "I'd like to meet up, maybe witchcraft? Next week is looking pretty empty" could work, yeah? [[Special:Contributions/108.162.246.135|108.162.246.135]] 04:36, 25 July 2020 (UTC)
:"I'd like witchcraft? Next week is looking pretty empty." [[Special:Contributions/162.158.159.18|162.158.159.18]] 12:35, 25 July 2020 (UTC)

I have to admit, before reading the title text I was expecting him to either have a sentence with a single replacement which could go in several locations (maybe both a noun and a verb), or a followup text implying that the obvious place to put those corrections wasn't the intended one. This time I feel a little disappointed; a sentence which feels natural with the replacement in several places would have been much more satisfying than one where it's a stretch to find any suitable place. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 10:14, 26 July 2020 (UTC)

Talk:2336: Campfire Habitable Zone

2020-07-23T09:03:12Z

Angel:

Amazingly how similar my aborted (edit-conflicted) edit matched what I found had gazumped me within the prior few minutes. Almost paragraph-for-paragraph on the same topic, with very similar details. Great minds think alike! (Fools never differ...) [[Special:Contributions/162.158.159.100|162.158.159.100]] 01:58, 23 July 2020 (UTC)
:Same thing happened to me. This was my first time trying to submit the main explanation. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 02:11, 23 July 2020 (UTC)
Since the marshmallow's axis of rotation (i.e. the stick) is parallel rather than perpendicular to its orbital plane, it cannot be tidally locked in terms of its rotation. However, for the same reason, one side of the marshmallow, that which is closest to the end of the stick, does always face the campfire. [[Special:Contributions/162.158.62.75|162.158.62.75]] 02:43, 23 July 2020 (UTC)

Take note of how Ponytail is toasting the Marshmallow above the fire with the stick nearly horizontal. In this orientation, the marshmallow typically becomes too gooey inside to maintain traction on a skewer or smooth stick. Rotating the skewer/stick becomes futile as the marshmallow spins relative to the skewer/stick but remains in the same direction relative to the fire, which will be with the heaviest part down due to the earth's gravity. In maintaining the analogy, the more massive side of the marshmallow is attracted to the fire... it has become tidally locked and cannot escape, preventing even toasting of the marshmallow. [[User:Dodgo|Dodgo]] ([[User talk:Dodgo|talk]]) 04:14, 23 July 2020 (UTC)
:you cannot toast marshmallows on a single tip skewer, you need to use a marshmallow fork (which for linguistic reasons that escape me is called a fork despite having only two prongs). Care still must be exercised that the insides don’t become so gooey that the marshmallow falls off, but with a fork you can rotate and brown all sides evenly.[[Special:Contributions/162.158.78.128|162.158.78.128]] 04:20, 23 July 2020 (UTC)
How long a stick would we need to roast marshmallows with the sun? [[User:Probably not Douglas Hofstadter|Probably not Douglas Hofstadter]] ([[User talk:Probably not Douglas Hofstadter|talk]]) 06:25, 23 July 2020 (UTC)

Am I the only person thinking that Cueball left the habitable zone because Megan, trying to get her marshmallow to toast, has just poked him in the face with her stick? [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 09:03, 23 July 2020 (UTC)

Talk:2328: Space Basketball

2020-07-04T12:52:32Z

Angel:

I'd just like to point out that this assumes cueball's odds of sinking a basket remain at 30% after hundreds/thousands of shots. One would think he would improve with practice.
[[Special:Contributions/162.158.62.75|162.158.62.75]] 23:53, 3 July 2020 (UTC)Duban
: Randall expresses as much in the title text. --[[User:NotaBene|NotaBene]] ([[User talk:NotaBene|talk]]) 00:00, 4 July 2020 (UTC)
: The psychological factor is another problem. The pressure of having reached a large number of shots will change how a person performs. Considering how sensitive the overall probability is to small variations in the success rate, this could have a dramatic effect, even if the overall free throw percentage doesn't change. [[Special:Contributions/172.69.70.15|172.69.70.15]] 05:23, 4 July 2020 (UTC)

Cueball's odds of 30 consecutive baskets are 0.3^30 = 2.06*10^-16. Earth is hit by about 6100 meteors per year, and a basketball hoop has a radius of 9 inches. Using that it will be hit about once every 5.09*10^11 years. In order for it to be even, Cueball would have to do approximately one trial every 55 minutes. Since he'll start over each time he misses, it works out to once attempt every 38.6 minutes. [[User:DanielLC|DanielLC]] ([[User talk:DanielLC|talk]]) 00:36, 4 July 2020 (UTC)

(?Almost) no-one in recorded history has been killed by a meteor, so the estimate of 1 in 250,000 is based on a very small chance of a very large number of people dying from something like a "Dinosaur Killer" object, which would not fit through the hoop.

Ok. Area of hoop: 0.166 square meters. Area of earth: 510 million square kilometers, or about 3x10^15 hoops. The Planetary Science Institute thinks 500 meteorites per year; Cosmos magazine think 6100 per year (which will essentially all be small enough to go through the hoop). So we get 5x10^11 or 6x10^12 years for space to score. If Cueball had to do multiple sets of 30 throws and wait until one of those sets was all successes he'd take 5x10^15 attempts, so 1000 or 10,000 attempts per year for a fair game. Which seems ok.

On the other hand, suppose that any 30 consecutive success counts. In that case the waiting time is shorter, but not much shorter. [This](https://math.stackexchange.com/questions/893941/distribution-of-maximum-run-length-of-independent-multinomial-trials) suggests the average time for any 30 consecutive is the same as the average time for batches of 29 when you need to get all 29 in a batch. So the difference is smaller than uncertainties/approximations we're already ignoring

Since almost all meteors are incinerated and reduced to dust upon contact with the earth's atmosphere, it stands to reason that there may already be a (teeny-weeny bit of a) meteor already passing through the hoop. [[User:RAGBRAIvet|RAGBRAIvet]] ([[User talk:RAGBRAIvet|talk]]) 02:40, 4 July 2020 (UTC)

Technically it's still a meteor as it's being put through the hoop. The definition of a meteorite is a meteor that has *reached the surface* and made it through the atmosphere. The basketball hoop is not the surface. It is still a point in the atmosphere. Magma at any arbitrary point before it flows or erupts out of a vent (10 feet before the vent, for example, the same height as the rim of the basket on a regulation hoop) is still called magma and not lava. Therefore the entry should note this and refer to the meteors as such and not improperly as meteorites as the current note does. [[Special:Contributions/108.162.216.124|108.162.216.124]] 07:32, 4 July 2020 (UTC)
: This is what I was going to say, more or less. Though with the additional pondering of hoop-height to atmosphere depth (roughly) proportional to chance of a hoop-scorer attaining "-ite" status soon after. And then *something* *something* about the inherent status of a rim-shot (the chances being an interesting additional function of hoop diameter and the (surviving) cross-sectional width - and what if the latter exceeds the former?)... [[Special:Contributions/162.158.154.71|162.158.154.71]] 10:01, 4 July 2020 (UTC)
:There seems to be some debate about the terminology. I can find definitions that would make it a meteor (meteoroid in space, meteor in the atmosphere, meteorite on the ground) or a meteoroid (if a meteor is the light show rather than the rock itself). [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 12:52, 4 July 2020 (UTC)

According to https://www.nasa.gov/astronauts/pettit_chron_10.html a 2001 study estimated the meteorite fall rate to one meteorite per million square kilometers per year, which yields an expected value of ~6e+12years to score for space. The Cosmos magazine article mentioned above may draw from the same source.

Talk:2309: X

2020-05-21T10:00:33Z

Angel:

id certainly use that language lol ([[User talk:172.69.70.101|172.69.70.101]])

-- haXkell is a X-based dialect of haskell 
X :: Integer -> Integer 
X 0 = 1 
X X = X * X (X-1) 
[[User:Capncanuck|Capncanuck]] ([[User talk:Capncanuck|talk]]) 02:35, 21 May 2020 (UTC)

https://esolangs.org/wiki/X isn't taken. --[[User:Blacksilver|Blacksilver]] ([[User talk:Blacksilver|talk]]) 02:40, 21 May 2020 (UTC)

Some unique looking variable names would be X and x in the fonts Webdings, Wingdings, Wingdings 2, and Wingdings 3. 
They are respectively as follows: 
X
x
X
x
X
x
X
x --[[User:Dstrube|Dstrube]] ([[User talk:Dstrube|talk]]) 02:49, 21 May 2020 (UTC) 
:This comment is quite uninformative to someone who doesn't have those fonts installed. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 09:57, 21 May 2020 (UTC)

As well as esolangs, among which I would consider the likes of Whitespace and b****fuck as potential inspirations, I think I'm also minded of TempleOS and its creator as vaguer but possibly still related influences... [[Special:Contributions/162.158.158.163|162.158.158.163]] 03:28, 21 May 2020 (UTC)

I added an explanation of what a variable is and why it's bad to have every one named X. It's pretty rudimentary though, hope someone more experienced than me will improve it. [[User:Unpopular Opinions|Goodbye, world!]] ([[User talk:Unpopular Opinions|talk]]) 04:39, 21 May 2020 (UTC)

:Forth basically doesn't use variable names. Commands operate on and consume the last number mentioned. A Forth program "1 2 3 . . ." prints 3, then 2, then 1. "2 3 + ." prints 5 I think??
:In Microsoft "Transact-SQL" you can script variables named starting @ and temporary objects starting #. I promise I try to resist naming objects @ or # and especially if @ or # is going to be a different object in each program... or is not. And if someone else needs to reads this (and I don't want to punish them). Not to mention "@ " for instance. Robert Carnegie rja.carnegie@gmail.com [[Special:Contributions/141.101.98.54|141.101.98.54]] 09:21, 21 May 2020 (UTC)

Psh you're all chicken. Chicken chicken chicken.

[[https://media.discordapp.net/attachments/677507038607048704/706860858587873310/ShapeLikeItSelf_img1.png?width=282&height=209 Language where you can have return keyword in a if condition]],
[[https://media.discordapp.net/attachments/677507038607048704/712914169774735441/unknown.png?width=292&height=103 Language that uses unicode symbols for built_in operators]],
[[https://media.discordapp.net/attachments/677507038607048704/712915431446282240/unknown.png?width=396&height=379 Language, I have no words to describe]],
and this this '''X''' thing is winning so far...
[[Special:Contributions/162.158.89.139|162.158.89.139]] 06:35, 21 May 2020 (UTC)

:Yeah, but C++ does that shit either '''unintentionally''' or '''at user demand''' (although, to be clear, I'm not saying it's any good; C++ and Java are possibly the worst programming languages in terms of shoddy design). The X programming language is just the designer being an asshole. [[Special:Contributions/172.68.189.205|172.68.189.205]] 07:04, 21 May 2020 (UTC)
::Those links have nothing to do with C++/Java and you can Not do those things in C++ or Java (except an if in an assignment).[[Special:Contributions/162.158.92.208|162.158.92.208]] 08:02, 21 May 2020 (UTC)
:Those look like pretty sane language features; just looks weird because of the Eliza effect; those keywords don't behave like you'd expect them to based on experience of other languages. In the first example, you can certainly do that in Perl using "if (defined wantarray)"; it's just unusual (but comprehensible) to name the keyword "return". What language is that? [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 09:57, 21 May 2020 (UTC)

Did Randall refer to this comic? https://xkcd.com/1537/
I vaguely remember another one about an esoteric language. Is there a category of programming languages on explainxkcd?

Am I the only one that tried fiddling the CSS on the page to see if the X would change? Spoiler -> It didn't. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 08:54, 21 May 2020 (UTC)

If X is the only variable name, can it be omitted? For example, writing a single-argument function name in a different font to imply which X should be treated as its argument. And that gets me wondering how the source is stored; will the IDE allow use of fonts not installed on your system? Will the compiler fail if it can't find the font, requiring you to track down all of the fonts a developer used in order to compile their code? And what would be the legality of mixing open-source code and proprietary fonts? [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 09:57, 21 May 2020 (UTC)

"… and array indices start at 8, because anything smaller than that would be unreadable." [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 10:00, 21 May 2020 (UTC)

Talk:2309: X

2020-05-21T09:57:15Z

Angel:

Talk:2306: Common Cold

2020-05-13T23:30:34Z

Angel:

WHEN COVID19 IS DONE KEEP UP WITH THE HAND WASHING![[Special:Contributions/108.162.216.122|108.162.216.122]] 23:16, 13 May 2020 (UTC)

I saw a thing reshared some time last month claiming that after the hand-sanitizer-and-masks outbreak in Japan, some regions were recording record low numbers of influenza hospitalisations for this time of year. Thought that would be nice; but could only find unsourced claims. Would be nice to think there really was that kind of silver lining. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 23:30, 13 May 2020 (UTC)

Talk:2299: Coronavirus Genome 2

2020-04-27T23:56:44Z

Angel:

How long is it likely to be before somebody does this? Hours? Minutes? [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 23:56, 27 April 2020 (UTC)

Talk:2298: Coronavirus Genome

2020-04-27T00:43:35Z

Angel:

Epigenetics is a pun, right? I think it's a pun but I don't know what and it's maddening. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 23:03, 24 April 2020 (UTC)
:...{{w|Epigenetics}} is a real thing—the study of how changes in things other than the genome itself can be passed down between generations. An example is conditioning a mouse to be scared of the smell of oranges/cherries/almonds by having them associate the scent of acetophenone with an electric shock, then testing whether its pups also have the same fear of that smell: they do, but this obviously can't be by the genome itself changing (no component of this has a lot of ionizing radiation{{Citation needed}}). Whatever causes this is the topic of actual epigenetics. --[[User:Volleo6144|Volleo6144]] ([[User talk:Volleo6144|talk]]) 00:12, 25 April 2020 (UTC)
::I know that, I added the link to the article. But afaik that has nothing to do with how the genome is formatted in Word, and I think it's a pun. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 00:31, 25 April 2020 (UTC)

since when does notepad have spellcheck? [[Special:Contributions/172.68.226.46|172.68.226.46]] 23:05, 24 April 2020 (UTC)
: Word does, so maybe she is using Word instead? Kind of contradictory. [[Special:Contributions/172.69.34.46|172.69.34.46]] 23:14, 24 April 2020 (UTC)

When Dr. Theall first scanned Finnegans Wake, he had to tell Microsoft the language was Old Icelandic.

The OCR kept trying to spellcheck Finnegans Wake.15:11, 26 April 2020 (UTC)~
True Story: In the 1980s, as part of the Work Experience initiative at my school, I was assigned to one of my local council's offices (I'd applied for their computer department, but someone else got that). I don't ''think'' the word-processor I used at home (Psion Exchange) had spellcheck, but the one the office used (Lotus? Can't actually recall, but it, like most things, was DOS-based) definitely had, and it was very easy to edit in new words. Inspired by the chemistry lessons I'd recently had, and some 'reports' I was asked to write (keeping the kid busy, more like!) that dealt with chemical degradation of concrete under the action of salt and suchlike, I of course added "NaCl" then absolutely any other chemical formulae I could think of. "H2SO4" was an early one (partial subscript formatting wasn't relevent to the spill-chucker) but I eventually got round to CH4, C2H6, C3H8, etc, and then as many of the derived alcohols, alkenes, alkynes, etc that I could be bothered to type in. Which were a lot. By the end I was 'confident' that nobody would ever type ''any'' correct chemical formula into that machine (no network-shared resources!) and have to worry about false-positive typo alerts. Yeah, well, I was still at school and thought I knew ''everything''. [[Special:Contributions/162.158.159.70|162.158.159.70]] 23:37, 24 April 2020 (UTC)

Can confirm: virus genomes are looked at in notepad. I worked at one of the national laboratories for a summer, experimenting with ways to check for the length of a gene and strength of genetic expression in various circumstances in E. coli. We used notepad because even old computers can open very large files without difficulty, and all our scripts were in Perl, which can easily output to .rtf or .txt file formats. These files are huge, by the way. If you hold down on the scroll bar so it's zooming to the bottom, you could be waiting 20 minutes to reach the end depending on the number of kilobase pairs in your microbe. And epigenetics is not a pun. It's a real word. [[Special:Contributions/172.68.143.192|172.68.143.192]] 00:15, 25 April 2020 (UTC)

Concurrent to the work in the medical community, work is underway in various open source software communities to fix bugs and other issues with software (eg genome analysis tools) that is useful to the scientists combatting COVID-19. These include the Debian "biohackathon" (https://lwn.net/Articles/816280/) as well as support from Mozilla (https://lwn.net/Articles/816386/). Parallel to these efforts, the FSF (Free Software Foundation) has focused on the shortage of medical equipment: https://lwn.net/Articles/816392/ [[Special:Contributions/108.162.242.5|108.162.242.5]] 00:34, 25 April 2020 (UTC)

I’m suddenly inspired to write a DNA-edit-mode for Emacs (if it doesn’t have it already) which would allow for the virus spell check as described in this comic. [[Special:Contributions/172.69.63.153|172.69.63.153]] 04:16, 25 April 2020 (UTC)

- the dna-mode for emacs does exist. Google for it. It is not very useful for real work, though. [[User:Heikkil|Heikkil]] ([[User talk:Heikkil|talk]]) 04:40, 26 April 2020 (UTC)

Derek Lowe has some insights about actual coronavirus mutations [https://blogs.sciencemag.org/pipeline/archives/2020/04/21/watching-for-mutations-in-the-coronavirus here], if you are interested.

Given coronavirus has an RNA genome, shouldn't all the 'T's be replaced by 'U's?

- It is standard practice no to use U's in public sequence database. It simplifies things. [[User:Heikkil|Heikkil]] ([[User talk:Heikkil|talk]]) 04:40, 26 April 2020 (UTC)

The sequence in the transcript does not actually appear on the [https://www.ebi.ac.uk/ena/data/view/MT344963&display=text site] mentioned in the explanation. In fact, when I google for 'TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA' I only get this particular site.
:
UNSIGNED COMMENT: PLEASE SIGN WITH "<nowiki>~~~~</nowiki>"
:To find this (or any) sequence go to [[https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome|Nucleotide Blast]] and paste the query into the box. You will receive a list of a number of best matches (10, 50 or 100 in standard search), this should look like [[https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastSearch&VIEW_SEARCH=on&UNIQ_SEARCH_NAME=A_SearchOptions_1jST3G_gRB_dgzLunnk2EC_23turP_1HUFpP|this]]
Interestingly, this is an US-specific strain of the virus (top result currently is "Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/NC_0025/2020").[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 23:21, 25 April 2020 (UTC)
:Well, ''obviously'' it's a new variant, yet unknown to other clinical studies. Of RNA that has switched to looking like DNA, so this is a hot discovery! [[Special:Contributions/162.158.159.142|162.158.159.142]] 12:05, 25 April 2020 (UTC)

: The site shows several views into the public database entry that are easier to understand by humans than the raw sequence. Click the link at 'View: TEXT'. and scroll down. The relevant lines look like this:

aatccagtaa tggaaccaat ttatgatgaa ccgacgacga ctactagcgt gcctttgtaa 26220

gcacaagctg attagtacga acttatgtac tcattcgttt cggaagagac aggtacgtta 26280

As you can see, these are not meant to be search for and compared in "a notepad". For the same reason, google does not index DNA sequence database entries. There are specialised tools for that.

The sequnces were published this month, so they are available only in the most recent sequence database updates. [[User:Heikkil|Heikkil]] ([[User talk:Heikkil|talk]]) 04:40, 26 April 2020 (UTC)

I have had trouble opening .txt files of even a hundred KB in Notepad! Sometimes it even crashes... It's one of the reasons I started using Notepad++. Notepad++ also happens to have a very extensible spellcheck, & language-specific formatting options. Since I often need to use Windows machines, it's one of my most frequently installed apps, after 7Zip.
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 18:03, 25 April 2020 (UTC)

The Grammar Checker concept only has a {{w|Colorless_green_ideas_sleep_furiously|limited analytical sophistication}}, though I don't doubt it'd still be enough to get a Nobel given the complexity of the task of deriving trivially feasible sequences from total codswallop. I also added the "next step" (probably much more than a single step), when I revised things, but that might actually be overstepping the explanation of the comic and removable. [[Special:Contributions/162.158.155.122|162.158.155.122]] 20:32, 25 April 2020 (UTC)
:Thanks for mentioning this in the discussion area, as I wondered what that "next step" line meant when I read it a little while ago, let alone how it related to the comic. I'll go ahead and trim that last "next step" sentence off the end, as I think it is unnecessary. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 03:36, 26 April 2020 (UTC)

Is using Notepad to analyse RNA sequences more or less sane than using a spam filter to play chess? - [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 00:43, 27 April 2020 (UTC)

Talk:2294: Coronavirus Charts

2020-04-16T22:36:19Z

Angel:

It must be because there aren't any numbers along the axes [[Special:Contributions/172.69.34.104|172.69.34.104]] 23:53, 15 April 2020 (UTC)

I want to know if this is a random sketch with silly labels, or if Randall looked up actual data to plot it. It seems to be a combination of 4 metrics which might be reported somewhere (search popularity, death rate, total reported cases, and number of tests performed). I suspect there aren't many countries/regions for which all 4 are available, but it's conceivable that someone's published enough stats to draw this crazy plot. ¬[[User:Angel|Angel]] ([[User talk:Angel|talk]]) 01:39, 16 April 2020 (UTC)
:What would negative results in a google search be? How do you make them a graph axis? I think its just random labels on graphs. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 05:12, 16 April 2020 (UTC)
::It doesn't say negative test results for a google search. It's the number of people who've tested negative for the disease, divided by the number of people who've searched google for it. I'm moderately surprised that nobody's yet started a list of links to various data soources that could be used to plot this graph. Does Google provide per-country search frequencies? ¬[[User:Angel|Angel]] ([[User talk:Angel|talk]]) 09:34, 16 April 2020 (UTC)
:::[https://trends.google.com/trends/explore/GEO_MAP/1587034200?hl=en-US&tz=420&date=today+3-m&q=covid&sni=3 Google Trends] is always normalized so that the data returned is in [0, 100], and denormalizing out of relative values back to raw numbers is almost impossible. The best you can do is get a unitless proportion by comparing to a second search term chosen as one which doesn't vary much over time. [[Special:Contributions/172.68.142.203|172.68.142.203]] 10:54, 16 April 2020 (UTC)
::::From the docs, looks like that data is simply scaled. "A value of 50 means that the term is half as popular [as its most popular day]". Using that 0-100 number as if it were an actual number of people should give the same graph, just with the units on the X-axis offset by some value. Positioning the graphs relative to each other would be harder, as the "Interest by region" chart doesn't follow the same rules; we're lacking good data for the ratio between one country and another. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 13:48, 16 April 2020 (UTC)

Is the y-axis ''(death_today + cases_aweekago)/capita'' or ''death_today + (cases_aweekago/capita)''? This would hugely effect the weighting of the two terms. (Parentheses in second interpretation are for clarity only, I know they change nothing mathematically.) [[Special:Contributions/172.69.54.9|172.69.54.9]] 09:03, 16 April 2020 (UTC)
:Perhaps it is intentionally ambiguous to support the main point about bad charts. [[Special:Contributions/172.68.142.203|172.68.142.203]] 10:54, 16 April 2020 (UTC)
:I assumed the latter; but the page here seems to assume the former. Either way, one of the results will dwarf the other. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 13:48, 16 April 2020 (UTC)

The 19th COVID19 comic... :-) almost in a row. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 12:40, 16 April 2020 (UTC)

I tried my hand at graphing the data for the United States, in this spreadsheet here: [https://docs.google.com/spreadsheets/d/1W1ttxu9Dths5uOLOzk7VHd78hXG0EgeMkW5TCtdgtqw/edit?usp=sharing]. If anybody is motivated enough to add data from other countries, go ahead. As it is, this data doesn't really look anything like what Randall graphed, making me think that he just made up the lines. [[Special:Contributions/172.68.174.82|172.68.174.82]] 16:42, 16 April 2020 (UTC)
:[https://imgur.com/a/hHc1j7S OH NO!] [[Special:Contributions/172.68.143.96|172.68.143.96]] 18:43, 16 April 2020 (UTC)
:: Well, since the x axis doesn't graph time, there's no reason for the trend lines to be functions of x— he just chose to draw them that way. Both x and y are independent functions of t. [[Special:Contributions/172.68.174.70|172.68.174.70]] 19:11, 16 April 2020 (UTC)

I suddenly wondered if the graph means negative test results to date; or the new ones returned today. Same for the Google results, I guess. The Y-axis explicitly says it's talking about the total number of cases and today's death count, but the X-axis doesn't say for either of its values. And then that gave me the idea that "total" on the Y axis might actually mean "worldwide". So now I'm reading the Y-axis label as being (today's deaths in $country)+(worldwide infection count/population of $country). Maybe that makes the graph more useful. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 22:36, 16 April 2020 (UTC)

Talk:2294: Coronavirus Charts

2020-04-16T13:48:42Z

Angel:

Talk:2294: Coronavirus Charts

2020-04-16T09:34:21Z

Angel:

Talk:2294: Coronavirus Charts

2020-04-16T01:39:16Z

Angel:

Talk:2291: New Sports System

2020-04-09T11:13:25Z

Angel:

Note that the title text goes at the end of the explanation, not within the transcript section. I've removed it twice now. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 00:41, 9 April 2020 (UTC)

I really want to see this happen now :D [[Special:Contributions/172.68.174.128|172.68.174.128]] 01:18, 9 April 2020 (UTC)
:Alright, who programs the VR software and who organises the tournament? :D [[User:Fabian42|Fabian42]] ([[User talk:Fabian42|talk]]) 03:17, 9 April 2020 (UTC)

I find myself wondering how easy it would be to merge the video feeds from the different players, so viewers can see everyone as if it were a traditional match. If each arena has a camera in the same place, it shouldn't be that hard to isolate parts of the image which are different from a static image; but I'm not sure what would be the best method for determining which player is in front when they overlap. I guess you need some method of tracking the players' positions in any case, to work out who's touching the ball. Would the technology used for home VR be easily adaptable to a full size stadium? - [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 10:50, 9 April 2020 (UTC)

Another way to do it: Each player has their own ball. But only one of the balls is "live" at any given time. Maybe it lights up or something. If another ball contacts the live one, it changes places, allowing you to effectively "tackle" the player who's in possession. Would mean that ball physics are more realistic, while still maintaining the confusion. Maybe also give the players little shock collars to let them know if they collided with another player. (Is running through another player a foul in basketball?) - [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 10:55, 9 April 2020 (UTC)

:And that's just got me thinking that [[wikipedia:BASEketball|BASEketball]] would be entirely playable in this form - [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 11:13, 9 April 2020 (UTC)

Talk:2291: New Sports System

2020-04-09T10:55:05Z

Angel:

Talk:2291: New Sports System

2020-04-09T10:50:47Z

Angel:

2288: Collector's Edition

2020-04-03T16:44:04Z

Angel: Have now got the chest for "The other side of the wardrobe" on 3 different Narnia pages at different times in the day. Do any of them match, or is it a different one each time?

{{comic
| number = 2288
| date = April 3, 2020
| title = Collectors Edition
| image = collectors_edition.png
| titletext = I'm sure you can find some suitable worldbuilding material if you scavenge through the archives.
}}

==Explanation==
{{incomplete|Created by TECHNICAL DIFFICULTIES. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}

This is an April 1st comic. It is a large image, of which only part is visible, but it can be dragged around. This Space acts as a virtual common sandbox where viewers can interact. "Items" (small, often humorous images) can be 'collected' from other comics and then placed in this image by viewers. The collection then updates for all viewers in real-time. Multiples of the same item are often seen.

There is a "backpack" at the bottom, similar to "backpacks" in video games containing items collected by the player. Items can be found by visiting different XKCD comics/pages. Randomly, some pages will have a treasure chest which will contain the sticker related to the page. It is believed that the hint represents what page currently has a chest.

The sticker images can be seen at https://xkcd.com/2288/collectors/static/loot/loot_XXX.png, where XXX is a number from 001-253. Additionally, some images can be found at custom urls, for example the periodic elements can be found at https://xkcd.com/2288/collectors/static/loot/element-XX.png, where XX is the element, and text loot at https://xkcd.com/2288/collectors/static/loot/loot-words-X.png, where X is the sentence.

===Hints===

{| class="wikitable"
!Hint
!Comic
!Unlocked item
!Item image
!Notes
|-
|Doctors in a row||[[1529: Bracket]] ||Cory Doctorow || loot_019.png ||
|-
|Get out the (US) vote|| [[2224: Software Updates]] || Statue of liberty || loot_246.png ||
|-
|Find a box of nice stuff on a picture with words like these|| [[1133: Up Goer Five]] || Signpost || loot_126.png ||
|-
|Plug in or find another power source||[[1373: Screenshot]] || || loot_228.png ||
|-
|Sweet dreams, kitty||[[729: Laser Pointer]] || Cat licking laser point || ||
|-
|What is this hint pointing to? Hell if I know.||[[28: Elefino]] || || ||
|-
|Somebody set up us the bomb||[[286: All Your Base]] ||Exploding rock || ||
|-
|Cowabunga||[[1412: Teenage Mutant Ninja Turtles]] ||Women Science Fiction Authors || loot_175.png || [[197: Ninja Turtles]] also works
|-
|I want to believe||[[2156: Ufo]] ||Ufo || ||
|-
|Bleeped|| || || ||
|-
|why waste time say few word when lot word do trick||[[1022: So It Has Come To This]] || First Annual Award for Excellence in Being Very Smart || ||
|-
|Cooler than electric scooters||[[409: Electric Skateboard (Double Comic)]]||An electric scooter|| ||
|-
|Take it from the top||[[1: Barrel - Part 1]] ||I am a turtle || loot_095.png ||
|-
|I accept the yucca gnocchi, this meal is a success!||[[1713: 50 ccs]] ||Man carrying parentheses from [[297: Lisp Cycles]] || loot_31.png ||
|-
|Catch up on the news|| [[1699: Local News]] || || ||
|-
|Participation trophy|| [[2288: Collectors Edition]] || Server rack || ||
|-
|Find an opportunity for a sojourn||[[1504: Opportunity]] ||Opportunity Mars rover || ||
|-
|Tastier than tau day||[[179: e to the pi times i]] ||First annual award for excellence in being very smart || ||
|-
|418 I'm a teapot||[[1866: Russell's Teapot]] ||S.S. NASA: Space is Hard || ||
|-
|26th September, 1983||[[2052: Stanislav Petrov Day]] ||White dove || ||
|-
|There are 4241 as of Apr 1, 2020|| [[1071: Exoplanets]] || Little girl from [[2264: Satellite]] || ||
|-
|asableiK|| [[645: RPS]] || A reverse Polish hotdog || || "Kielbasa" backwards, which is "sausage" in Polish
|-
|Critical mass elements|| [[235: Kite]] || || loot_203.png ||
|-
|Some Februarys are more equal than others|| [[390: Nightmares]]? || Cueball wheelie from [[272: Linux User at Best Buy]] || || Comic-hint connection largely conjectural; 390 was the first comic published on a leap day.
|-
|Five spice||[[1554: Spice Girls]]|| Rock guitarist || ||
|-
|Call the plumber|| [[290: Fucking Blue Shells]] || || loot_058.png ||
|-
|Was it a rat I saw?|| [[1632: Palindrome]] || Cueball with a large sack, pulling a wagon || || or [[1503: Squirrel Plan]] for cueball holding a balloon caught in a ceiling fan.
|-
|Churchill's gonna have to seriously rehydrate||[[1148: Nothing to Offer]]|| Bottle of soda || ||
|-
|Keep coming back|| || || ||
|-
|A new model released each year|| || || ||
|-
|Tea Time||[[581: The Race: Part 5]] ||Floor tea ||loot_232.png|| Also [[479: Tones]] ? Also [[578: The Race: Part 2]] ?
|-
|Try pattern-matching! Look for comic 'bout alphabet?||[[1045: Constraints]] || || ||
|-
|Where's Hilbert?||[[195: Map of the Internet]] ||maze || ||
|-
|Science fiction fetish|| || || ||
|-
|The first one was funnier||[[11: Barrel - Part 2]]||Falling feather || ||
|-
|It's up to over 260 million cycles!|| || || ||
|-
|Sleeping Beauty is the same everywhere though||[[2233: Aurora Meaning]] || || ||
|-
|On the internet, nobody knows you're an arachnid|| [[1530: Keyboard Mash]] || Cobwebbed frame || ||
|-
|Did James Cameron pay for the rice cooker too?||[[1598: Salvage]] ||Rice bowl || ||
|-
|Never going to give you up||[[351: Trolling]] || || ||
|-
|If red touches yellow, that's 24 ohms||[[1604: Snakes]]|| Yoda with an mp3 player from What If || ||
|-
|An enthusiastic but questionable business opportunity||[[1533: Antique Factory]] or [[1021: Business Plan]]|| Beret guy with a goat on leash || ||
|-
|Read the fine manual|| [[1343: Manuals]] or [[293: RTFM]] || "Configure the network" window with a prompt for hostname || ||
|-
|That thing's undecimodal!||[[1347: t Distribution]] || Floating tentacled alien || ||
|-
|Actually, it's Myanmar-Shave now||[[491: Twitter]]||Expensive bottle || ||
|-
|You don't have to find all 99|| [[121: Balloon]] ||Balloon copter || loot_002.png || Or [[51: Malaria]] ?
|-
|Going in circles|| || || ||
|-
|Couldn't you try knitting, or maybe stamp collecting?||[[2123: Meta Collecting]]||Phishing License sign|| ||
|-
|It's the ciiiiircle of HONK||[[537: Ducklings]] ||DUCKLOOP'D? || ||
|-
|Fool me twice|| [[880: Headache]] || Raptor Attack || ||The second April fools' comic
|-
|oOOOoooo|| || || || https://xkcd.com/316/ ? definitely not https://xkcd.com/1393/- I got that hint while On that page. ?
|-
|Maybe we can ask for new wishes||[[879: Lamp]] ||Genie and his bottle ||loot_004.png ||
|-
|HACK THE PLANET||[[1337: Hack]] || || ||
|-
|Monetization haute couteur||[[20: Ferret]]||Two bags of money ||loot_162.png||
|-
|Maybe writing a script would help||[[1319: Automation]]|| || ||
|-
|Go big to go small|| [[1365: Inflation]] || || loot_245.png ||
|-
|Are you projecting||[[850: World According to Americans]] or [[977: Map Projections]]||Squirrel on a gun||loot_237.png||
|-
|Do spiders really have six legs||[[8: Red spiders]] || || ||
|-
|Istanbul or Constantinople or St. Trimble's Island?||[[1688: Map Age Guide]] ||Cephalopod || ||
|-
|Another rulebook?||[[393: Ultimate Game]]||Wizard in a chair || ||
|-
|Moooooon|| [[1300: Galilean Moons]] || MOOOOOON || ||
|-
|Take a flight from LOL to FFS|| [[1937: IATA Airport Abbreviations]] || || ||
|-
|Everyone deserves a second chnace|| || || ||
|-
|Community contribution|| [[826: Guest Week: Zach Weiner (SMBC)]] || [Citation Needed] protester || ||
|-
|On the other side of the wardrobe|| [[665: Prudence]] or [[969: Delta-P]] or [[2218: Wardrobe]] ||Authentic Reindeer pulling sled || ||
|-
|Today's your lucky day|| [[1053: Ten Thousand]] || Ms. Frizzle || loot_105.png ||
|-
|[This hint has been redacted due to a copyright claim]|| [[1005: SOPA]] || || ||
|-
|Try a different approach|| [[55: Useless]] || || loot_times.png ||
|-
|The cake is a lie!|| [[606: Cutting Edge]] || Cake || ||
|-
|Joanna, fire.||[[322: Pix Plz]] || Joanna with EMP cannon || loot_026.png ||
|-
|Everything changes from time to time when the fire nation attacks|| [[965: Elements]] || Symposium || ||
|-
|90KG x 300M|| [[382: Trebuchet]] || Trebuchet || ||
|-
|Copyright Enforcement Brigade|| [[344: 1337: Part 4]] || || loot_046.png ||
|-
|Where Cape Town meets Chukotka||[[1500: Upside-Down Map]] || || ||
|-
|Take a ride in a barrel|| || || || ('''not''' any of the comics in the barrel series)
|}

==Trivia==
* This comic is the 2020 April Fools comic and was supposed to be released April 1st. However, the below message was displayed on the top of the page until early Friday (April 3rd) morning, when the comic finally went live. It remains to be seen if Friday's intended comic will be published later.
<blockquote>
Note: For technical reasons Wednesday's comic will be posted Thursday instead. Apologies for the delay!
</blockquote>
* Placement is limited to 10,000 units from the origin. Users will receive no messages if they try placing something outside the boundary.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
:[Cueball stands to the left of a vibrating box.]
:[The words "Collector's Edition" are written above him and boxed.]

{{comic discussion}}

[[Category:April fools' comics]]
[[Category:Comics featuring Cueball]]
[[Category:Interactive comics]]

Talk:2288: Collector's Edition

2020-04-03T13:01:17Z

Angel: typo

... is this going to be like [[1190: Time]]? [[Special:Contributions/162.158.74.63|162.158.74.63]] 04:08, 3 April 2020 (UTC)
: I hope so, otherwise I don't get the joke [[User:Forresthopkinsa|Forresthopkinsa]] ([[User talk:Forresthopkinsa|talk]]) 04:15, 3 April 2020 (UTC)
: The page just went down for me so maybe what we've seen isn't what it's supposed to be? [[User:Avi m|avis_magpie]] ([[User talk:Avi m|talk]]) 04:20, 3 April 2020 (UTC)
Looks like the whole comic was just taken down. [[User:Parzivail|Parzivail]] ([[User talk:Parzivail|talk]]) 04:27, 3 April 2020 (UTC)
: Can confirm - the most recent comic is Pathogen again [[Special:Contributions/162.158.187.207|162.158.187.207]] 04:26, 3 April 2020 (UTC)
It is still up on the mobile website, but only if you directly go to comic page https://m.xkcd.com/2288 [[Special:Contributions/172.69.22.146|172.69.22.146]] 05:10, 3 April 2020 (UTC)
: Perhaps this is a collector's edition because it was only up for a limited amount of time? {{unsigned ip|108.162.219.60|05:12, 3 April 2020}}
:: That was my immediate assumption. The title text says, "I'm sure you can find some suitable worldbuilding material if you scavenge through the archives." And I was viewing the comic by using the Internet Archive's Wayback Machine — which, wouldn't you know it, captured the page exactly once before it went down. Between that and the title "Collector's Edition", I can't help thinking that the comic was actually intended to be viewed this way. Though for what reason, and what intended meaning, I couldn't tell you. …And jeez, in the time it took me to type this, the comic is back, but changed! Oy vey. [[User:NoriMori|NoriMori]] ([[User talk:NoriMori|talk]]) 06:42, 3 April 2020 (UTC)

Maybe it's called collectors edition, because it was only available quite limited and to an unusual time? But that logic doesn't fit with the title text. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 05:14, 3 April 2020 (UTC)
:I doubt that could be caused by "technical difficulties". [[Special:Contributions/172.69.34.186|172.69.34.186]] 06:14, 3 April 2020 (UTC)

It looks like it went back up about 5 minutes age. I can't figure out if it's possible to do more than pan right now though. [[Special:Contributions/108.162.215.120|108.162.215.120]] 06:39, 3 April 2020 (UTC)
:Yeah I see the same thing, looks like they're just testing it live. What a shame :(--[[Special:Contributions/108.162.215.242|108.162.215.242]] 06:47, 3 April 2020 (UTC)
::what makes you assume that this is testing right now? however it doesn't seem to be very interactive apart from panning through it, and that it seems to chagne over time (the moon from [[1300]] wasn't there a few minutes ago, was it? --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 06:49, 3 April 2020 (UTC)

:It's a giant pan similar to [https://xkcd.com/1110], although it's mostly empty, with some content at [https://xkcd.com/2288/#-361,-161]
. The title reads that you can find world building material, if you scavenge through the archives. I assume, more content will be unlocked as you read through past comics. [[User:Goatfryed|Goatfryed]] ([[User talk:Goatfryed|talk]]) 06:52, 3 April 2020 (UTC)
::That would mean it is individual? That everyone gets their own picture? --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:03, 3 April 2020 (UTC) Edit: I can kinda rule that out. I get the same picture on my phone and my work laptop, the work laptop is in a different country via vpn, and doesn't share any logins/advertisement ID's apart from explain xkcd with my phone... --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:05, 3 April 2020 (UTC)

Yeah, it definitely changes. The orange swimming pool just showed up now. Also, at the bottom of the page, it says something about "backpack", and what appears to be a reference to some other xkcd comic. For example, "Hint: why waste time say few word when lot word do trick", which I think refers to Up Goer Five. But I have no idea what to do with that info. [[Special:Contributions/172.68.141.190|172.68.141.190]] 06:55, 3 April 2020 (UTC)
:and the content seems to be related to previous comics and what-ifs... but still no clue what to do apart from exploring the page. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 06:57, 3 April 2020 (UTC)

So I just stumbled upon this and it seems to be exactly as other commentors have theorised: as you read previous comics more stuff gets added to the page. There seems to be some kind of backpack mechanic where you collect items from previous ones somehow, but, perhaps because I've already read all previous comics, that didn't seem to work for me. Instead I just had to click the link above the backpack, which opened the comic in a new tab, and it had a bunch of stuff there. We may need to co-ordinate to figure out if different people end up with different sets of items, and to ensure we have all of them, but I think other than that it should be just a cut and dry thing of making a table with every item in it. [[Special:Contributions/162.158.34.202|162.158.34.202]] 07:12, 3 April 2020 (UTC)
:Hang on, mine just changed: before there was only 1 pool on the left, now there are two. I only went back to pathogens and then forwards agin. This may be harder than I thought, I'm going to start keeping a screenshot log of actions vs. results. [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 07:17, 3 April 2020 (UTC)
:You may need to try xkcd.com instead of www.xkcd.com - there seems to be an issue with the latter at the moment. [[Special:Contributions/162.158.255.216|162.158.255.216]] 07:18, 3 April 2020 (UTC)
::Hold up it changed again! This time without a reload! [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 07:28, 3 April 2020 (UTC)
:::It seems to change periodically, the url does change everytime. New stuff always seems to be added, not old stuff rremoved. [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 07:28, 3 April 2020 (UTC)
::::The URL is related to the coordinates, it changes when you pan the image. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:34, 3 April 2020 (UTC)
::::Timings seem to be random, working on double checking that rn. Highest first number so far is 1127, once it switches agin I'm going to experiement with manually editing the url.

I was briefly able to do things. Open the archieve, navigate it to one of the comics, that are hinted for (e.g. compiling or iata) and when viewing that comic I get a lootbox, with an image I can then place in the 2288. It worked twice, and now it doesn't again... neither with those that have worked before, nor with others I am fairly sure have been placed by other people. (such as galilean moons) --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:21, 3 April 2020 (UTC)
:I'm working on assembling an image log, wonder if we could compare? Also, the two number url could be useful, rn I'm on -1378, -152 [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 07:25, 3 April 2020 (UTC)
::What do you mean by compare? Also the URL is related to the coordinates, it changes when you pan the image. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:34, 3 April 2020 (UTC)
:::Yh just got that, is that the same for other panning comics (I'm a little new)? And I was wondering if the comic changed per person/system like certain previous comics. [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 07:40, 3 April 2020 (UTC)
::::Just seen a previous comment from you saying it doesn't change cross-system. However, it definetely changes with time, so the question is whether that's per user or done on a sort of universal clock, so we all unlock the same new content at the same time.
:::::I didn't complete writing up the thing I was able to do above... after opening the lootbox I got one image related to the comic I opened in my backpack and was able to place that in the actual 2288, where it now is placed. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:50, 3 April 2020 (UTC)
::::::For me that didn't happen, it started with a loading screen type thing, and then objects just started appearing seemingly at random. I've also noticed some of them dissapear. I feel like the best course of action would be to start with a table of all the different objects, and then see if we can figure out when/why they appear later.
::::::: At least 2 objects appeared, because I placed them. It is a colaboration of many xkcd readers to do this world building here. I placed one of the sword fights around #439,-181 and the non-inverted kite at #-1679,-290 . --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:55, 3 April 2020 (UTC)
::::::::Do you agree that the best course of action would therefore be a table with all the items? [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 08:03, 3 April 2020 (UTC)
:::::::::Not a big fan of tables, unless there really is content of muliple categories to be entered for one line. A list would do fine I guess? Also I find lists easier to work with. Or what would be the columns you'd set up? --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 08:08, 3 April 2020 (UTC)
::::::::::Something along the lines of the comic that it's a reference to, an image, and an explanation. Do we know if you find the same sticker at the same comic every time? If so, then that. A list would work well too. [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 08:12, 3 April 2020 (UTC)
::::::::::From looking at what image URLs don't 404, it looks like there are 253 stickers, which is quite a lot for a table.[[User:Matthias1|Matthias1]] ([[User talk:Matthias1|talk]]) 10:03, 3 April 2020 (UTC)
:::::I think we can unlock new elements by reading older comics (seemingly at random, it doesn't work with every comic read) and that everyone can see the changes once they are put on the global picture. If someone could check, I have put berret guy and his goat around (5000,0)
::::::Yep, he's there. [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 08:01, 3 April 2020 (UTC)

I almost feel like someone needs to show them this xkcd... https://xkcd.com/169/

It seems to be an interactive canvas. You can find stickers in chests on specific comics and put them in your backpack, and then when you come back here you can choose where to put them on the canvas. The hints in the empty backpack are cryptic references to comics. {{unsigned ip|162.158.107.85}}
:Yep, I figured the same thing, but for me it only worked twice (fly from wtf to lol was a reference to the iata thing and compiling was a reference to the compiling one) - but it didn't work again. Also: Some of the placed images are clearly references to what-if. Like the squirrel on top of an AK47 or the yoda powering an IPOD. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:59, 3 April 2020 (UTC)

I've made a catalog of the stickers but it's only partial because stuff keeps appearing: https://photos.app.goo.gl/dPYeYVpGqu5tqGTt5 [[User:Lev|Lev]] ([[User talk:Lev|talk]]) 08:02, 3 April 2020 (UTC)

I got it. I wrote the steps on reddit and included some screenshots. Feel free to use it to edit this page https://old.reddit.com/r/xkcd/comments/fu1dt0/xkcd_2288_collectors_edition/fmaqp1w/ [[User:Ufolicker|Ufolicker]] ([[User talk:Ufolicker|talk]]) 09:27, 3 April 2020 (UTC)

Am I too late to participate in this or am I doing something wrong? Where is this hint supposed to appear? I only see an empty backpack and the canvas on which references to different comics are placed. No comic I've visited, either inspired by references on the canvas, nor by random selection has any chest or other interactive components to it. [[User:Bischoff|Bischoff]] ([[User talk:Bischoff|talk]]) 09:53, 3 April 2020 (UTC)
:No, you're doing it right. Hints show up in the backpack area. Obviously no one is sure of anything, but even users who have seen hints have reported not seeing hints on a different browser/device. I suspect something similar to [https://xkcd.com/1037/ Umwelt], where different hints are shown to different people. And I think once a chest is picked up, it stops appearing to everyone that could see it, but that's a guess.[[User:Matthias1|Matthias1]] ([[User talk:Matthias1|talk]]) 10:03, 3 April 2020 (UTC)
::Ok, I was unsure because on my windows 10 laptop I have yet to see a hint. I've tried chrome, firefox and internet explorer. [[User:Bischoff|Bischoff]] ([[User talk:Bischoff|talk]]) 11:09, 3 April 2020 (UTC)
:::Finally got it to work in Safari in iOS [[User:Bischoff|Bischoff]] ([[User talk:Bischoff|talk]]) 11:13, 3 April 2020 (UTC)

When I view the comic, I don't see the closed box - the screen is absolutely full of stickers. I've not done any scavenger hunting (I'd upload an image, but I don't have permissions to do so) [[User:Kvetch|Kvetch]] ([[User talk:Kvetch|talk]]) 11:10, 3 April 2020 (UTC)

Hints I've seen so far: "The first one was funnier" (chest appeared in comic 1, contained I'm a turtle);
"418 I'm a teapot"
"26th September, 1983" (comic 2052, Stanislav Petrov Day, white dove); [[Special:Contributions/172.69.134.135|172.69.134.135]] 11:20, 3 April 2020 (UTC)

Perhaps a table for found chests with no attached hints? I've stumbled across a few but don't know if they're hinted at or not :). [[User:Deranged|Deranged]] ([[User talk:Deranged|talk]]) 11:54, 3 April 2020 (UTC)
:Maybe add a line to the table with a blank first box, the link in the second box, empty third box? Someone will match it up. [[Special:Contributions/162.158.166.37|162.158.166.37]] 12:21, 3 April 2020 (UTC)

"Churchill's gonna have to rehydrate" is Nothing to Offer. Can't remember what number, I think 1148?

In other news, the bad ads are back ([[Talk:2220: Imagine Going Back in Time/Ads|previous discussion]]) - who's in charge of dealing with them anyway? [[User:Arcorann|Arcorann]] ([[User talk:Arcorann|talk]]) 12:25, 3 April 2020 (UTC)

Could someone post an image showing what it looks like to find a chest on a comic? I've browsed to some of the comics referenced as having chests but couldn't see one so far. Thanks![[Special:Contributions/141.101.69.13|141.101.69.13]] 12:54, 3 April 2020 (UTC)

"The other side of the wardrobe", someone's put in the solution [[2218: Wardrobe]]; but I also found the chest on [[665: Prudence]]. Can there be multiple solutions to the same hint? [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 13:00, 3 April 2020 (UTC)

Talk:2288: Collector's Edition

2020-04-03T13:00:37Z

Angel:

... is this going to be like [[1190: Time]]? [[Special:Contributions/162.158.74.63|162.158.74.63]] 04:08, 3 April 2020 (UTC)
: I hope so, otherwise I don't get the joke [[User:Forresthopkinsa|Forresthopkinsa]] ([[User talk:Forresthopkinsa|talk]]) 04:15, 3 April 2020 (UTC)
: The page just went down for me so maybe what we've seen isn't what it's supposed to be? [[User:Avi m|avis_magpie]] ([[User talk:Avi m|talk]]) 04:20, 3 April 2020 (UTC)
Looks like the whole comic was just taken down. [[User:Parzivail|Parzivail]] ([[User talk:Parzivail|talk]]) 04:27, 3 April 2020 (UTC)
: Can confirm - the most recent comic is Pathogen again [[Special:Contributions/162.158.187.207|162.158.187.207]] 04:26, 3 April 2020 (UTC)
It is still up on the mobile website, but only if you directly go to comic page https://m.xkcd.com/2288 [[Special:Contributions/172.69.22.146|172.69.22.146]] 05:10, 3 April 2020 (UTC)
: Perhaps this is a collector's edition because it was only up for a limited amount of time? {{unsigned ip|108.162.219.60|05:12, 3 April 2020}}
:: That was my immediate assumption. The title text says, "I'm sure you can find some suitable worldbuilding material if you scavenge through the archives." And I was viewing the comic by using the Internet Archive's Wayback Machine — which, wouldn't you know it, captured the page exactly once before it went down. Between that and the title "Collector's Edition", I can't help thinking that the comic was actually intended to be viewed this way. Though for what reason, and what intended meaning, I couldn't tell you. …And jeez, in the time it took me to type this, the comic is back, but changed! Oy vey. [[User:NoriMori|NoriMori]] ([[User talk:NoriMori|talk]]) 06:42, 3 April 2020 (UTC)

Maybe it's called collectors edition, because it was only available quite limited and to an unusual time? But that logic doesn't fit with the title text. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 05:14, 3 April 2020 (UTC)
:I doubt that could be caused by "technical difficulties". [[Special:Contributions/172.69.34.186|172.69.34.186]] 06:14, 3 April 2020 (UTC)

It looks like it went back up about 5 minutes age. I can't figure out if it's possible to do more than pan right now though. [[Special:Contributions/108.162.215.120|108.162.215.120]] 06:39, 3 April 2020 (UTC)
:Yeah I see the same thing, looks like they're just testing it live. What a shame :(--[[Special:Contributions/108.162.215.242|108.162.215.242]] 06:47, 3 April 2020 (UTC)
::what makes you assume that this is testing right now? however it doesn't seem to be very interactive apart from panning through it, and that it seems to chagne over time (the moon from [[1300]] wasn't there a few minutes ago, was it? --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 06:49, 3 April 2020 (UTC)

:It's a giant pan similar to [https://xkcd.com/1110], although it's mostly empty, with some content at [https://xkcd.com/2288/#-361,-161]
. The title reads that you can find world building material, if you scavenge through the archives. I assume, more content will be unlocked as you read through past comics. [[User:Goatfryed|Goatfryed]] ([[User talk:Goatfryed|talk]]) 06:52, 3 April 2020 (UTC)
::That would mean it is individual? That everyone gets their own picture? --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:03, 3 April 2020 (UTC) Edit: I can kinda rule that out. I get the same picture on my phone and my work laptop, the work laptop is in a different country via vpn, and doesn't share any logins/advertisement ID's apart from explain xkcd with my phone... --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:05, 3 April 2020 (UTC)

Yeah, it definitely changes. The orange swimming pool just showed up now. Also, at the bottom of the page, it says something about "backpack", and what appears to be a reference to some other xkcd comic. For example, "Hint: why waste time say few word when lot word do trick", which I think refers to Up Goer Five. But I have no idea what to do with that info. [[Special:Contributions/172.68.141.190|172.68.141.190]] 06:55, 3 April 2020 (UTC)
:and the content seems to be related to previous comics and what-ifs... but still no clue what to do apart from exploring the page. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 06:57, 3 April 2020 (UTC)

So I just stumbled upon this and it seems to be exactly as other commentors have theorised: as you read previous comics more stuff gets added to the page. There seems to be some kind of backpack mechanic where you collect items from previous ones somehow, but, perhaps because I've already read all previous comics, that didn't seem to work for me. Instead I just had to click the link above the backpack, which opened the comic in a new tab, and it had a bunch of stuff there. We may need to co-ordinate to figure out if different people end up with different sets of items, and to ensure we have all of them, but I think other than that it should be just a cut and dry thing of making a table with every item in it. [[Special:Contributions/162.158.34.202|162.158.34.202]] 07:12, 3 April 2020 (UTC)
:Hang on, mine just changed: before there was only 1 pool on the left, now there are two. I only went back to pathogens and then forwards agin. This may be harder than I thought, I'm going to start keeping a screenshot log of actions vs. results. [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 07:17, 3 April 2020 (UTC)
:You may need to try xkcd.com instead of www.xkcd.com - there seems to be an issue with the latter at the moment. [[Special:Contributions/162.158.255.216|162.158.255.216]] 07:18, 3 April 2020 (UTC)
::Hold up it changed again! This time without a reload! [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 07:28, 3 April 2020 (UTC)
:::It seems to change periodically, the url does change everytime. New stuff always seems to be added, not old stuff rremoved. [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 07:28, 3 April 2020 (UTC)
::::The URL is related to the coordinates, it changes when you pan the image. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:34, 3 April 2020 (UTC)
::::Timings seem to be random, working on double checking that rn. Highest first number so far is 1127, once it switches agin I'm going to experiement with manually editing the url.

I was briefly able to do things. Open the archieve, navigate it to one of the comics, that are hinted for (e.g. compiling or iata) and when viewing that comic I get a lootbox, with an image I can then place in the 2288. It worked twice, and now it doesn't again... neither with those that have worked before, nor with others I am fairly sure have been placed by other people. (such as galilean moons) --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:21, 3 April 2020 (UTC)
:I'm working on assembling an image log, wonder if we could compare? Also, the two number url could be useful, rn I'm on -1378, -152 [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 07:25, 3 April 2020 (UTC)
::What do you mean by compare? Also the URL is related to the coordinates, it changes when you pan the image. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:34, 3 April 2020 (UTC)
:::Yh just got that, is that the same for other panning comics (I'm a little new)? And I was wondering if the comic changed per person/system like certain previous comics. [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 07:40, 3 April 2020 (UTC)
::::Just seen a previous comment from you saying it doesn't change cross-system. However, it definetely changes with time, so the question is whether that's per user or done on a sort of universal clock, so we all unlock the same new content at the same time.
:::::I didn't complete writing up the thing I was able to do above... after opening the lootbox I got one image related to the comic I opened in my backpack and was able to place that in the actual 2288, where it now is placed. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:50, 3 April 2020 (UTC)
::::::For me that didn't happen, it started with a loading screen type thing, and then objects just started appearing seemingly at random. I've also noticed some of them dissapear. I feel like the best course of action would be to start with a table of all the different objects, and then see if we can figure out when/why they appear later.
::::::: At least 2 objects appeared, because I placed them. It is a colaboration of many xkcd readers to do this world building here. I placed one of the sword fights around #439,-181 and the non-inverted kite at #-1679,-290 . --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:55, 3 April 2020 (UTC)
::::::::Do you agree that the best course of action would therefore be a table with all the items? [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 08:03, 3 April 2020 (UTC)
:::::::::Not a big fan of tables, unless there really is content of muliple categories to be entered for one line. A list would do fine I guess? Also I find lists easier to work with. Or what would be the columns you'd set up? --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 08:08, 3 April 2020 (UTC)
::::::::::Something along the lines of the comic that it's a reference to, an image, and an explanation. Do we know if you find the same sticker at the same comic every time? If so, then that. A list would work well too. [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 08:12, 3 April 2020 (UTC)
::::::::::From looking at what image URLs don't 404, it looks like there are 253 stickers, which is quite a lot for a table.[[User:Matthias1|Matthias1]] ([[User talk:Matthias1|talk]]) 10:03, 3 April 2020 (UTC)
:::::I think we can unlock new elements by reading older comics (seemingly at random, it doesn't work with every comic read) and that everyone can see the changes once they are put on the global picture. If someone could check, I have put berret guy and his goat around (5000,0)
::::::Yep, he's there. [[User:Benkor42|Benkor42]] ([[User talk:Benkor42|talk]]) 08:01, 3 April 2020 (UTC)

I almost feel like someone needs to show them this xkcd... https://xkcd.com/169/

It seems to be an interactive canvas. You can find stickers in chests on specific comics and put them in your backpack, and then when you come back here you can choose where to put them on the canvas. The hints in the empty backpack are cryptic references to comics. {{unsigned ip|162.158.107.85}}
:Yep, I figured the same thing, but for me it only worked twice (fly from wtf to lol was a reference to the iata thing and compiling was a reference to the compiling one) - but it didn't work again. Also: Some of the placed images are clearly references to what-if. Like the squirrel on top of an AK47 or the yoda powering an IPOD. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:59, 3 April 2020 (UTC)

I've made a catalog of the stickers but it's only partial because stuff keeps appearing: https://photos.app.goo.gl/dPYeYVpGqu5tqGTt5 [[User:Lev|Lev]] ([[User talk:Lev|talk]]) 08:02, 3 April 2020 (UTC)

I got it. I wrote the steps on reddit and included some screenshots. Feel free to use it to edit this page https://old.reddit.com/r/xkcd/comments/fu1dt0/xkcd_2288_collectors_edition/fmaqp1w/ [[User:Ufolicker|Ufolicker]] ([[User talk:Ufolicker|talk]]) 09:27, 3 April 2020 (UTC)

Am I too late to participate in this or am I doing something wrong? Where is this hint supposed to appear? I only see an empty backpack and the canvas on which references to different comics are placed. No comic I've visited, either inspired by references on the canvas, nor by random selection has any chest or other interactive components to it. [[User:Bischoff|Bischoff]] ([[User talk:Bischoff|talk]]) 09:53, 3 April 2020 (UTC)
:No, you're doing it right. Hints show up in the backpack area. Obviously no one is sure of anything, but even users who have seen hints have reported not seeing hints on a different browser/device. I suspect something similar to [https://xkcd.com/1037/ Umwelt], where different hints are shown to different people. And I think once a chest is picked up, it stops appearing to everyone that could see it, but that's a guess.[[User:Matthias1|Matthias1]] ([[User talk:Matthias1|talk]]) 10:03, 3 April 2020 (UTC)
::Ok, I was unsure because on my windows 10 laptop I have yet to see a hint. I've tried chrome, firefox and internet explorer. [[User:Bischoff|Bischoff]] ([[User talk:Bischoff|talk]]) 11:09, 3 April 2020 (UTC)
:::Finally got it to work in Safari in iOS [[User:Bischoff|Bischoff]] ([[User talk:Bischoff|talk]]) 11:13, 3 April 2020 (UTC)

When I view the comic, I don't see the closed box - the screen is absolutely full of stickers. I've not done any scavenger hunting (I'd upload an image, but I don't have permissions to do so) [[User:Kvetch|Kvetch]] ([[User talk:Kvetch|talk]]) 11:10, 3 April 2020 (UTC)

Hints I've seen so far: "The first one was funnier" (chest appeared in comic 1, contained I'm a turtle);
"418 I'm a teapot"
"26th September, 1983" (comic 2052, Stanislav Petrov Day, white dove); [[Special:Contributions/172.69.134.135|172.69.134.135]] 11:20, 3 April 2020 (UTC)

Perhaps a table for found chests with no attached hints? I've stumbled across a few but don't know if they're hinted at or not :). [[User:Deranged|Deranged]] ([[User talk:Deranged|talk]]) 11:54, 3 April 2020 (UTC)
:Maybe add a line to the table with a blank first box, the link in the second box, empty third box? Someone will match it up. [[Special:Contributions/162.158.166.37|162.158.166.37]] 12:21, 3 April 2020 (UTC)

"Churchill's gonna have to rehydrate" is Nothing to Offer. Can't remember what number, I think 1148?

In other news, the bad ads are back ([[Talk:2220: Imagine Going Back in Time/Ads|previous discussion]]) - who's in charge of dealing with them anyway? [[User:Arcorann|Arcorann]] ([[User talk:Arcorann|talk]]) 12:25, 3 April 2020 (UTC)

Could someone post an image showing what it looks like to find a chest on a comic? I've browsed to some of the comics referenced as having chests but couldn't see one so far. Thanks![[Special:Contributions/141.101.69.13|141.101.69.13]] 12:54, 3 April 2020 (UTC)

"The other side of the wardrobe", someone's put in the solution [[2218: Wardrobe]]; but I also found the chest on [[665: Prodence]]. Can there be multiple solutions to the same hint? [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 13:00, 3 April 2020 (UTC)

Talk:2253: Star Wars Voyager 1

2020-01-10T10:18:34Z

Angel:

;Rate of increase
Given that the first Star Wars movie and Voyager I were "released" around the same time, and that over the years Voyager has been getting further away while more Star Wars movies have been realeased, I wonder how often the time it takes for a message to reach Voyager I has been exactly the same as the total runtime of Star Wars movies at that date. Like, how far away was Voyager when Revenge of the Sith was released? This would make for an interesting graph.

RANDALL CAN YOU HEAR ME? MAKE A GRAPH PLS {{unsigned|Alcatraz ii}}
:Yes that could be interesting actually. Sadly I belvie Randall keeps clear of such sites as this so he will not see you request. Remember to sign your comments, and try not to add new sections in the comments. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 08:31, 10 January 2020 (UTC)

How accurately is the position of Voyager I known? I think this comic came out earlier in the day than usual, and I found myself wondering if there's public data precise enough to calculate this momentous occasion to within an hour, or even a minute. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 10:18, 10 January 2020 (UTC)

Talk:2250: OK/okay/ok

2020-01-03T17:41:55Z

Angel:

I think this should have been a table. Put spellings down the side (I've seen a lot of "oki" online; maybe "A-OK" too, or some humorous misspelling) and possible permutations of punctuations and capitalisation across the top. I want to know how "o.k.ay." makes you sound :p [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 17:41, 3 January 2020 (UTC)

Talk:2249: I Love the 20s

2020-01-02T10:53:54Z

Angel: (is that right?)

in gif diehard is a Christmas movie. There is no right or wrong answer.
But is White Hat right or wrong? [[Special:Contributions/162.158.91.197|162.158.91.197]] 19:00, 1 January 2020 (UTC)
:Both. It's the only way to settle this. [[Special:Contributions/173.245.54.63|173.245.54.63]] 19:13, 1 January 2020 (UTC)
::I think that he is right, but it’s like asking if diehard is a Christmas movie. There is no right or wrong answer.
:::Indeed, famed D.J. and space journalist [https://www.youtube.com/watch?v=FZVOSZqth70 Scott Manley says it's a new decade in C but not in FORTRAN]. [[Special:Contributions/172.68.189.241|172.68.189.241]] 19:37, 1 January 2020 (UTC)
::::You mean it's already 21th century for FORTRAN? -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 23:33, 1 January 2020 (UTC)
::::But what decade is it in the {{w|Delisle scale}}? [[Special:Contributions/141.101.98.250|141.101.98.250]] 20:35, 1 January 2020 (UTC)
I'm fairly certain Ponytail contradicts herself in panel 5. Arguing that decades are not cardinally numbered is arguing that the decade starts in 2021 (ordinal numbering.) [[Special:Contributions/162.158.126.34|162.158.126.34]] 21:20, 1 January 2020 (UTC)
:She doesn't: you're assuming there are only two options, but that's not the case. Decades (in the common "20s, 30s, 40s" form) are not technically numbered at all: they're named, it's just that those names are based on numbers.
:It's still a sequence, like names or dictionary entries being grouped into "As, Bs, Cs" and so on, though. (Is there a specific name for this type of sequence? If so, I don't know it.) [[Special:Contributions/141.101.107.144|141.101.107.144]] 23:03, 1 January 2020 (UTC)
::She (more likely Randall's slip of the pen) is still wrong: what she means is that they aren't ''ordinally'' numbered, which is the reason the other guy is wrong. [[Special:Contributions/162.158.158.179|162.158.158.179]] 08:23, 2 January 2020 (UTC)
Having had this conversation on WhatsApp, I have settled on an ingenious solution that works for me (on being told that "0" had not been invented in the year between -1 and +1") and explains why decades start with "10, 20...": As usually nowadays, the first decade was the Betaversion and so only ran from 1-9... {{unsigned ip|188.114.103.5|07:29, 2 January 2020 (UTC)}}

Every year is a new decade. Just some of them overlap. The 203rd decade was from 2021 to 2030, while the '20s will run from 1920 to 1929. Both are legitimate decades. So id 1994-2003; it just doesn't have a convenient name to refer to it by. Heck, you don't even need a new year. 1981-12-03 to 1991-12-02 is the first decade of my life :) So if you want to celebrate the start of a new decade, you should celebrate ''every single day''. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 10:48, 2 January 2020 (UTC)

Talk:2249: I Love the 20s

2020-01-02T10:49:05Z

Angel: oops (and did the previous comment fail to sign his comment?)

in gif diehard is a Christmas movie. There is no right or wrong answer.
But is White Hat right or wrong? [[Special:Contributions/162.158.91.197|162.158.91.197]] 19:00, 1 January 2020 (UTC)
:Both. It's the only way to settle this. [[Special:Contributions/173.245.54.63|173.245.54.63]] 19:13, 1 January 2020 (UTC)
::I think that he is right, but it’s like asking if diehard is a Christmas movie. There is no right or wrong answer.
:::Indeed, famed D.J. and space journalist [https://www.youtube.com/watch?v=FZVOSZqth70 Scott Manley says it's a new decade in C but not in FORTRAN]. [[Special:Contributions/172.68.189.241|172.68.189.241]] 19:37, 1 January 2020 (UTC)
::::You mean it's already 21th century for FORTRAN? -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 23:33, 1 January 2020 (UTC)
::::But what decade is it in the {{w|Delisle scale}}? [[Special:Contributions/141.101.98.250|141.101.98.250]] 20:35, 1 January 2020 (UTC)
I'm fairly certain Ponytail contradicts herself in panel 5. Arguing that decades are not cardinally numbered is arguing that the decade starts in 2021 (ordinal numbering.) [[Special:Contributions/162.158.126.34|162.158.126.34]] 21:20, 1 January 2020 (UTC)
:She doesn't: you're assuming there are only two options, but that's not the case. Decades (in the common "20s, 30s, 40s" form) are not technically numbered at all: they're named, it's just that those names are based on numbers.
:It's still a sequence, like names or dictionary entries being grouped into "As, Bs, Cs" and so on, though. (Is there a specific name for this type of sequence? If so, I don't know it.) [[Special:Contributions/141.101.107.144|141.101.107.144]] 23:03, 1 January 2020 (UTC)
::She (more likely Randall's slip of the pen) is still wrong: what she means is that they aren't ''ordinally'' numbered, which is the reason the other guy is wrong. [[Special:Contributions/162.158.158.179|162.158.158.179]] 08:23, 2 January 2020 (UTC)
Having had this conversation on WhatsApp, I have settled on an ingenious solution that works for me (on being told that "0" had not been invented in the year between -1 and +1") and explains why decades start with "10, 20...": As usually nowadays, the first decade was the Betaversion and so only ran from 1-9...

Every year is a new decade. Just some of them overlap. The 203rd decade was from 2021 to 2030, while the '20s will run from 1920 to 1929. Both are legitimate decades. So id 1994-2003; it just doesn't have a convenient name to refer to it by. Heck, you don't even need a new year. 1981-12-03 to 1991-12-02 is the first decade of my life :) So if you want to celebrate the start of a new decade, you should celebrate ''every single day''. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 10:48, 2 January 2020 (UTC)