<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Jkrstrt</id>
		<title>explain xkcd - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Jkrstrt"/>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php/Special:Contributions/Jkrstrt"/>
		<updated>2026-05-15T02:01:13Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.30.0</generator>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2908:_Moon_Armor_Index&amp;diff=337694</id>
		<title>2908: Moon Armor Index</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2908:_Moon_Armor_Index&amp;diff=337694"/>
				<updated>2024-03-19T12:15:17Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: typo&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2908&lt;br /&gt;
| date      = March 18, 2024&lt;br /&gt;
| title     = Moon Armor Index&lt;br /&gt;
| image     = moon_armor_index_2x.png&lt;br /&gt;
| imagesize = 740x390px&lt;br /&gt;
| noexpand  = true&lt;br /&gt;
| titletext = Astronomers are a little unsure of the applicability of this index, but NASA's Planetary Protection Officer is all in favor.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a MOON ARMOR ROCK SAMURAI BOT - Please change this comment when editing this page. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
In this comic, [[Randall]] hypothesizes a situation in which each planet's moons were converted into protective armor to coat their respective planets. For example, the {{w|Moon}} would coat {{w|Earth}} in a 43 kilometer layer if it were molded into protective armor for the planet. It is unknown how the moons would be converted into armor, but with current technology, this would be highly impractical, if not impossible.{{citation needed}} It is also unclear how planets such as Jupiter, Saturn, Uranus, and Neptune, which are gas giants and thus have no solid surface, would sustain such a layer of armor, nor is it immediately evident what threat might necessitate such drastic measures. A 43km moon rock layer might in fact endanger life on Earth by blocking out the sun and impacting ecosystems, rather than protecting it.&lt;br /&gt;
&lt;br /&gt;
Mars' moons {{w|Phobos_(moon)|Phobos}} and {{w|Deimos_(moon)|Deimos}}, being very small compared to Mars, would make a very thin layer over Mars. Huge Jupiter would be covered with almost 3km of &amp;quot;moon&amp;quot;, which indicates just how much moon mass there is around Jupiter. This is, to a smaller degree, similar for Saturn, Uranus and Neptune. &lt;br /&gt;
&lt;br /&gt;
Some trans-Neptunian {{w|Dwarf_planet|dwarf planets}} and dwarf planet candidates are included, as well: Only Pluto, having a moon ({{w|Charon_(moon)|Charon}}) of a comparable size to its planet, would have a layer thicker than Earth's. Salacia, Haumea, Quaoar, Gonggong and Eris are among the ten largest such objects.&lt;br /&gt;
&lt;br /&gt;
The comic uses the ≈ sign to show that the formula is only an approximation: this is because it does not take account of the armor having a larger surface area as it gets thicker. This approximation would be perfect for a shield of thickness zero, but for the thickest shield (Pluto) the error is around 4% (52.5 km by approximation, but 50.4 km by calculation). If P, M and A are the Planet radius, Moon radius and Armour thickness respectively, we can use V(P+A) = V(P) + V(M) to get A^3 + (3P)A^2 + (3P^2)A - C^3 = 0 and then solve the cubic to make an accurate calculation. For multiple moons, this calculation can be used repeatedly to armor each moon with the previous moon, before using the final moon-conglomerate to armor the planet.&lt;br /&gt;
Compression effects due to increased gravity at the planet's surface in comparison to the moon's surface, which could compress the moon mass into smaller volumes, are not taken into account either.&lt;br /&gt;
&lt;br /&gt;
The title text states that astronomers are &amp;quot;unsure&amp;quot; about the applicability of protective armor made from moons, possibly because they are wary of {{w|Giant-impact_hypothesis|moons and planets getting too close}}. It is dubious whether there would be an actual increase in planet safety due to the procedure. Moons as they are already serve a protective purpose by deflecting incoming asteroids, and by covering a small portion of sky. &lt;br /&gt;
&lt;br /&gt;
The title text continues that NASA's [https://what-if.xkcd.com/117/ Planetary Protection Officer], whose job it is indeed to protect planets, is purportedly in favor of the idea. However, they are in fact responsible for keeping other celestial bodies safe from Earth's contamination, not for shielding planets in armor, as the title text suggests. There is no known method of shielding other planets from contamination by physically armoring them. {{citation needed}}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Planet/&amp;lt;br&amp;gt;dwarf planet !! Area (km²) || Moons || Volume (km³) || Moon shield thickness &amp;lt;!-- please add more info --&amp;gt;&lt;br /&gt;
|-&lt;br /&gt;
| {{w|Earth}} || 5.1007*10^8 || {{w|Moon|1}} || 2.196*10^10 || 43 km (27 mi)&lt;br /&gt;
|-&lt;br /&gt;
| {{w|Mars}} || 1.4437*10^8 || {{w|Moons of Mars|2}} || {{w|Phobos (moon)&lt;br /&gt;
|(5695±32)}}+{{w|Deimos (moon)|(1033±19)}} || 5 cm (2 in)&lt;br /&gt;
|-&lt;br /&gt;
| {{w|Jupiter}} || 6.1469*10^10 || {{w|Moons of Jupiter|95}} || 1.7646*10^11 || 2.87 km (1.78 mi)&lt;br /&gt;
|-&lt;br /&gt;
| {{w|Saturn}} || 4.27*10^10 || {{w|Moons of Saturn|146}} || 7.651*10^10 || 1.79 km (1.11 mi)&lt;br /&gt;
|-&lt;br /&gt;
| {{w|Uranus}} || 8.1156*10^9 || {{w|Moons of Uranus|28}} ||  || &lt;br /&gt;
|-&lt;br /&gt;
| {{w|Neptune}} || 7.6187*10^9 || {{w|Moons of Neptune|16}} ||  || &lt;br /&gt;
|-&lt;br /&gt;
| {{w|Pluto}} || 1.7744*10^7 || {{w|Moons of Pluto|5}} || {{w|Charon (moon)|(9.322×10^8)}}+{{w|Moons of Pluto|(approx 87100+38800+900+200)}} || 52.5 km (32.6 mi) (by XKCD)&lt;br /&gt;
50.4 km (31.3 mi) (by full calculation)&lt;br /&gt;
|-&lt;br /&gt;
| {{w|120347 Salacia|Salacia}} || 2.27*10^6 || {{w|Actaea (moon)|1}} || 1.41*10^7 || 6.21 km (3.85 mi)&lt;br /&gt;
|-&lt;br /&gt;
| {{w|Haumea}} || 8.14*10^6 || {{w|Moons of Haumea|2}} || {{w|Hiʻiaka (moon)&lt;br /&gt;
|(17.2*10^6)}}+{{w|Namaka (moon)|(2.57*10^6)}} || 2.43 km (1.51 mi)&lt;br /&gt;
|-&lt;br /&gt;
| {{w|50000 Quaoar|Quaoar}} || 3.78*10^6 || {{w|Weywot|1}} || 4.19*10^6 || 1.11 km (0.69 mi)&lt;br /&gt;
|-&lt;br /&gt;
| {{w|225088 Gonggong|Gonggong}} || || {{w|Xiangliu (moon)|1}} ||  || &lt;br /&gt;
|-&lt;br /&gt;
| {{w|Eris (dwarf planet)|Eris}} || (1.70±0.02)*10^7 || {{w|Dysnomia (moon)|1}} ||  || &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
[Text above diagram:]&lt;br /&gt;
:Moon armor index:&lt;br /&gt;
:How thick the shells around various worlds would be if their moon(s) were converted into protective armor&lt;br /&gt;
:≈Total moon volume/Planet surface area&lt;br /&gt;
&lt;br /&gt;
:[Vertical bars showing &amp;quot;moon armor&amp;quot; thicknesses for the Earth, Mars, Jupiter, Saturn, Uranus, Neptune, Pluto, Salacia, Haumea, Quaoar, Gonggong and Eris. Earth's bar has a label named &amp;quot;43 km thick&amp;quot; and is compared to the height of Mt Everest. The zoom in to the Mars' bar has a thickness label of 2&amp;quot; and is compared to a rover wheel over it. Pluto's bar has a label named &amp;quot;(Mostly Charon)&amp;quot;.]&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Astronomy]]&lt;br /&gt;
[[Category:Bar charts]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2838:_Dubious_Islands&amp;diff=325102</id>
		<title>2838: Dubious Islands</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2838:_Dubious_Islands&amp;diff=325102"/>
				<updated>2023-10-07T07:28:00Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */ &amp;quot;subcontinental&amp;quot;  otherwise all land is inherently an island. A planet with all land one drop of  water would be  one big island.&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2838&lt;br /&gt;
| date      = October 6, 2023&lt;br /&gt;
| title     = Dubious Islands&lt;br /&gt;
| image     = dubious_islands_2x.png&lt;br /&gt;
| imagesize = 740x1040px&lt;br /&gt;
| noexpand  = true&lt;br /&gt;
| titletext = Running for office in Minnesota on the single-issue platform 'dig a permanent channel through the Traverse Gap because it will make this map more satisfying.'&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a DUBIOUSLY LARGE ISLAND - Please change this comment when editing this page. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
The definition of &amp;quot;island&amp;quot; is a piece of subcontinental land completely surrounded by bodies of water. In most cases we don't count rivers and canals as the surrounding bodies{{citation needed}}, although small pieces of land like Manhattan are exceptions.&lt;br /&gt;
&lt;br /&gt;
Randall has ignored this, so he considers large parts of North America as &amp;quot;dubious&amp;quot; islands because they're separated from other parts of the continent by major rivers, canals, and large lakes.&lt;br /&gt;
&lt;br /&gt;
The repetition between the title &amp;quot;Dubious Islands&amp;quot; and the in-image label &amp;quot;Dubious Islands of North America&amp;quot; emphasizes the &amp;quot;Dubious-ness&amp;quot; of this map.  &amp;quot;Dubious&amp;quot; means &amp;quot;thought not to be completely true or not able to be trusted&amp;quot; (per Cambridge Dictionary).&lt;br /&gt;
&lt;br /&gt;
Randall's map's &amp;quot;Dubious Islands&amp;quot; are indeed not to be trusted -- they leave out many rivers and canals which would break them into many additional &amp;quot;islands&amp;quot;.  For example, southern Nova Scotia, southern New Jersey, and the nearly 60-mile-long &amp;quot;Grand Strand&amp;quot; of South Carolina are also islands by the sense used here in recognizing the Cape Cod Canal as creating an island.&lt;br /&gt;
&lt;br /&gt;
These and many other omissions would be errors -- except that Randall clearly labelled his islands &amp;quot;Dubious&amp;quot; (not to be trusted) from the start, and he is presumably well-aware of this map's inaccuracy.&lt;br /&gt;
&lt;br /&gt;
The {{w|Parting of the Waters}} explains the connection between the Yellowstone and Snake Rivers shown.&lt;br /&gt;
&lt;br /&gt;
{{w|Isa Lake}} drains into both the Snake River (via the Lewis River) and the Madison River (via the Firehole River), explaining the connection there.&lt;br /&gt;
&lt;br /&gt;
It is unclear why {{w|Divide Creek}} which connects Hudson's Bay to the Columbia River is not shown on this map.&lt;br /&gt;
&lt;br /&gt;
The title text suggests that a new island could be created by digging a canal through the {{w|Traverse Gap}}, and this is Randall's platform when running for office in Minnesota. This is unnecessary and would create little benefit to residents,{{Citation needed}} but constituents who like interesting maps might vote for him.&lt;br /&gt;
&lt;br /&gt;
These islands are possibly Randall's humorous interpretation of what continued climate change-induced sea level rise might cause. But this seems unlikely since some of the connections shown are over 7000' in elevation, a water level that would leave almost all of North America (and many of these &amp;quot;islands&amp;quot;) completely submerged.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
:[Title:] Dubious Islands of North America&lt;br /&gt;
:[Subtitle:] And the waterways that separate them&lt;br /&gt;
&lt;br /&gt;
:[A map of mainland North America, down to the Panama isthmus. It is internally separated by various waterways, given labels or otherwise.]&lt;br /&gt;
&lt;br /&gt;
:[Separating land approximating Nunavut (with some Northern Territories) from neighbouring Canada:] Mackenzie Athabasca Churchill&lt;br /&gt;
&lt;br /&gt;
:[Comprising the much of the remainder of Canada, much of the northern United States (including Alaska), additionally separated by:] Columbia Snake Madison Missouri Chicago [Unlabelled, some of the Great Lakes and the channel past Quebec]&lt;br /&gt;
::[An incursive gap near the central point, from the north:] Nelson Red&lt;br /&gt;
::[An internal label, with arrow:] Traverse Gap&lt;br /&gt;
::[An incursive gap near the central point, from the south:] Mississippi&lt;br /&gt;
::[A separate fragment of land south of the Madison, in the western half of the land-mass, bordered to its south by:] Yellowstone&lt;br /&gt;
::[A small fragment off the southen part of the western edge, an arrow and a label:] Chehalis/Black Lake&lt;br /&gt;
&lt;br /&gt;
:[Nova Scotia, New Brunswick and parts of the adjacent US, disconnected by:] Champlaw Hudson&lt;br /&gt;
::[Label with an arrow on the east coast:] Cape Cod Canal&lt;br /&gt;
&lt;br /&gt;
:[A small triangle of territory, further isolated by:] Erie&lt;br /&gt;
&lt;br /&gt;
:[Most of the Eastern Seaboard of the US, additionally divided off by:] Tombigbee&lt;br /&gt;
::[Fragment of land shorn from the northern part of the eastern edge, label with arrow:] Chesapeake and Delaware Canal&lt;br /&gt;
::[Fragment of land shorn from the tip of Florida, label with arrow:] Okeechobee Waterway&lt;br /&gt;
&lt;br /&gt;
:[Strip of land west of the Tombigbee, bounded also to its west by:] Mississippi&lt;br /&gt;
::[Fragment of land immediately to its south, with a nearby label and arrow:] Atchafalaya&lt;br /&gt;
&lt;br /&gt;
:[The remainder of the continent; comprising much of the US, all of Mexico and various central American territories, with a final tip of the eastwards-bending isthmus:] Panama Canal&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Maps]]&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:Politics]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2660:_Gen_Z&amp;diff=293116</id>
		<title>2660: Gen Z</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2660:_Gen_Z&amp;diff=293116"/>
				<updated>2022-08-19T08:31:18Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */ yaourt&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2660&lt;br /&gt;
| date      = August 17, 2022&lt;br /&gt;
| title     = Gen Z&lt;br /&gt;
| image     = gen_z.png&lt;br /&gt;
| titletext = Curdled milk, of a peculiar kind, made after a Bulgarian recipe and called &amp;quot;yaghurt,&amp;quot; is now a Parisian fad and is believed to be a remedy against growing old. A correspondent who has tried it, says he would prefer to die young. (1905, The Elk Falls Journal)&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a CONFUSINGLY TRENDY BOT - Please change this comment when editing this page. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
Older generations are often confused by the trends and norms of younger people, and this comic aims to contextualize this common situation by placing it in a historical perspective. The man in the black hat is expressing a notion that sounds a lot like  [https://www.youtube.com/watch?v=LD0x7ho_IYc juvenoia], and is quick to make sweeping generalizations about the younger group.  The other reactions depicted are representative of the broader spectrum of possible responses: either surprised interest or cautious acceptance.  Neither knee-jerk rejection nor forward-looking sympathy are specifically praised by the main text of the comic, but the example highlighted in the title text seems to imply that Randall would like to emphasize openness to new things.&lt;br /&gt;
&lt;br /&gt;
The title text [https://mobile.twitter.com/xkcd/status/1560020008545165319 quotes] a newspaper from Elk Falls, Kansas, which on May 18, 1905, told of a &amp;quot;Parisian fad&amp;quot;.  The item was a shortened version of an account which also ran in many other newspapers.  In this case, the &amp;quot;fad&amp;quot; is the introduction of {{w|yogurt}} (spelled &amp;quot;yaghurt&amp;quot; in this publication, probably because English spelling of the word was not standardized yet and may have been influenced by the French spelling (&amp;quot;yaourt&amp;quot;) and phonology).  In the modern day, yogurt is enjoyed as a common food in most [[559: No Pun Intended|cultures]], but in 1905 the concept was bizarre and repulsive to many readers.  This shows that things which are dismissed as &amp;quot;strange&amp;quot; because of preconceived notions of a particular group (that curdled milk is necessarily bad) may, in fact, be perfectly acceptable once more context is obtained.  It is also worth noting that yogurt was not invented in 1905, but had existed for centuries prior; despite this, the recent introduction to French culture is what prompted its recognition as a nascent &amp;quot;fad&amp;quot;.  This may be analogized to various fads and trends which {{w|Gen Z}} is embracing which may appear unfounded to members of older generations, but which nevertheless represent acceptance of ideas which did not originate with members of that generation.  Randall may have chosen this particular version of the item in part because it omits some of the statements in the longer item, such as that consumption of yogurt could “prolong human life to what is its normal span - a century or so.”&lt;br /&gt;
&lt;br /&gt;
This is not the first comic to identify &amp;quot;modern&amp;quot; complaints or viewpoints as having been present throughout history in various forms (see comics [[1227: The Pace of Modern Life]] and [[1601: Isolation]]).&lt;br /&gt;
&lt;br /&gt;
The humor in making generalizations about people born in specific time periods is also seen in [[973: MTV Generation]], [[1962: Generations]] and [[2249: I Love the 20s]].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:[Six individuals in clothing representing early 1900s' American fashion stand in a line.  Four of them have speaking roles, from left to right, and two stand in silence, contributing to the feeling of a conversation amongst a crowd gathered around the first speaker]&lt;br /&gt;
:Speaker 1 (white brim hat): Now, it may sound strange, but it's how Gen Z is doing things!&lt;br /&gt;
:Speaker 2 (wavy hair, dress with belt): Gosh!  Is that really true??&lt;br /&gt;
:Speaker 3 (dark hat with indent): Ridiculous.  It just goes to show what I've been saying about them.&lt;br /&gt;
:Speaker 4 (hair in bun, dress with lace hem): Now now, maybe we just need to change with the times.&lt;br /&gt;
&lt;br /&gt;
:Caption below comic: People ascribing qualities to &amp;quot;Gen Z&amp;quot; have the same energy as small-town salespeople in 1905 talking about what the ladies in Paris are up to.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Food]]&lt;br /&gt;
[[Category:Social interactions]]&lt;br /&gt;
[[Category:Comics featuring White Hat]]&lt;br /&gt;
[[Category:Comics featuring Hairbun]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1453:_fMRI&amp;diff=243472</id>
		<title>1453: fMRI</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1453:_fMRI&amp;diff=243472"/>
				<updated>2022-05-04T20:32:55Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: Undo revision 242288 by Ex Kay Cee Dee (talk)&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1453&lt;br /&gt;
| date      = November 28, 2014&lt;br /&gt;
| title     = fMRI&lt;br /&gt;
| image     = fmri.png&lt;br /&gt;
| titletext = They also showed activation in the parts of the brain associated with exposure to dubious study methodology, concern about unremoved piercings, and exasperation with fMRI techs who won't stop talking about Warped Tour.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{w|Functional magnetic resonance imaging}} (fMRI), as the name suggests, is an offshoot of the MRI. It shows brain activity, typically while the subject is performing tasks or responding to stimuli. During the test, the subject is laid in a relatively small cylinder inside a big, very loud, machine which produces extremely strong magnetic fields. To prevent damage or injury, the subject must remove all metal objects from their body, including piercings, jewelry, watches, etc.&lt;br /&gt;
&lt;br /&gt;
In the tests shown, the brain activity detected is a direct result of the testing environment itself, and has nothing to do with the simple tasks being performed by the subject. During fMRI participants hear loud noises, are confined in a small space (thus the claustrophobia) and have removed their jewelry. The researcher has mistaken these associated brain activities as effects as being caused by ''performing simple memory tasks'' which the participants have been asked to do and not a direct result of the settings of the test. Thus, the brain areas described by Megan are those associated with taking a functional MRI scan, rather than those associated with the &amp;quot;test&amp;quot; supposedly being carried out. The results being shown are known as {{w|Artifact_(error)|artifacts}}, which are shown later in [[1781: Artifacts]].&lt;br /&gt;
&lt;br /&gt;
In real experiments, reported activity patterns are always a result of subtracting average brain activity from many samples gathered during task from so called ''resting-state'' activity - which is obtained while subjects are not engaged in any task, thus eliminating the effect the setting has on brain activity. Apparently, the researcher in the comic has failed to account for that in the analysis of the data.&lt;br /&gt;
&lt;br /&gt;
The title text raises the more difficult and controversial issues of methodology, saying that the subjects ''also showed activation in the parts of the brain associated with exposure to dubious study methodology''. Here [[Randall]] makes fun of the overly confident, sweeping statements made by some fMRI researchers, often in the press. Of course, fMRI technique requires that the researcher account for several possible sources of errors by, among others, performing proper statistical analyses, multiple comparisons and using proper control groups. These are usually the reasons for {{w|Functional magnetic resonance imaging#Criticism|fMRI criticism}}. See the link for further information, including a famous ironic study of a dead salmon which was shown various pictures of people while fMRI scans were made. The scans could be interpreted as showing meaningful brain activity, unless the {{w|multiple comparisons problem}} was properly addressed. Randall has previously made fun of geographic profiles falling to this trap in comic [[1138: Heatmap|1138]].&lt;br /&gt;
&lt;br /&gt;
The title text then continues with the jewelry issue, now especially the ''concern about unremoved piercings''. In the worst case these could be ripped off by the strong magnetic field. So it could be of some concern - especially when you take into consideration some of the places people may have piercings that are not obvious to the MRI personnel! The final remark about activation regards ''exasperation with fMRI techs who won't stop talking about Warped Tour''. &amp;quot;{{w|Warped Tour}}&amp;quot; refers to a traveling music festival that has been going since 1995, originally as a punk rock festival, but now with a more diverse set of music. Due to the nature of {{w|Moshing|Mosh Pits}}, the loud, cacophonous music, the facial jewelry of concert-goers and the tight quarters of the pit make it similar in description to an MRI.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Megan talking to an unseen audience in front of an fMRI brain scan.]&lt;br /&gt;
:Megan: Our fMRI study found that subjects performing simple memory tasks showed activity in the parts of the brain associated with loud noises, claustrophobia, and the removal of jewelry.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Psychology]]&lt;br /&gt;
[[Category:Science]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2137:_Text_Entry&amp;diff=224857</id>
		<title>2137: Text Entry</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2137:_Text_Entry&amp;diff=224857"/>
				<updated>2022-01-19T14:38:06Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2137&lt;br /&gt;
| date      = April 15, 2019&lt;br /&gt;
| title     = Text Entry&lt;br /&gt;
| image     = text_entry.png&lt;br /&gt;
| titletext = I like to think that somewhere out there, there's someone whose personal quest is lobbying TV providers to add an option to switch their on-screen keyboards to Dvorak.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
In this comic, Randall remarks upon something that he considers to be an absurdity of modern living; that in spite of our amazing advances in technology, there still exist user interfaces in 2019 where a person has to &amp;quot;pick letters&amp;quot; to type, a somewhat clunky and inefficient method of text entry. This can be seen when doing searches in a TV guide menu or in menus for streaming options like {{w|Netflix}} or {{w|Hulu}}. Some of these menus may allow for voice searches or support {{w|bluetooth keyboard}}s, but the traditional method is still to select letters via a cursor.  Many controllers for devices only have a few buttons, which makes it necessary to use schemes such as scrolling around a picture of a keyboard to laboriously select letters, making this extremely inconvenient and annoying to users. The fact that these haven't been replaced with better interfaces comes as a surprise to Randall, hence him  believing it to be the second most weird thing in 2019. [[Cueball]] is probably looking up ''{{w|Our Planet}}'' which was a popular Netflix series when this comic was released. Cueball has spelled out &amp;quot;O U R [space] P L&amp;quot; so far.&lt;br /&gt;
&lt;br /&gt;
Randall references the &amp;quot;{{w|Score (game)|high score}}&amp;quot; in an {{w|arcade game}}. When achieving a high score in an arcade game, the user typically is able to enter their name or initials into the machine. These are entered by picking letters one by one (and usually under a time limit, for extra fun &amp;lt;s&amp;gt;and/or stress&amp;lt;/s&amp;gt;), as the comic mentions.&lt;br /&gt;
&lt;br /&gt;
The title text mentions the keyboard system {{w|Dvorak Simplified Keyboard|Dvorak}}, a [[:Category:Dvorak|recurrent theme]] on xkcd, which is a keyboard layout patented by {{w|August Dvorak}} and {{w|William Dealey}}. As the Dvorak layout is optimized for more efficient typing with two hands, it is unlikely that using it would be more efficient than a standard {{w|Qwerty}} when limited to cursor entry methods. Another drawback would be that the Dvorak layout is visually unfamiliar to most people, even to many Dvorak typists who rarely look at their keyboard and instead rely on muscle-memory to find keys. As such it could be confusing for users to use for TV selection menus compared to either the more visually familiar {{w|Qwerty}} layout or showing letters in alphabetical order. Alternately, Randall may be referring to Dvorak’s placement of frequently used letters clustered in the center as a potential slight improvement over the linear A-Z layout of such interfaces (a half-measure offered ironically, of course).&lt;br /&gt;
&lt;br /&gt;
Although the focus of this comic is on the text entry method, Randall prefaces the comic with what he considers to be the actual weirdest thing about 2019: that {{w|Donald Trump}} is the president of the United States of America. Randall had previously expressed support for Trump's opponent, Hillary Clinton, in the comic [[1756: I'm With Her]] which preceded the 2016 US Presidential Election. In that comic he did not mention Trump. Although [[Sad comics|several comics]] may have a relation to Donald Trump becoming president, this is the [[Sad_comics#Text_Entry|first time ever]], Donald Trump has been mentioned by his full name in a standard xkcd comic. (In [[1939: 2016 Election Map]] he is referred to by his surname).&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Ponytail and Cueball are sitting on a couch, with Megan standing behind them.  Cueball is pointing a remote at a television. The word space is written inside a frame.]&lt;br /&gt;
:Television: O...U...R...SPACE...P...L...&lt;br /&gt;
:Remote: Click Click Click&lt;br /&gt;
&lt;br /&gt;
:[Caption below the panel:]&lt;br /&gt;
:The weirdest thing about 2019 is obviously that Donald Trump is president, but I think the second weirdest is that you sometimes ''still'' have to type stuff in by picking letters on a screen one at a time with a cursor like you're entering a high score in a 1980s arcade game.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Comics featuring Ponytail]]&lt;br /&gt;
[[Category:Politics]]&lt;br /&gt;
[[Category:Video games]]&lt;br /&gt;
[[Category:Dvorak]]&lt;br /&gt;
[[Category:Comics featuring Donald Trump]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2525:_Air_Travel_Packing_List&amp;diff=218988</id>
		<title>2525: Air Travel Packing List</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2525:_Air_Travel_Packing_List&amp;diff=218988"/>
				<updated>2021-10-08T07:15:10Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2525&lt;br /&gt;
| date      = October 6, 2021&lt;br /&gt;
| title     = Air Travel Packing List&lt;br /&gt;
| image     = air_travel_packing_list.png&lt;br /&gt;
| titletext = I know the etiquette is controversial, but I think it's rude when the person in front of me reclines their seat into the bell of my trumpet.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by an TRUMPETBORNE PARACHUTER - Please change this comment when editing this page. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is another in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}. &lt;br /&gt;
&lt;br /&gt;
The comic is about a proposed air-travel packing list, and the humor stems from the fact that many people have not been flying during the pandemic, and thus they might have forgotten what to pack. So [[Randall]] is so kind as to provide a packing list with 20 items. However, apart from the first item, the rest is not something you should or would normally bring on a plane.&lt;br /&gt;
&lt;br /&gt;
Many of the items are already found on the plane, some would seem like they could be useful on a plane, while other could actually be useful in case of a plane crash (but only if you survive). Below in [[#Table of items|the table]] is a quick summary of each item.&lt;br /&gt;
&lt;br /&gt;
The title text reference the idea that there is a trumpet for each passenger provided by the airline; item number 16 on the list. This items also states that you, because of the covid-19 pandemic, should remember to bring your own mouthpiece for the trumpet for safety measure. &lt;br /&gt;
&lt;br /&gt;
The trumpet idea is then combined with the common debate regarding reclining your seat in airplanes. About half of the people think that reclining is rude as it takes up the space of the person behind you. The other half think that seats recline for a reason and the person in a seat has the rights to the space behind them. See for instance this [https://www.youtube.com/watch?v=08A30v8isRs video] about such a debate. Reclining a seat has resulted in actual [https://www.independent.co.uk/news/world/americas/crime/fight-airplane-man-punch-video-b1895402.html physical fights] on board planes.&lt;br /&gt;
&lt;br /&gt;
Here it seems that Randall sides with the anti-recliners, although maybe only in the context of the comic, because he states that the recline would prevent him from playing his trumpet, as the seat hits the bell of the trumpet The person in front could certainly argue that playing the trumpet behind them would be very annoying, to which Randall could reply that because the trumpet is provided by the airline, he has the right to play it. This would add a new layer to the debate. This could also be Randall's way of arguing against the right to recline a seat, just because it is possible.&lt;br /&gt;
&lt;br /&gt;
===Table of items===&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
! Item&lt;br /&gt;
! Explanation&lt;br /&gt;
|-&lt;br /&gt;
|Seat cushion&lt;br /&gt;
|This can be used as a flotation device in a crash and is provided by the airline. Some people may also bring their own cushions for comfort.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Parachute}}&lt;br /&gt;
|Parachutes are normally used to slow down your falling out of the sky to a relatively safe speed in case of a severe problem with your aircraft, and are routinely used as a safety device by (para)glider pilots, test pilots, military aircraft crew and in similar situations when being unable to land safely is a significant concern. A parachute won't be very useful in a typical passenger airplane (even a small one) as there is no way to safely exit such a plane in-flight. Even the airplanes used for {{w|skydiving}} need to be specifically designed or modified for that purpose, such as having wide sliding doors that are unaffected by airflow. However, there were single cases of people being ejected or sucked out of a passenger airplane; in such case a parachute could by arguably useful. Famously, [[:Category:Comics featuring D. B. Cooper|D.B. Cooper]] jumped from an airplane in-flight with a parachute.&lt;br /&gt;
|-&lt;br /&gt;
|Wing glue&lt;br /&gt;
|Probably to repair wings in the event of damage, potentially in a crash. Would be tricky (but not necessarily impossible) to apply mid-flight. This the first of several items that are potentially useful to the flight crew or maintenance teams, but would not be useful or appropriate for passengers to bring aboard.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Air horn}}&lt;br /&gt;
|An air horn uses compressed air to make a very loud noise very easily. This may be important for drawing attention to yourself in the event of a crash. Typically, emergency lifejackets on a plane are provided with a light and whistle for this purpose. The noise of an air horn might prove more effective for this purpose than a whistle, but it would become useless as soon as the compressed air ran out. Its inclusion is probably meant to suggest that the word 'air' in its name indicates that it's designed for use in an aircraft. Using one in a non-emergency situation would infuriate everyone else on the plane.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Sextant}}&lt;br /&gt;
|In combination with star charts, a sextant can be used to determine your position based on the location of stars in the night sky. Alternately, in combination with an accurate clock, a sextant can be used to determine the position of the sun relative to the aircraft to determine the vehicle's position.  In a crash, you could use this to find your way to a safe place, but sextants are rarely used, and most people not trained on how to operate one. GPS will also allow you to find your position, is built into many phones, and is faster and easier to use than a sextant. If you've got a homing beacon, it probably makes more sense to just activate that and wait for help to arrive.&lt;br /&gt;
&lt;br /&gt;
Until the early 1980s, long-range airplanes had a {{w|Air_navigation#Flight_navigator|flight navigator}} who used sextants and {{w|celestial navigation}} to determine the position of the airplane. Interestingly, it was much more accurate than early {{w|inertial navigation systems}}, and the accuracy of celestial navigation is still useful today. What made the sextant redundant was the INS' lower workload - the error accumulated by the INS during a long oceanic flight could always and easily be mitigated by other means, for example with {{w|VHF omnidirectional range|VOR}}/{{w|Non-directional beacon|NDB}} radio beacons.  &lt;br /&gt;
|-&lt;br /&gt;
|Nose plugs and goggles for pressure&lt;br /&gt;
|Nose plugs and goggles are commonly used in swimming but would be useless for dealing with cabin pressurization or depressurization. Since your mouth and nose are interconnected, nose plugs would be useless on their own. Trying to hold your breath in a sudden depressurization event will cause lung damage, so nose plugs wouldn't be a good thing, even if you could also seal off your mouth. Goggles would also not be useful. During depressurization, the air would just seep out. During pressurization, they would just become uncomfortable and difficult to remove.&lt;br /&gt;
|-&lt;br /&gt;
|Airplane shoes&lt;br /&gt;
|Airlines typically don't require the use of special footwear for passengers, nor do they provide special shoes. Before emergency egress, certain shoes (like high heels) must be discarded, though. Aircrew are also prohibited from wearing such shoes. &lt;br /&gt;
|-&lt;br /&gt;
|Navigation crystal&lt;br /&gt;
|Mystical form of navigation, presumably either for navigation during flight or to help you get home after a crash.&lt;br /&gt;
Crystals that polarize light can be used as a compass [http://www.polarization.com/viking/viking.html].&lt;br /&gt;
|-&lt;br /&gt;
|Spare batteries in case the plane runs out&lt;br /&gt;
|Airplanes will generally use more power than any battery small enough to be easily packed in a bag can provide. They will generally use either 115V AC at 400Hz or 28V DC, both of which are very uncommon outside of aviation. The plane will almost never use its own batteries in-flight anyway, getting its electric power from the main engines, the APU, or, in emergencies, the ram air turbine or similar generating device. The batteries are generally only used on the ground when the engines are not running.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Birdseed}}&lt;br /&gt;
|So one can attract birds. In practice, this wouldn't work for multiple reasons (high speed, altitude, and sealed windows being some of most obvious ones) and would pose a significant hazard of birds getting stuck in an engine if it did. On the other hand, spreading birdseed before boarding would be seen as misconduct by airport authorities, as it may pose a danger to aircraft by attracting birds. Alternatively, birdseed can be used to attract birds after surviving a crash, e.g. to catch them for food.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Homing beacon}}&lt;br /&gt;
|Once activated, a homing beacon will send out a continuous radio signal so that rescuers can find your location. These can be very useful in a plane crash, but airplanes already carry them ({{w|Emergency position-indicating radiobeacon}}s), so you don't need to pack one yourself. Incidentally, the {{w|COSPAS-SARSAT}} system for locating distressed airplanes and ships was a cooperation started by the United States and the Soviet Union, and it was an elegant and simple solution that uses the {{w|Doppler effect}} of radio signals for accurate location - long before the {{w|Global Positioning System}}.&lt;br /&gt;
|-&lt;br /&gt;
|Meteorite antidote&lt;br /&gt;
|Meteorites are pieces of space rocks that make it all the way to the ground. They can cause injury but they aren't poisonous{{Citation needed}}, so an antidote would not help.&lt;br /&gt;
|-&lt;br /&gt;
|USB wing connector&lt;br /&gt;
|This is a just a wire connector, but because it has wing in the name is on the list. Alternatively, the plane wings connect by USB, and this can be used to reattach wings. Airplanes usually use the {{W|ARINC 429}} protocol (or, increasingly, TCP/IP, RS427, RS232, or even CANBUS) instead of USB protocols to facilitate electronic communication between flight computers and the engines, for example.&lt;br /&gt;
|-&lt;br /&gt;
|Emergency siren&lt;br /&gt;
|USE IN CASE OF EMERGENCY&lt;br /&gt;
|-&lt;br /&gt;
|Spare flaps&lt;br /&gt;
|Flaps can be moved to adjust the lift/drag ratio of a wing, generally during takeoff and landing. Flaps are very large and mounted on the wing, outside the passenger compartment, so bringing spares would be very difficult and completely useless. Flaps failing to come down can also usually be remedied by just landing at a longer runway.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Mouthpiece (brass)|Mouthpiece}} (pandemic restriction; airlines still provide the trumpet)&lt;br /&gt;
|A part of a brass instrument like a trumpet. Randall jokes that trumpets are provided on airplanes (which would be very obnoxious to other passengers), but due to the pandemic you cannot use a shared mouthpiece.&lt;br /&gt;
|-&lt;br /&gt;
|Luggage ballast&lt;br /&gt;
|Likely to make plane more balanced. While balancing weight in a plane is indeed a real problem, it's solved by rearranging luggage and adjusting engine power slightly. Introducing ballast would mean additional weight for no real reason.&lt;br /&gt;
Alternatively, while a common passenger issue is to have hand- and/or hold-luggage that exceeds the airline's personal allowance, this person has ''under''weight baggage and does not wish to 'waste' the difference, so bulks it up. (Noting that someone already with the rest of the items on this list is unlikely to suffer this 'problem'.)&lt;br /&gt;
|-&lt;br /&gt;
|Flag (international flights)&lt;br /&gt;
|To identify your country of origin. Other flags are also used to communicate between boats without electricity, in the event the boats are in distress, so they could be used in the event of a crash.&lt;br /&gt;
|-&lt;br /&gt;
|Decoy tickets&lt;br /&gt;
|Maybe these would used as a distraction so you can sneak onto the plane without paying?&lt;br /&gt;
But also a typical trope for fictional (and real life?) attempts to evade being tracked or followed. Buy tickets for one destination, that one assumes the opposition will be fully aware of, but also arrange for another set (probably with a 'clean' identity) for your intended destination and switch to using those once in the chaos of the departure-lounge.&lt;br /&gt;
|-&lt;br /&gt;
|Keys to the plane&lt;br /&gt;
|Though some pushed for it after a plane was stolen in the {{w|2018 Horizon Air Q400 incident}}, most commercial planes do not require keys to start the engine(s) like a car does. Likewise, plane doors are not locked with a key. Instead, they are secured with a tamper seal. If a seal is found broken, the plane is thoroughly checked for any wrongdoing.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[A lists of 20 items is given in two columns with 10 items in each. Each item is preceded by a checkbox. Most items only take up one line, but in the left column two items take up two and in the right one item take up three, so they take up the same space. Above is a large heading, with an explanation beneath it.]&lt;br /&gt;
:&amp;lt;big&amp;gt;&amp;lt;big&amp;gt;Air Travel Packing List&amp;lt;/big&amp;gt;&amp;lt;/big&amp;gt;&lt;br /&gt;
:&amp;lt;big&amp;gt;If you haven't flown in a while, you might not remember what you need to bring. Use this handy checklist to pack!&amp;lt;/big&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:[Left column:]&lt;br /&gt;
:☐ Seat cushion&lt;br /&gt;
:☐ Parachute&lt;br /&gt;
:☐ Wing glue&lt;br /&gt;
:☐ Air horn&lt;br /&gt;
:☐ Sextant&lt;br /&gt;
:☐ Nose plugs and goggles for pressure&lt;br /&gt;
:☐ Airplane shoes&lt;br /&gt;
:☐ Navigation crystal&lt;br /&gt;
:☐ Spare batteries in case the plane runs out&lt;br /&gt;
:☐ Birdseed&lt;br /&gt;
&lt;br /&gt;
:[Right column:]&lt;br /&gt;
:☐ Homing beacon&lt;br /&gt;
:☐ Meteorite antidote&lt;br /&gt;
:☐ USB wing connector&lt;br /&gt;
:☐ Emergency siren&lt;br /&gt;
:☐ Spare flaps&lt;br /&gt;
:☐ Mouthpiece (Pandemic restriction; airlines still provide the trumpet)&lt;br /&gt;
:☐ Luggage ballast&lt;br /&gt;
:☐ Flag (International flights)&lt;br /&gt;
:☐ Decoy tickets&lt;br /&gt;
:☐ Keys to the plane&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:COVID-19]]&lt;br /&gt;
[[Category:Animals]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2523:_Endangered&amp;diff=218764</id>
		<title>2523: Endangered</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2523:_Endangered&amp;diff=218764"/>
				<updated>2021-10-02T10:05:31Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */ corrected typo (I hope it was not meant to be a pun)&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2523&lt;br /&gt;
| date      = October 1, 2021&lt;br /&gt;
| title     = Endangered&lt;br /&gt;
| image     = endangered.png&lt;br /&gt;
| titletext = The list includes polio, Guinea worm, and this one particular enterovirus strain that they've been tracking out of spite after it went around the lab a few years ago.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a HEARTBLEED BUG - Please change this comment when editing this page. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
The {{w|endangered species}} list (also known as the {{w|IUCN Red List}}) is a system for categorizing species based on &amp;quot;level of extinction&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
[[Ponytail]], [[Cueball]], and [[Megan]] in this comic are scientists who are sarcastically worried about pathogen strains becoming extinct. People in general want harmful pathogens to go extinct.{{citation needed}}&lt;br /&gt;
&lt;br /&gt;
Randall was most likely inspired by [https://www.nature.com/articles/s41579-021-00642-4 this article] about different {{w|influenza}} strains. Influenza causes the yearly flu, which infects 3-5 million people worldwide.&lt;br /&gt;
&lt;br /&gt;
The title text mentions {{w|polio}} and {{w|Dracunculiasis|Guinea worm disesase}} - diseases that are being eradicated due to worldwide efforts - the former, famously, through vaccination, and the latter through education and prevention techniques. A Google search [https://www.google.com/search?q=&amp;quot;sarcastic+endangered&amp;quot;+list] seems to indicate that the &amp;quot;sarcastic endangered&amp;quot; list is not a real thing. &lt;br /&gt;
&lt;br /&gt;
The bitter irony here is that much recent scholarship has described [https://www.smithsonianmag.com/science-nature/parasites-are-going-extinct-heres-why-thats-a-bad-thing-180964808/ links between parasite biodiversity and ecosystem-wide, indeed planet-wide, biodiversity]. In few, if preserving and expanding biodiversity are seen as good things, then preserving and expanding biodiversity of parasites is a good thing, the one not being possible without the other. Parasites and disease agents, arguably, are classes of predators, and their removal can help establish a superpredator, the actions of which can catastrophically drive down biodiversity. Humans, released from predation by a large percentage of formerly-effective microbial predators, through the introduction of penicillin and other antibiotics plus other elements of 'heroic medicine', sanitation, etc., have arguably [https://www.smithsonianmag.com/science-nature/modern-humans-have-become-superpredators-180956348/ become such a superpredator], and one that is mediating a loss of global biodiversity that may become the largest single species-extinction event in the history of planet Earth.&lt;br /&gt;
&lt;br /&gt;
There also seems to be some evidence that infections with influenza viruses increase the chance of a heart attack. For instance regular flu shorts reduce the risk of heart attacks [https://www.heart.org/en/news/2020/11/18/flu-shot-reduces-risk-of-death-for-people-with-heart-disease]. Thus the fact that we are &amp;quot;heartbroken&amp;quot; when B/Yamagata goes extinct could be sarcastic, since we might in fact suffer less from broken hearts.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:[Ponytail stands facing Cueball and Megan in front of a poster board.]&lt;br /&gt;
:[Ponytail is pointing a stick to the board reading &amp;quot;Current List&amp;quot; with bullet points beneath.]&lt;br /&gt;
:[The first bullet reads Influenza B/Yamagata.]&lt;br /&gt;
:[Four further bulletpoints follow, which are left indistinct.]&lt;br /&gt;
&lt;br /&gt;
:Ponytail: Influenza's genetic diversity has declined druing the pandemic, and the B/Yamagata lineage is at risk of extinction.&lt;br /&gt;
:Ponytail: Which would be ''such'' a shame.&lt;br /&gt;
:Megan: Yeah, I'm sooooooo worried about it.&lt;br /&gt;
:Cueball: We'd be just ''heartbroken!''&lt;br /&gt;
&lt;br /&gt;
:[Caption below the panel]: &lt;br /&gt;
:When a pathogen that scientists really don't like is close to disappearing, it gets added to the sarcastic endangered species list.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Ponytail]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Biology]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2456:_Types_of_Scientific_Paper&amp;diff=211243</id>
		<title>2456: Types of Scientific Paper</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2456:_Types_of_Scientific_Paper&amp;diff=211243"/>
				<updated>2021-04-29T06:06:35Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: immune system&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2456&lt;br /&gt;
| date      = April 28, 2021&lt;br /&gt;
| title     = Types of Scientific Paper&lt;br /&gt;
| image     = types_of_scientific_paper.png&lt;br /&gt;
| titletext = Others include &amp;quot;We've incrementally improved the estimate of this coefficient,&amp;quot; &amp;quot;Maybe all these categories are wrong,&amp;quot; and &amp;quot;We found a way to make student volunteers worse at tasks.&amp;quot;&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a RESEARCH DEPARTMENT ON A LUNCHBREAK. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
In this comic, Randall describes categories of scientific papers with somewhat humorous generalized titles.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|+Breakdown of Papers&lt;br /&gt;
|-&lt;br /&gt;
!Paper Title&lt;br /&gt;
!Explanation&lt;br /&gt;
!Article Description&lt;br /&gt;
|-&lt;br /&gt;
!scope=row|We put a camera somewhere new&lt;br /&gt;
|This may involve miniaturisation or other improvements of imaging sensors, power supply, transmission or retention of data, environmental hardening and (possibly) recovery afterwards. Photographs and videos can be especially helpful in understanding what is or was going on, especially for the layman, than more limited signal traces.&lt;br /&gt;
&lt;br /&gt;
Cameras have been inserted into ''every'' obvious bodily orifice (including swallowed, to be later excreted), placed in habitats to monitor wildlife, attached to wildlife to monitor habitats, sent into volcanic craters/ocean trenches/high altitudes/nuclear reactors, launched into space and sent past/round/onto several of the solar-system's more interesting bodies.&lt;br /&gt;
&lt;br /&gt;
|There are no headers, so the text may discuss the records without undertaking a more structured study. Includes a large figure, likely an image captured with the camera.&lt;br /&gt;
|-&lt;br /&gt;
!scope=row|Hey, I found a trove of old records! They don't turn out to be particularly useful, but still, cool!&lt;br /&gt;
|Rather than starting with the aim of investigating some question, and finding some way of answering it by uncovering evidence, sometimes a writer may have stumbled upon a cache of historic documents that they then feel compelled to justify the resulting 'WikiWalk' they may have found themselves sucked into.&lt;br /&gt;
|Small figure may show the most interesting fragment of the records.&lt;br /&gt;
|-&lt;br /&gt;
!scope=row|My colleague is wrong and I can finally prove it&lt;br /&gt;
|This title refers to the occasional rivalries between scientists within a field, which can push them to seek proof that they, and not their colleague, are correct.&lt;br /&gt;
|Note the lack of headers, suggesting an argument more than an explanation of data&lt;br /&gt;
|-&lt;br /&gt;
!scope=row|The immune system is at it again&lt;br /&gt;
|The human immune system is notoriously complex, and there are countless papers in medical fields just describing its strangeness. While it is best known for preventing and battling infections, in auto-immune disease, it can also turn against the body that it is supposed to protect. Moreover it can overreact, for instance in allergic reactions or in a potentially lethal {{w|cytokine storm}}  known to occur in certain viral infections, including {{w|Influenza}} and {{w|COVID-19}}.  &lt;br /&gt;
|&lt;br /&gt;
|-&lt;br /&gt;
!scope=row|We figured out how to make this exotic material, so email us if you need some&lt;br /&gt;
|Researchers often attempt to create materials despite there not being any demand, predicting that in the future their material will be game-changing without any actual applications. These researchers have created such a material, and are offering to produce it for anyone who needs it.&lt;br /&gt;
|&lt;br /&gt;
|-&lt;br /&gt;
!scope=row|What are fish even doing down there&lt;br /&gt;
|Deep sea marine biology regularly discovers [https://www.youtube.com/watch?v=u7QXdlSBGGY strange lifeforms] in unexpected places, and theories explaining deep sea ecosystems are regularly confounded by new data.&lt;br /&gt;
&lt;br /&gt;
Scientists may also bump into marine organisms when looking for something else. For example, one planned underwater neutrino detector [https://www.nature.com/articles/srep44938 picked up bioluminescence instead].&lt;br /&gt;
|This paper does not appear to have any headers, implying a longer, free-flowing format.&lt;br /&gt;
|-&lt;br /&gt;
!scope=row|This task I had to do anyway turned out to be hard enough for its own paper&lt;br /&gt;
|There is a huge variety in the complexity and importance of subjects studied in scientific papers, and often some supposedly easy task will be sufficiently complicated as to merit its own paper.&lt;br /&gt;
|&lt;br /&gt;
|-&lt;br /&gt;
!scope=row|Hey, at least we showed that this method can produce results! That's not nothing, right?&lt;br /&gt;
|One of the struggles of the scientific method is that many experiments will not produce the results scientists desired or expected. Negative or conflicting results of well-conducted research are as important as positive or dramatic ones, but are often ignored in favor of more novel findings. As a result, some journals are established specifically for negative results.&lt;br /&gt;
|&lt;br /&gt;
|-&lt;br /&gt;
!scope=row|Check out this weird thing one of us saw while out for a walk&lt;br /&gt;
|This paper may be imagined as an opportunistic publication. A department or team has seen itself low down on the local 'league table' for academic output. A brainstorming session for a way of rectifying this led to desperately seizing upon the first idle comment made (in lieu of any better sounding ideas) that can somehow be shoehorned into their respective subject area.&lt;br /&gt;
&lt;br /&gt;
This also works in the context of entomology. Insects have the most species of any class of animals [https://www.si.edu/spotlight/buginfo/bugnos by a wide margin], but due to their small size, they're not easily seen. As a result, new species are constantly being discovered in places as innocuous as [https://wildlife.org/video-entomologists-discover-30-new-species-in-la-backyards/ someone's backyard.]&lt;br /&gt;
|Includes several large figures, likely close-up photographs of the weird thing. There are no headers, as the paper may have little background or methodology, just observations.&lt;br /&gt;
|-&lt;br /&gt;
!scope=row|We are 500 scientists and here's what we've been up to for the last 10 years&lt;br /&gt;
| Some papers summarize the work of big research teams, like those working on the [https://repositorio.uc.cl/xmlui/bitstream/handle/11534/13948/Observation%20of%20a%20new%20particle%20in%20the%20search%20for%20the%20Standard%20Model%20Higgs%20boson%20with%20the%20ATLAS%20detector%20at%20the%20LHC.pdf Higgs Boson] (list of authors starts at page 17 and goes to page 26 with foot notes about authors to page 29) or LIGO. Since the discoveries which are made are a team effort, probably outlasting many of the individual tenures involved, the papers have many authors listed.&lt;br /&gt;
A credit for participation may not mean any particularly great contribution by each individual, but being left out (even for one summer's secondment, seven years before any results could be recorded) would be taken as a slight, and an opportunity missed to be 'citable' in the future.&lt;br /&gt;
|A huge portion of the page is taken up by the presumably 500 authors' names, above the main horizontal bar.&lt;br /&gt;
|-&lt;br /&gt;
!scope=row|Some thoughts on how everyone else is bad at research&lt;br /&gt;
|Similar to the &amp;quot;my colleague is wrong&amp;quot; paper, but in this case applied to far greater swathes of the community by the author(s) of this (possibly unfocussed) tract. Usually a &amp;quot;systematic review&amp;quot;.&lt;br /&gt;
|No header sections, possibly because these particular thoughts are in the form of an essay or letter without an accompanying investigation.&lt;br /&gt;
|-&lt;br /&gt;
!scope=row|We scanned some undergraduates&lt;br /&gt;
|Some initial research, especially that on a low budget, may recruit students at the same institution as easily available test-subjects. Quite often these are psychological or sociological studies, but can involve more medical (but non-invasive) 'scans', from simple eyeball-tracking to full-body MRI.&lt;br /&gt;
&lt;br /&gt;
When misread as &amp;quot;scammed&amp;quot;, this paper can also refer to numerous famous psychological studies done before the establishment of certain ethical rules, such as the Milgram experiment.&lt;br /&gt;
|&lt;br /&gt;
|-&lt;br /&gt;
!scope=row|We've incrementally improved the estimate of this coefficient&lt;br /&gt;
|Often scientific research, e.g. in cosmology or physics, will work with an assumed constant value that is known to be only an 'educated guess' of the actual definite value, or an inclusive range. However accurate/certain this is, further experimentation or observation may further narrow down the uncertainty involved to a statistically significant degree.&lt;br /&gt;
|rowspan=&amp;quot;3&amp;quot;|(Only referenced in Title Text)&lt;br /&gt;
|-&lt;br /&gt;
!scope=row|Maybe all these categories are wrong&lt;br /&gt;
|In some field that relies heavily upon classification (e.g. phylogenetic biology, or the Standard Model in physics) sometimes observations arise that cast doubt on the previously established ideas. It seems that this may have happened here, hopefully with a suggestion of how to reimagine the situation.&lt;br /&gt;
|-&lt;br /&gt;
!scope=row|We found a way to make student volunters worse at tasks&lt;br /&gt;
|Possibly a psychology experiment, and maybe not even the result expected. In general, the repetition of an activity will induce greater skill/capacity in a tested individual. By accident or design, the study group in this instance has induced the opposite correlation. (There ''are'', however, some studies that explicitly look at how e.g. lack of sleep reduces productivity.)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
===Trivia===&lt;br /&gt;
Originally, this comic's title text misspelt &amp;quot;volunteers&amp;quot; as &amp;quot;volunters&amp;quot;. This could have been intentional (''we'' might be the volunteers), but probably not as it was quickly corrected.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
Types of Scientific Paper &lt;br /&gt;
&lt;br /&gt;
''An array of scientific papers is shown, with only their titles legible. Titles are as follows:''&lt;br /&gt;
&lt;br /&gt;
We put a camera somewhere new&lt;br /&gt;
&lt;br /&gt;
Hey, I found a trove of old records! They don't turn out to be particularly useful, but still, cool!&lt;br /&gt;
&lt;br /&gt;
My colleague is wrong and I can finally prove it&lt;br /&gt;
&lt;br /&gt;
The immune system is at it again&lt;br /&gt;
&lt;br /&gt;
We figured out how to make this exotic material, so email us if you need some&lt;br /&gt;
&lt;br /&gt;
What are fish even doing down there&lt;br /&gt;
&lt;br /&gt;
This task I had to do anyway turned out to be hard enough for its own paper&lt;br /&gt;
&lt;br /&gt;
Hey, at least we showed that this method can produce results! That's not nothing, right?&lt;br /&gt;
&lt;br /&gt;
Check out this weird thing one of us saw while out for a walk&lt;br /&gt;
&lt;br /&gt;
We are 500 scientists and here's what we've been up to for the last 10 years&lt;br /&gt;
&lt;br /&gt;
Some thoughts on how everyone else is bad at research&lt;br /&gt;
&lt;br /&gt;
We scanned some undergraduates&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2421:_Tower_of_Babel&amp;diff=205905</id>
		<title>2421: Tower of Babel</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2421:_Tower_of_Babel&amp;diff=205905"/>
				<updated>2021-02-06T07:43:32Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2421&lt;br /&gt;
| date      = February 5, 2021&lt;br /&gt;
| title     = Tower of Babel&lt;br /&gt;
| image     = tower_of_babel.png&lt;br /&gt;
| titletext = Soon, linguists will be wandering around everywhere, saying things like &amp;quot;colorless green ideas sleep furiously&amp;quot; and &amp;quot;more people have been to Russia than I have,&amp;quot; and speech will become unintelligible.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a COLORLESS GREEN IDEA. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
The story of the {{w|Tower of Babel}} is the Biblical explanation for the existence of different languages in the world. In the story, humans endeavor to build a tower reaching heaven. Their arrogance angers God and prompts him to sabotage the project. He does this by &amp;quot;confounding their speech&amp;quot; (commonly interpreted as giving everyone their own language), inhibiting their ability to work together.&lt;br /&gt;
&lt;br /&gt;
In this retelling, however, the tower is actually finished. God is happy to receive the human visitors, and offers them a reward.&lt;br /&gt;
&lt;br /&gt;
The party that ascends to the top of the tower consists of Cueball, Megan and a third figure most likely representing linguist {{w|Gretchen McCulloch}}, previously seen in [[2381: The True Name of the Bear]]. When Gretchen expresses her love of words, God offers to create a panoply of languages. Megan immediately sees the problems with this, but Gretchen is enthusiastic. Instead of a punishment by God, linguistic diversity is presented as a well-intended challenge.&lt;br /&gt;
&lt;br /&gt;
{{w|Phonology}}, a part of linguistics, is the study of the sound system used in a language or dialect, or of the systems that languages use to organize sounds. {{w|b:Conlang/Advanced/Grammar/Alignment|Morphosyntactic alignment}} is the grammatical relationship between the noun arguments to a verb &amp;amp;mdash; for example, between the two arguments (in English, the subject and object) of transitive verbs like ''the dog chased the cat'', and the single argument of intransitive verbs like ''the cat ran away''.&lt;br /&gt;
&lt;br /&gt;
The title text presents two meaningless English-language phrases that illustrate the language's ability to convey confusing or paradoxical information. &amp;quot;{{w|Colorless green ideas sleep furiously}}&amp;quot;, coined by linguist {{w|Noam Chomsky}} in 1957, is an example of a sentence that is structurally correct but contains paradoxes and meaningless comparisons: something cannot be both colorless AND green (see {{w|Invisible Pink Unicorn}}), ideas do not sleep, and sleeping is not generally done furiously. That said, the sentence &amp;quot;colorless green ideas sleep furiously&amp;quot; is so well known in linguistics that a competition to make the sentence meaningful was held in 1985 and {{w|Colorless_green_ideas_sleep_furiously#Attempts_at_meaningful_interpretations|attracted a number of entrants}}.&lt;br /&gt;
&lt;br /&gt;
&amp;quot;More people have been to Russia than I have&amp;quot; is a well-known example of {{w|comparative illusion}}. It sounds like it means something but, upon actual analysis, does not, although it could be interpreted as there being more people to visit Russia than the speaker owns, or has in their household.&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
In [[2381: The True Name of the Bear]], sentences spoken by Gretchen McCulloch do not have periods at their ends, a fact which she mentioned on Twitter. However, in this comic, she uses periods, so her previous periodlessness might be a coincidence and not a trait of her character on xkcd.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
[Cueball, Gretchen McCulloch and Megan are standing at the base of the Tower of Babel.] &lt;br /&gt;
:Cueball: The Tower of Babel is complete!&lt;br /&gt;
:Megan: Let's go meet God!&lt;br /&gt;
&lt;br /&gt;
[Cueball, Gretchen McCulloch and Megan are now standing at the top of the Tower of Babel. God is represented by an off-panel voice coming from the top of the panel.]&lt;br /&gt;
:Cueball: Hi God!&lt;br /&gt;
:God: Wow, nice tower!&lt;br /&gt;
:God: You did a great job! I'm so proud!&lt;br /&gt;
:Megan: Thanks!&lt;br /&gt;
&lt;br /&gt;
:God: I'm going to give you a reward.&lt;br /&gt;
:God: What do you like about the world?&lt;br /&gt;
:Gretchen McCulloch:  Hmm. Words are really cool.&lt;br /&gt;
:Megan:  No, wait-&lt;br /&gt;
&lt;br /&gt;
:God:  Great! I'm going to give you lots of languages to study, each with its own phonology, word ordering, morphosyntactic alignment...&lt;br /&gt;
:Gretchen McCulloch: YESSSSSS!&lt;br /&gt;
:Megan:  We should not have brought a linguist.&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring real people]]&lt;br /&gt;
[[Category:Language]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2409:_Steepen_the_Curve&amp;diff=204323</id>
		<title>2409: Steepen the Curve</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2409:_Steepen_the_Curve&amp;diff=204323"/>
				<updated>2021-01-09T06:25:46Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2409&lt;br /&gt;
| date      = January 8, 2021&lt;br /&gt;
| title     = Steepen the Curve&lt;br /&gt;
| image     = steepen_the_curve.png&lt;br /&gt;
| titletext = 1. Flatten the curve. 2. Steepen the curve. 3. Hang out.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a STEEPENED FLATTENED CURVE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
In early 2020, the COVID-19 pandemic rapidly became the main public concern. All kinds of political, civic and personal efforts were put towards doing things that would cause the 'curve' (the graph of cumulative deaths, or deaths per period) to flatten and not rise as rapidly as it was feared it would do, unchecked. The graphic drawn in black depicts this statistic — though it is not clear (without proper units or values on either axis) if this is a cumulative one or the initial 'rate' graph for before initial lockdowns started to reduce the initial trajectory for a time.&lt;br /&gt;
&lt;br /&gt;
In 2021, the same issues exist (with second or even third 'waves' of resurgence affecting some populations) but now we have a handful of vaccines available. The red overlay intends to update the 'original' graphic to portray the curve of vaccines provided (again, it could easily be either cumulative or rate-wise). This year, the line remains the same but the year, the thing labelled as being represented and the hoped-for outcome are changed accordingly.&lt;br /&gt;
&lt;br /&gt;
Note that, in both cases, there would be an upper limit on the cumulative value, but the ceiling must be well beyond the upper (and timewise) limits of this graph. If this is a rate-graph, it would show a peak and subsequent decline at the same point in time where a cumulative graph would show an inflection in its gradient, but neither are visible here.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
:[Line graph shown with a curve.]&lt;br /&gt;
:[Y-Axis: COVID &amp;lt;s&amp;gt;Deaths&amp;lt;/s&amp;gt; &amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;Vaccinations&amp;lt;/span&amp;gt;&lt;br /&gt;
:[Caption above the graph:]&lt;br /&gt;
:&amp;lt;u&amp;gt;202&amp;lt;s&amp;gt;0&amp;lt;/s&amp;gt;&amp;lt;/u&amp;gt; &amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;1&amp;lt;/span&amp;gt;&lt;br /&gt;
:[Caption below the graph:]&lt;br /&gt;
:&amp;lt;s&amp;gt;Flatten&amp;lt;/s&amp;gt; &amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;Steepen&amp;lt;/span&amp;gt; The Curve&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:COVID-19]]&lt;br /&gt;
[[Category:Line graphs]]&lt;br /&gt;
[[Category:Comics with color]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2397:_I_Just_Don%27t_Trust_Them&amp;diff=203112</id>
		<title>Talk:2397: I Just Don't Trust Them</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2397:_I_Just_Don%27t_Trust_Them&amp;diff=203112"/>
				<updated>2020-12-13T07:33:01Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Is this a parody of anti-vaxxers? that's what my first thought was, but the way Cueball seems so polite about it just being his opinion makes me think otherwise. --[[Special:Contributions/162.158.255.164|162.158.255.164]] 01:19, 12 December 2020 (UTC)&lt;br /&gt;
:It is, but I could definitely see a milder-than-stereotypical &amp;quot;Karen&amp;quot; saying that—I think it'd be more clear on the politeness if Cueball had, y'know, a face. &amp;lt;span style=&amp;quot;font-family:serif&amp;quot;&amp;gt;[[User:Bubblegum|&amp;lt;span style=&amp;quot;color:#00BFFF&amp;quot;&amp;gt;bubblegum&amp;lt;/span&amp;gt;]]-[[User_talk:Bubblegum|&amp;lt;span style=&amp;quot;color:#BF7FFF&amp;quot;&amp;gt;talk&amp;lt;/span&amp;gt;]]|[[Special:Contributions/Bubblegum|&amp;lt;span style=&amp;quot;color:#FF7FFF&amp;quot;&amp;gt;contribs&amp;lt;/span&amp;gt;]]&amp;lt;/span&amp;gt; &amp;lt;span style=&amp;quot;font-family:serif&amp;quot;&amp;gt;06:33, 12 December 2020 (UTC)&amp;lt;/span&amp;gt;&lt;br /&gt;
::I say it in only two words:  YOU FIRST[[User:Seebert|Seebert]] ([[User talk:Seebert|talk]]) 18:37, 12 December 2020 (UTC)&lt;br /&gt;
:::William Shakespeare was the second person to be given the vaccine, is that good enough for you? [[Special:Contributions/162.158.159.100|162.158.159.100]] 03:47, 13 December 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
There's obviously also some reference about the fantastical idea of 'microchip' injections, which the more Conspiracy Theorising anti-vaxxer will try to suggest. Right now there's nothing in the Explanation about that, but it agrees with the particular fervency of the statement made (before the bait-n-switch, at least). But what currently ''is'' said is &amp;quot;Bats, which are unhygeinic (sic) disease-carrying animals rather than rational humans.&amp;quot; I'd like to add a real (non-injoke) [Citation Needed] to that 'unhygienic' bit. They do a lot of personal (and social) grooming, and its not lack of hygiene that means they can't handle viral transmission (probably the opposite).  Maybe reword it as more obviously tongue-in-cheek, if that was the intention?. [[Special:Contributions/162.158.159.30|162.158.159.30]] 02:59, 12 December 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
There actually _are_ some web pages that would work as a &amp;quot;citation&amp;quot; for lethal things that are &amp;quot;natural&amp;quot;, for example, I started one (at &amp;lt;http://map.map-ne.com/Rants/natural.html&amp;gt; for reference) but I'm not really maintaining it, because in researching the info I kept running across other sites that had already done it (and I link to the relevant TVtropes page). [[User:MAP|MAP]] ([[User talk:MAP|talk]]) 06:16, 12 December 2020 (UTC)&lt;br /&gt;
:Were you trying for Markdown-style italics? Those are &amp;amp;apos;&amp;amp;apos;…&amp;amp;apos;&amp;amp;apos; ''double apostrophes (not quotation marks)'' or &amp;amp;lt;i&amp;amp;gt;…&amp;amp;lt;/i&amp;amp;gt; &amp;lt;i&amp;gt;HTML &amp;amp;lt;i&amp;amp;gt; tags&amp;lt;/i&amp;gt;.&amp;lt;span style=&amp;quot;font-family:serif&amp;quot;&amp;gt;[[User:Bubblegum|&amp;lt;span style=&amp;quot;color:#00BFFF&amp;quot;&amp;gt;bubblegum&amp;lt;/span&amp;gt;]]-[[User_talk:Bubblegum|&amp;lt;span style=&amp;quot;color:#BF7FFF&amp;quot;&amp;gt;talk&amp;lt;/span&amp;gt;]]|[[Special:Contributions/Bubblegum|&amp;lt;span style=&amp;quot;color:#FF7FFF&amp;quot;&amp;gt;contribs&amp;lt;/span&amp;gt;]]&amp;lt;/span&amp;gt; &amp;lt;span style=&amp;quot;font-family:serif&amp;quot;&amp;gt;06:33, 12 December 2020 (UTC)&amp;lt;/span&amp;gt;&lt;br /&gt;
::Well, I was habitually typing that because when _I_ started on the net (1974, long before it was the &amp;quot;Internet&amp;quot;) that was the way you emphasized things. [[User:MAP|MAP]] ([[User talk:MAP|talk]]) 15:34, 12 December 2020 (UTC)&lt;br /&gt;
:::Well, Kahn and Cerf coined the term ''in'' 1974, though it wasn't regularly called that for a while, probably had to wait for TCP/IP (easier than X.25, IMO). But, yeah, the good old days where text ''was'' text (and email wasn't bulked out with MIME sections) when you could make things _underlined_, /italics/ or in *bold* ''in the reader's mind'' and everyone was happy about this! I couldn't even spot the 'markup' you hadn't used in the above, because I think I read it as intended. ;) And nice to meet someone maybe a little more senior than me. I believe the young 'uns would say something about kudos. (Well, maybe 20 years ago they would. Not sure what the rad lingo is these days, daddyo!) [[Special:Contributions/162.158.159.100|162.158.159.100]] 03:47, 13 December 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
&amp;quot;While it is usually true that what is &amp;quot;natural&amp;quot; is also &amp;quot;healthy&amp;quot;, this is not the case anymore in many modern scenarios that have become more commonplace. Of course, far far more modern things are lethal, than natural things are.&amp;quot; Oh, come on. Most plants are poisonous, wood fire is very bad for your lungs. Also, what exactly does 'natural' mean. Is it natural or not that some people die from viral disease?&lt;br /&gt;
:I refer you to the George Carlin quote from my page.  Everything in existence is, in fact, &amp;quot;natural&amp;quot;! [[User:MAP|MAP]] ([[User talk:MAP|talk]]) 15:34, 12 December 2020 (UTC)&lt;br /&gt;
:::If everything(..)is natural, it proves my point that the word 'natural' is useless. (If every color were green, we would not need the word color.)&lt;br /&gt;
::Natural is definitely wide term. All {{w|Baryon#Baryonic_matter|baryonic matter}} is natural. Most {{w|black hole}}s are natural. {{w|Neutrino}}s are natural. If you really happen to have something unnatural, give it to scientist - it can enhance our understanding of universe by centuries. Also, I believe you need some unnatural (also called {{w|exotic matter|exotic}}) matter to create wormholes. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 03:22, 13 December 2020 (UTC)&lt;br /&gt;
::The 'best' thing I've heard from that side is someone promoting Natural Products (sic) because &amp;quot;Natural products don't have side-effects&amp;quot;. I really wanted to say that the only things that have no side-effects are the ones with absolutely no effects at all... (In light of Hkmaly's comment... Dark matter?) [[Special:Contributions/162.158.159.100|162.158.159.100]] 03:47, 13 December 2020 (UTC)&lt;br /&gt;
::All raw material may be natural, but what's artificial is the way it's organized. There's plenty of silicon laying around in sand on beaches, but it takes humans to rearrange it into microchips. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 06:07, 13 December 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
I believe aluminum salts, formaldehyde, mercury, and nanoparticles all are or were used in vaccines, and are toxic in higher amount. The idea is that the amount present in vaccine is small enough to be safe. Also, at least mercury is being phased out. Generally, vaccines are not supposed to be completely safe - they are supposed to be safer than the illness they are against. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 03:22, 13 December 2020 (UTC)&lt;br /&gt;
:They need to be a ''little'' unsafe (traditional types with adjuvants, that is) to better prime the body against the thing they're trying to show it. But it shouldn't be a problem in itself because of the miniscule amounts. These days they're (wrongly) complaining about DNA being re-written, of course. And then being far more reckless 'free' from the perceived threat than they otherwise would be even by being a guinea-pig. [[Special:Contributions/162.158.159.100|162.158.159.100]] 03:47, 13 December 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
One of my YouTube addictions is watching wild bat rescue and rehabilitation channels from Australia. (Sky Puppies!) The rescuers warn about not handling bats without the proper training, inoculations, and precautions, but possible COVID-19 transmission is rarely mentioned. This might be due to the separation from Asian bat populations. [[User:These Are Not The Comments You Are Looking For|These Are Not The Comments You Are Looking For]] ([[User talk:These Are Not The Comments You Are Looking For|talk]]) 07:21, 13 December 2020 (UTC)&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2397:_I_Just_Don%27t_Trust_Them&amp;diff=203048</id>
		<title>Talk:2397: I Just Don't Trust Them</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2397:_I_Just_Don%27t_Trust_Them&amp;diff=203048"/>
				<updated>2020-12-12T06:46:45Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: natural?&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Is this a parody of anti-vaxxers? that's what my first thought was, but the way Cueball seems so polite about it just being his opinion makes me think otherwise. --[[Special:Contributions/162.158.255.164|162.158.255.164]] 01:19, 12 December 2020 (UTC)&lt;br /&gt;
:It is, but I could definitely see a milder-than-stereotypical &amp;quot;Karen&amp;quot; saying that—I think it'd be more clear on the politeness if Cueball had, y'know, a face. &amp;lt;span style=&amp;quot;font-family:serif&amp;quot;&amp;gt;[[User:Bubblegum|&amp;lt;span style=&amp;quot;color:#00BFFF&amp;quot;&amp;gt;bubblegum&amp;lt;/span&amp;gt;]]-[[User_talk:Bubblegum|&amp;lt;span style=&amp;quot;color:#BF7FFF&amp;quot;&amp;gt;talk&amp;lt;/span&amp;gt;]]|[[Special:Contributions/Bubblegum|&amp;lt;span style=&amp;quot;color:#FF7FFF&amp;quot;&amp;gt;contribs&amp;lt;/span&amp;gt;]]&amp;lt;/span&amp;gt; &amp;lt;span style=&amp;quot;font-family:serif&amp;quot;&amp;gt;06:33, 12 December 2020 (UTC)&amp;lt;/span&amp;gt;&lt;br /&gt;
&lt;br /&gt;
There's obviously also some reference about the fantastical idea of 'microchip' injections, which the more Conspiracy Theorising anti-vaxxer will try to suggest. Right now there's nothing in the Explanation about that, but it agrees with the particular fervency of the statement made (before the bait-n-switch, at least). But what currently ''is'' said is &amp;quot;Bats, which are unhygeinic (sic) disease-carrying animals rather than rational humans.&amp;quot; I'd like to add a real (non-injoke) [Citation Needed] to that 'unhygienic' bit. They do a lot of personal (and social) grooming, and its not lack of hygiene that means they can't handle viral transmission (probably the opposite).  Maybe reword it as more obviously tongue-in-cheek, if that was the intention?. [[Special:Contributions/162.158.159.30|162.158.159.30]] 02:59, 12 December 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
There actually _are_ some web pages that would work as a &amp;quot;citation&amp;quot; for lethal things that are &amp;quot;natural&amp;quot;, for example, I started one (at &amp;lt;http://map.map-ne.com/Rants/natural.html&amp;gt; for reference) but I'm not really maintaining it, because in researching the info I kept running across other sites that had already done it (and I link to the relevant TVtropes page). [[User:MAP|MAP]] ([[User talk:MAP|talk]]) 06:16, 12 December 2020 (UTC)&lt;br /&gt;
:Were you trying for Markdown-style italics? Those are &amp;amp;apos;&amp;amp;apos;…&amp;amp;apos;&amp;amp;apos; ''double apostrophes (not quotation marks)'' or &amp;amp;lt;i&amp;amp;gt;…&amp;amp;lt;/i&amp;amp;gt; &amp;lt;i&amp;gt;HTML &amp;amp;lt;i&amp;amp;gt; tags&amp;lt;/i&amp;gt;.&amp;lt;span style=&amp;quot;font-family:serif&amp;quot;&amp;gt;[[User:Bubblegum|&amp;lt;span style=&amp;quot;color:#00BFFF&amp;quot;&amp;gt;bubblegum&amp;lt;/span&amp;gt;]]-[[User_talk:Bubblegum|&amp;lt;span style=&amp;quot;color:#BF7FFF&amp;quot;&amp;gt;talk&amp;lt;/span&amp;gt;]]|[[Special:Contributions/Bubblegum|&amp;lt;span style=&amp;quot;color:#FF7FFF&amp;quot;&amp;gt;contribs&amp;lt;/span&amp;gt;]]&amp;lt;/span&amp;gt; &amp;lt;span style=&amp;quot;font-family:serif&amp;quot;&amp;gt;06:33, 12 December 2020 (UTC)&amp;lt;/span&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;quot;While it is usually true that what is &amp;quot;natural&amp;quot; is also &amp;quot;healthy&amp;quot;, this is not the case anymore in many modern scenarios that have become more commonplace. Of course, far far more modern things are lethal, than natural things are.&amp;quot; Oh, come on. Most plants are poisonous, wood fire is very bad for your langs. Also, what exactly does 'natural' mean. Is it natural or not that some people die from viral disease?&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2343:_Mathematical_Symbol_Fight&amp;diff=195755</id>
		<title>2343: Mathematical Symbol Fight</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2343:_Mathematical_Symbol_Fight&amp;diff=195755"/>
				<updated>2020-08-08T12:08:07Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */ link&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2343&lt;br /&gt;
| date      = August 7, 2020&lt;br /&gt;
| title     = Mathematical Symbol Fight&lt;br /&gt;
| image     = mathematical_symbol_fight.png&lt;br /&gt;
| titletext = Oh no, a musician just burst in through the door confidently twirling a treble clef.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a SQUARE ROOT SCYTHE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
This panel imagines which {{w|List of mathematical symbols|mathematical symbols}} would be good in a fight if they were made corporeal in two (or three) dimensions. Generally, objects with longer reach and pointier ends wind up on the right (&amp;quot;more useful&amp;quot;) side of the scale, and symbols with less reach and more curves tend towards the left (&amp;quot;less useful&amp;quot;) side. &lt;br /&gt;
&lt;br /&gt;
The comic invokes [[wikipedia:surreal humour|surreal humour]] by suggesting that mathematical symbols could be handled as physical objects in the real world. Another component of the humor is the implication that it is useful to prepare to use mathematical symbols in a fight, even though mathematicians, who use mathematical symbols, usually do not conduct their debates violently {{Citation needed}} (though some stories suggest that {{w|Hippasus}} was killed by his fellow Pythagoreans for his proof that irrational numbers exist), and even if they did, they wouldn't use large reproductions of their symbols as weapons.{{Citation needed}}&lt;br /&gt;
&lt;br /&gt;
A straight line is farthest to the &amp;quot;more dangerous&amp;quot; side, which could possibly be a reference to the dangers posed by lines in &amp;quot;Flatland&amp;quot;, because their infinitely-sharp endpoints could be difficult to see (particularly their rear end, which does not contain a gleaming eye as their front end does) and would fatally pierce whoever they chose to stab. However, taking a more literal view of the drawings, the straight line does not appear to be any thicker or thinner, or pointier, than any of the other lines.  &lt;br /&gt;
&lt;br /&gt;
The title text refers to a {{w|clef}}, which is not a mathematical symbol but rather a {{w|List of musical symbols|musical symbol}}. The note of concern in the text suggests musical symbols may be viewed in such fights as exotic or especially dangerous.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
! Symbol&lt;br /&gt;
! Meaning&lt;br /&gt;
! Notes on using in a fight&lt;br /&gt;
|-&lt;br /&gt;
|ℝ&lt;br /&gt;
|The set of [[wikipedia:real number|real number]]s&lt;br /&gt;
|Megan seems to be struggling with a giant version of this symbol.&lt;br /&gt;
|-&lt;br /&gt;
|θ&lt;br /&gt;
|[[wikipedia:Theta#Mathematics_and_science|Theta]]&lt;br /&gt;
|This symbol is not very sharp, and [[White Hat]] is unable to use it in combat. It would not work as a good shield due to the hole in the symbol, but it possibly could be thrown. (The later version of Xena's chakram had a bar in the middle.)&lt;br /&gt;
|-&lt;br /&gt;
|∅&lt;br /&gt;
|[[wikipedia:Empty set|Empty set]]&lt;br /&gt;
|-&lt;br /&gt;
|∞&lt;br /&gt;
|infinity&lt;br /&gt;
|-&lt;br /&gt;
|&amp;gt;&lt;br /&gt;
|Greater than&lt;br /&gt;
|-&lt;br /&gt;
|α&lt;br /&gt;
|[[wikipedia:Alpha_(disambiguation)#Mathematics_and_statistics|Alpha]]&lt;br /&gt;
|-&lt;br /&gt;
|∪&lt;br /&gt;
|{{w|union (set theory)}}&lt;br /&gt;
|-&lt;br /&gt;
|∈&lt;br /&gt;
|{{w|Element (mathematics)|member of}} (set theory)&lt;br /&gt;
|Cueball is holding this in the manner of a Klingon &amp;quot;{{w|Bat'leth}}&amp;quot; from the ''Star Trek'' franchise. The Bat'leth is [https://youtu.be/VsElSDXPgSA infamous] among swordfighters for being rather impractical, and that the Klingon warrior race would have been better suited using swords like humans. It seems Randall agrees, as the ∈ is quite far on the left of the chart.&lt;br /&gt;
|-&lt;br /&gt;
|π&lt;br /&gt;
|[[wikipedia:Pi|pi]]&lt;br /&gt;
|-&lt;br /&gt;
|∀&lt;br /&gt;
|&amp;quot;{{w|Universal quantification|for all}}&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
|∂&lt;br /&gt;
|{{w|∂}} ([[wikipedia:Partial derivative|partial derivative]] or [[wikipedia:Boundary_(topology)|boundary operator]])&lt;br /&gt;
|-&lt;br /&gt;
| +&lt;br /&gt;
|[[wikipedia:Plus_and_minus_signs#Plus_sign|Plus]]&lt;br /&gt;
|Maybe thrown like a {{w|shuriken}}?&lt;br /&gt;
|-&lt;br /&gt;
|Ψ&lt;br /&gt;
|[[wikipedia:Psi#Mathematics|Psi]]&lt;br /&gt;
|It could be used as a slightly-less-functional trident or pitchfork, with a shorter handle. More particularly, it resembles a {{w|sai}} (which, funnily enough, is how &amp;quot;Psi&amp;quot; is pronounced).&lt;br /&gt;
|-&lt;br /&gt;
|≠&lt;br /&gt;
|not equal sign&lt;br /&gt;
|-&lt;br /&gt;
|~&lt;br /&gt;
|[[wikipedia:Tilde#Mathematics|tilde]], meaning &amp;quot;approximately&amp;quot;, equivalent, or several transforms of a function&lt;br /&gt;
|A potentially dangerous throwing weapon.&lt;br /&gt;
|-&lt;br /&gt;
|#&lt;br /&gt;
|[[wikipedia:Cardinality|Cardinality]], [[wikipedia:Connected_sum|connected sum]] (knot theory), or [[wikipedia:Primorial|primorial]].&lt;br /&gt;
|Blondie uses this symbol.&lt;br /&gt;
|-&lt;br /&gt;
|Δ&lt;br /&gt;
|[[wikipedia:Delta_(letter)|Delta]]&lt;br /&gt;
|-&lt;br /&gt;
|⇒&lt;br /&gt;
|[[wikipedia:Material_conditional|Material consequence]] or [[wikipedia:Logical_consequence|Logical consequence]], meaning &amp;quot;implies&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
|⋅&lt;br /&gt;
|multiplication sign&lt;br /&gt;
|If thrown, this could be a dangerous projectile weapon.&lt;br /&gt;
|-&lt;br /&gt;
|ζ&lt;br /&gt;
|{{w|Zeta#Mathematics_and_science|Zeta}}&lt;br /&gt;
|-&lt;br /&gt;
|ℵ&lt;br /&gt;
|[[wikipedia:Aleph_number|Aleph number]]&lt;br /&gt;
|Could be brandished or thrown in the manner of a shuriken.&lt;br /&gt;
|-&lt;br /&gt;
|Γ&lt;br /&gt;
|uppercase Greek letter {{w|Gamma#Uppercase|Gamma}}&lt;br /&gt;
|-&lt;br /&gt;
|√&lt;br /&gt;
|{{w|square root}} sign&lt;br /&gt;
|Black Hat has chosen this symbol and is using it like a polearm, something like a {{w|shepherd's crook}}.&lt;br /&gt;
|-&lt;br /&gt;
|𝜌&lt;br /&gt;
|italic {{w|Rho#Mathematics_and_science|rho}}&lt;br /&gt;
|Ponytail is brandishing this symbol against Danish, apparently using it like a club or hammer and striking with the curve.&lt;br /&gt;
|-&lt;br /&gt;
|∮&lt;br /&gt;
|{{w|contour integral}}&lt;br /&gt;
|This symbol is drawn with a very tight center, giving it an almost identical figure to the regular integral symbol. Presumably, the added bulk for marginal additional use earns it a rating of 'less effective'.&lt;br /&gt;
|-&lt;br /&gt;
|∫&lt;br /&gt;
|{{w|integral}}&lt;br /&gt;
|Could possibly be used in the manner of a shepherd's crook.&lt;br /&gt;
|-&lt;br /&gt;
|→&lt;br /&gt;
|Implies; X→Y means that if X is true, then Y is also true&lt;br /&gt;
|Danish is brandishing this symbol against Ponytail, apparently using it like a spear or other polearm.&lt;br /&gt;
|-&lt;br /&gt;
|⊥&lt;br /&gt;
|{{w|up tack}} or falsum, indicating a false proposition in logic or the bottom element in a partial order&lt;br /&gt;
|Held like an axe, the top of the T could be arced towards an opponent.  Held like a wishbone, two hands could be used to try to drive the point into an opponent. &lt;br /&gt;
|-&lt;br /&gt;
|⇀&lt;br /&gt;
|{{w|Vector notation}}&lt;br /&gt;
|A single-barbed spear.&lt;br /&gt;
|-&lt;br /&gt;
|⎯⎯&lt;br /&gt;
|{{w|Fraction#Vocabulary|Fraction bar}} (division) or {{w|Overline#Math_and_science|overline}} (complex conjugate or mean).&lt;br /&gt;
|Hairy is brandishing this symbol against Black Hat. The single shaft would allow it to be used in the manner of a {{w|quarterstaff}}, {{w|bō}}, or other {{w|stick-fighting}} weapon&lt;br /&gt;
|-&lt;br /&gt;
|𝄞&lt;br /&gt;
|{{w|Treble clef}}&lt;br /&gt;
|Mentioned in the title text; this is not a mathematical symbol, but a musical symbol. The treble clef is a much more complicated symbol than those used in mathematics, hence the musician's &amp;quot;confidence&amp;quot; in his weapon. The curve at the bottom could be used as a hook, the upper curl could be used as a blunt weapon, and the tight curl of the center would serve as a better defensive shield than theta.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
[Heading]&lt;br /&gt;
&lt;br /&gt;
Mathematical Symbols&lt;br /&gt;
&lt;br /&gt;
[Subheading]&lt;br /&gt;
&lt;br /&gt;
by how useful they would be in a fight&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
more useful&lt;br /&gt;
&lt;br /&gt;
⟶&lt;br /&gt;
&lt;br /&gt;
 ℝ   ∅ &amp;gt; α π + Ψ ~ ⇒ ⋅ Γ √ ∮ ∫ ⇀&lt;br /&gt;
   θ ∞ ∪ ∈ ∀ ∂ ≠ # Δ ζ ℵ 𝜌 → ⊥ ⎯&lt;br /&gt;
&lt;br /&gt;
[Below the (number?) line, eight characters fight each other, using some of the symbols mentioned above as weapons.]&lt;br /&gt;
&lt;br /&gt;
[The characters hold more &amp;quot;useful&amp;quot; weapons from left to right, correlating with the chart.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[Megan is awkwardly handling a giant &amp;quot;ℝ&amp;quot;.]&lt;br /&gt;
&lt;br /&gt;
[White Hat is holding a &amp;quot;θ&amp;quot; with both hands, as a shield.]&lt;br /&gt;
&lt;br /&gt;
[Cueball is holding an &amp;quot;∈&amp;quot; in both hands, with its &amp;quot;tines&amp;quot; pointed towards Blondie, who is swatting at him with a &amp;quot;#&amp;quot;.]&lt;br /&gt;
&lt;br /&gt;
[Ponytail is leaping at Danish, swinging a &amp;quot;ρ&amp;quot; like an axe, while Danish is leaning back and thrusting a &amp;quot;→&amp;quot; back at her.]&lt;br /&gt;
&lt;br /&gt;
[Black Hat is swinging a long &amp;quot;√&amp;quot; like a polearm at Hairy, who is holding a long &amp;quot;⎯&amp;quot; defensively.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
-&lt;br /&gt;
List of symbols from left to right (by rightmost edge): &lt;br /&gt;
 &lt;br /&gt;
ℝ θ ∅ ∞  &amp;gt; ∪ α ∈ ∀ π ∂ + ≠ Ψ # ~ △ ζ ⇒ ⋅ ℵ Γ 𝜌 √ → ∮ ∫ ⊥  ⇀ ⎯&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Note: Where two symbols had similar right-most edges, the overlay grid on an ASUS pro-art display was used to decide which one went further right. &lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Math]]&lt;br /&gt;
[[Category:Music]]&lt;br /&gt;
[[Category:Charts]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Comics featuring Danish]]&lt;br /&gt;
[[Category:Comics featuring White Hat]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Blondie]]&lt;br /&gt;
[[Category:Comics featuring Ponytail]]&lt;br /&gt;
[[Category:Comics featuring Black Hat]]&lt;br /&gt;
[[Category:Comics featuring Hairy]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2319:_Large_Number_Formats&amp;diff=193704</id>
		<title>2319: Large Number Formats</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2319:_Large_Number_Formats&amp;diff=193704"/>
				<updated>2020-06-21T14:09:58Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: Undo revision 193595 by Jameslucas (talk)&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2319&lt;br /&gt;
| date      = June 12, 2020&lt;br /&gt;
| title     = Large Number Formats&lt;br /&gt;
| image     = large number formats-2.png&lt;br /&gt;
| titletext = 10^13.4024: A person who has come back to numbers after a journey deep into some random theoretical field&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic shows what the way you write large numbers says about you. Different people use different methods to express large numbers. And this comic claims it can tell something about you based on the way you format large numbers. In this way, the comic is similar in idea to [[977: Map Projections]], where it was your choice of map projections that could tell something about you.&lt;br /&gt;
&lt;br /&gt;
See the [[#Table of types|table]] below for each of the 10 different ways to express large numbers, plus the 11th mentioned in the title text.&lt;br /&gt;
&lt;br /&gt;
The number used as an example is the [https://www.wolframalpha.com/input/?i=Distance+to+Jupiter+in+inches approximate distance] from the planet {{w|Earth}} to the planet {{w|Jupiter}} as of the release day of the comic on June 12th 2020, in {{w|inch|inches}} (1 inch = 2.54 cm).&lt;br /&gt;
&lt;br /&gt;
Two days after the release of the comic the following text could be found on [https://theskylive.com/jupiter-info Jupiter info] on [https://theskylive.com/ The Sky Live].&lt;br /&gt;
:The distance of Jupiter from Earth is currently 640,084,108 kilometers, equivalent to 4.278698 Astronomical Units. Light takes 35 minutes and 35.0908 seconds to travel from Jupiter and arrive on Earth.&lt;br /&gt;
&lt;br /&gt;
64,008,410,800,000 cm / 2.54 inches/cm = 25,200,161,732,283 inches - much less than the number used in the comic. But Jupiter's distance to Earth changes quite quickly, and was decreasing at the time of the release of the comic. &lt;br /&gt;
&lt;br /&gt;
According to a graph of the distance as a function of time on The Sky Live, the distance on the release day was 643,1 million km. This will give 25,3&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt; which the used number will round to. &lt;br /&gt;
&lt;br /&gt;
The used number 25,259,974,097,204 is equivalent to 641,6 million km. On June 13th the distance is given as 641,7 million km in the graph on The Sky Live, very close to the number used. As this was the day after the release of this comic, it seems like [[Randall]] used a different distance than the exact one for the release day. He may have also used an average for June which would be 642 million km based on the average of the distance on June and July 1st.&lt;br /&gt;
&lt;br /&gt;
==Table of types==&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Number&lt;br /&gt;
! Type of person&lt;br /&gt;
! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 25,259,974,097,204&lt;br /&gt;
| Normal Person&lt;br /&gt;
| This is the full number, 25259974097204, written out in the normal fashion, with commas to indicate powers of 1000. Although writing out the number in full is indeed a common action for normal people, the specific comma convention depicted here is only considered normal in the Anglo-Saxon world; conventions for writing large numbers in full vary considerably across cultures. For example, in countries where the period is used as a {{w|decimal separator}} (including Europe outside the UK), one would write the number as 25.259.974.097.204 (or 25'259'974'097'204 in Switzerland, or 25 259 974 097 204 in Poland, France and Estonia). Under the {{w|Indian numbering system}}, this number would be written as 25,25,997,40,97,204. &lt;br /&gt;
|-&lt;br /&gt;
| 25 Trillion&lt;br /&gt;
| Normal Person&lt;br /&gt;
| This is the number, rounded to trillions in the normal fashion.&lt;br /&gt;
|-&lt;br /&gt;
| 25 Billion&lt;br /&gt;
| Old British Person&lt;br /&gt;
| In current English usage, across the Anglophonic world with some hold-outs, an n-illion means 10^(3n+3) as per the {{w|short scale}} system popularised by American influence in international trade, so a trillion means 10^12, as above. However, older British English use had an n-illion meaning 10^(6n) (i.e. the simpler calculation of ''million^n''), so a billion meant 10^12. The change stems from a 1974 commitment by Harold Wilson, the Prime Minister of the UK at the time, to change from the {{w|long scale}} (previously often described as the British system) to the short one for all official purposes.&lt;br /&gt;
&lt;br /&gt;
Though not instantly widely adopted for common usage, the mid-'70s could therefore be considered the key turning point between when an older or younger British person learns (as the change filters through the system at various stages of education) what their &amp;quot;Billion&amp;quot;s and &amp;quot;Trillion&amp;quot;s are supposed to represent.&lt;br /&gt;
&lt;br /&gt;
As well as 'traditionalist' British use, the long scale is widely used in the non-Anglophone world, in local language versions, though while the British system tended to infill n-and-a-half powers of the million with the term &amp;quot;thousand n-illion&amp;quot;, the suffix &amp;quot;-illi''ard''&amp;quot;, or equivalent, is often used for the thousands multiple directly atop the respective &amp;quot;-illion&amp;quot; point.&lt;br /&gt;
|-&lt;br /&gt;
|2.526x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&lt;br /&gt;
|Scientist&lt;br /&gt;
|This number is formatted in {{w|scientific notation}}, using the exponent 10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;.&lt;br /&gt;
|-&lt;br /&gt;
| 2.525997x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&lt;br /&gt;
| Scientist trying to avoid rounding up&lt;br /&gt;
| Using as many decimal places as necessary until hitting a digit (0-4) that results in rounding down, even if it goes against the common scientific practice of reporting the correct amount of &amp;quot;significant figures&amp;quot;. [[:File:large number formats.png|A previous version of the comic]] had a typo (the number was ''2.5997x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;''), but Randall updated the comic.&lt;br /&gt;
|-&lt;br /&gt;
| 2.526e13 or&lt;br /&gt;
2.526*10^13&lt;br /&gt;
| Software developer &lt;br /&gt;
| The first example is how the number would be expressed as a floating point number in scientific notation in [https://rosettacode.org/wiki/Literals/Floating_point most common programming languages]. The second example is a technically correct way of expressing the same thing in some programming languages in which exponentiation is indicated by the ^ operator. However writing it that way instead of the first way could be considered quirky, as it is written as an instruction to the computer to calculate the product of a number with 10 raised to power 13, instead of just writing the number (although in many situations  the compiler or preprocessor would detect this and solve it correctly, making it functionally identical to the first case). A software developer might write it that way if they are a novice who is not familiar with the first notation, or they could simply have an personal preference that considers the second version easier to read. Perhaps an additional joke for the second version is that it is the standard scientific notation with the x for multiplication and superscript for raising to a power replaced with the notation used in many programming languages of * and ^, i.e., a software developer writing down a number in scientific notation, not necessarily while writing a program, would by habit write a * for multiplication and a ^ for exponentiation. &lt;br /&gt;
|-&lt;br /&gt;
| 25,259,973,541,888&lt;br /&gt;
| Software developer who forgot about floats&lt;br /&gt;
| The two most common computer {{w|Floating-point arithmetic|floating-point}} formats are the IEEE 754 {{w|Single-precision floating-point format|single-precision}} and {{w|Double-precision floating-point format|double-precision}} representations.  These are ''binary'' floating-point formats, representing numbers as the quantity ''a'' &amp;amp;times; 2&amp;lt;sup&amp;gt;''e''&amp;lt;/sup&amp;gt;, for some fractional number ''a'' and exponent ''e''.  Both the values ''a'' and ''e'' have a fixed size in bits, and therefore a finite range.  In single-precision, ''a'' and ''e'' have (effectively) 24 and 8 bits, respectively, while in double precision the effective sizes are 53 and 11 bits.&lt;br /&gt;
&lt;br /&gt;
Fully representing the number 25,259,974,097,204 (in any format) requires at least 45 bits.  Therefore this number cannot be represented exactly as a single-precision float.  The closest possible representations are 0.717931628 &amp;amp;times; 2&amp;lt;sup&amp;gt;45&amp;lt;/sup&amp;gt; and 0.717931688 &amp;amp;times; 2&amp;lt;sup&amp;gt;45&amp;lt;/sup&amp;gt;; these work out to 25,259,973,541,888 and 25,259,975,639,040, respectively.  Of these, the one ending in 888 is considerably closer to the original, so is chosen due to {{w|rounding}}.  (Naturally these numbers are represented internally in binary, not decimal; the actual representations, in {{w|hexadecimal}}, are &amp;lt;tt&amp;gt;0.b7ca5e&amp;lt;/tt&amp;gt; &amp;amp;times; 2&amp;lt;sup&amp;gt;&amp;lt;tt&amp;gt;&amp;lt;/tt&amp;gt;2d&amp;lt;/sup&amp;gt; and &amp;lt;tt&amp;gt;0.b7ca5f&amp;lt;/tt&amp;gt; &amp;amp;times; 2&amp;lt;sup&amp;gt;&amp;lt;tt&amp;gt;&amp;lt;/tt&amp;gt;2d&amp;lt;/sup&amp;gt;.)&lt;br /&gt;
&lt;br /&gt;
In many programming languages, the keyword to request a single-precision floating-point variable is &amp;lt;tt&amp;gt;float&amp;lt;/tt&amp;gt;, while the keyword to request double-precision is &amp;lt;tt&amp;gt;double&amp;lt;/tt&amp;gt;.  It is an easy mistake to make to forget about the limited precision available with type &amp;lt;tt&amp;gt;float&amp;lt;/tt&amp;gt;, especially since its name sounds like what you want for &amp;quot;floating point&amp;quot;.  (Had the programmer remembered to use type &amp;lt;tt&amp;gt;double&amp;lt;/tt&amp;gt;, the number 25,259,974,097,204 could have been represented exactly (still in hexadecimal), as &amp;lt;tt&amp;gt;0.b7ca5e43c9a000&amp;lt;/tt&amp;gt; &amp;amp;times; 2&amp;lt;sup&amp;gt;&amp;lt;tt&amp;gt;&amp;lt;/tt&amp;gt;2d&amp;lt;/sup&amp;gt;.)&lt;br /&gt;
|-&lt;br /&gt;
| 10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&lt;br /&gt;
| Astronomer&lt;br /&gt;
| For extremely large distances, astronomers typically only care about orders of magnitude, e.g. whether a number is 10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;, as opposed to 10&amp;lt;sup&amp;gt;12&amp;lt;/sup&amp;gt; or 10&amp;lt;sup&amp;gt;14&amp;lt;/sup&amp;gt;. Randall often jokes about the lack of precision needed by astronomers, such as in [[2205: Types of Approximation]] where the astronomer-cosmologist is equally willing to make pi equal to one, or ten. The original number is rounded to the nearest power of ten.&lt;br /&gt;
|-&lt;br /&gt;
| {∅,{∅},{∅,{∅}},{∅,{∅},{...&lt;br /&gt;
| Set theorist&lt;br /&gt;
| The natural numbers can be constructed in a {{w|set theory}} in various ways. In the most common of these, the {{w|Natural_number#Von_Neumann_ordinals|Von Neumann ordinals}}, the natural numbers are defined recursively by letting 0 = ∅ (the {{w|empty set}}), and ''n'' + 1 = ''n'' ∪ {''n''}. So, every natural number ''n'' is the set of all natural numbers less than ''n'', and since 0 is defined as the empty set, all numbers are nested sets of empty sets. Note that writing out a number in this form requires an exponential number of characters - that is, ''n'' + 1 requires over twice the characters as ''n'' does to write out. Thus, this method could not be finished, as it would require more data to be stored than there is matter in the universe to store it.&lt;br /&gt;
|-&lt;br /&gt;
| 1,262,998,704,860 score and four&lt;br /&gt;
| Abraham Lincoln&lt;br /&gt;
| In the {{W|Gettysburg Address}}, Lincoln speaks the number &amp;quot;87&amp;quot; as &amp;quot;four score and seven&amp;quot; (&amp;quot;score&amp;quot; meaning &amp;quot;20&amp;quot;). Base-20 or {{w|vigesimal}} numeral systems are or have been used in pre-Columbian-American, African and many other cultures. In French it is used only for higher numbers (e.g. 92 = quatre-vingt-douze). In English it can appear in certain archaic and classic contexts, such as the King James translation of the Bible (&amp;quot;threescore years and ten&amp;quot;  to be the life expectancy of a human according to Psalm 90:10).  In these cases, a number is written in &amp;quot;score&amp;quot; (multiples of 20) plus a remainder. In this case 1,262,998,704,860 * 20 + 4 yields the exact number.&lt;br /&gt;
|-&lt;br /&gt;
| 10^13.4024 ''(title text)''&lt;br /&gt;
| A person who has come back to numbers after a journey deep into some random theoretical field&lt;br /&gt;
| In some fields of mathematics, especially those dealing with very {{w|large numbers}}, numbers are sometimes represented by raising ten (or some other convenient base) to an oddly precise power, to facilitate comparison of their magnitudes without filling up pages upon pages of digits.  An example of this is {{w|Skewes's number}}, which is formally calculated to be ''e''&amp;lt;sup&amp;gt;''e''&amp;lt;sup&amp;gt;''e''&amp;lt;sup&amp;gt;79&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;, but is more commonly approximated as 10&amp;lt;sup&amp;gt;10&amp;lt;sup&amp;gt;10&amp;lt;sup&amp;gt;34&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;. 13.4024 is a rounded version of the {{w|common logarithm}} of 25,259,974,097,204 (log&amp;lt;sub&amp;gt;10&amp;lt;/sub&amp;gt; 25,259,974,097,204 = 13.4024329009); thus, this &amp;quot;format&amp;quot; is still mathematically correct, but uncommon. However, only by using many more digits will the result get close enough to be rounded to the original number 10^13.40243290087302 = 25,259,974,097,203.5, which would round up to the correct number. This number 10^13.4024 = 25,258,060,548,319.6 deviating almost 2 billion from the correct number&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[A panel only with text. At the top there is four lines of explanatory text. Below that are 2 columns with 5 rows of number formats. Each numerical format is in red, with black text explaining the format below it.]&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;big&amp;gt;What the way you write large numbers says about you&amp;lt;/big&amp;gt;&lt;br /&gt;
:(Using the approximate current distance to Jupiter in inches as an example)&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:#ba0000&amp;quot;&amp;gt;25,259,974,097,204&amp;lt;/span&amp;gt;&lt;br /&gt;
:Normal person&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:#ba0000&amp;quot;&amp;gt;25 trillion&amp;lt;/span&amp;gt;&lt;br /&gt;
:Normal person&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:#ba0000&amp;quot;&amp;gt;25 billion&amp;lt;/span&amp;gt;&lt;br /&gt;
:Old British person&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:#ba0000&amp;quot;&amp;gt;2.526x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&amp;lt;/span&amp;gt;&lt;br /&gt;
:Scientist&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:#ba0000&amp;quot;&amp;gt;2.525997x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&amp;lt;/span&amp;gt;&lt;br /&gt;
:Scientist trying to avoid rounding up&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:#ba0000&amp;quot;&amp;gt;2.526e13 or 2.526*10^13&amp;lt;/span&amp;gt;&lt;br /&gt;
:Software developer&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:#ba0000&amp;quot;&amp;gt;25,259,973,541,888&amp;lt;/span&amp;gt;&lt;br /&gt;
:Software developer who forgot about floats&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:#ba0000&amp;quot;&amp;gt;10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&amp;lt;/span&amp;gt;&lt;br /&gt;
:Astronomer&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:#ba0000&amp;quot;&amp;gt;{∅,{∅},{∅,{∅}},{∅,{∅},{...&amp;lt;/span&amp;gt;&lt;br /&gt;
:Set theorist&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:#ba0000&amp;quot;&amp;gt;1,262,998,704,860 score and four&amp;lt;/span&amp;gt;&lt;br /&gt;
:Abraham Lincoln&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:Programming]]&lt;br /&gt;
[[Category:Math]]&lt;br /&gt;
[[Category:Astronomy]]&lt;br /&gt;
[[Category:Science]]&lt;br /&gt;
[[Category:Comics featuring politicians]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2319:_Large_Number_Formats&amp;diff=193411</id>
		<title>2319: Large Number Formats</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2319:_Large_Number_Formats&amp;diff=193411"/>
				<updated>2020-06-13T20:47:14Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: Base-20 numeral system does not come from French&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2319&lt;br /&gt;
| date      = June 12, 2020&lt;br /&gt;
| title     = Large Number Formats&lt;br /&gt;
| image     = large number formats-2.png&lt;br /&gt;
| titletext = 10^13.4024: A person who has come back to numbers after a journey deep into some random theoretical field&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by ABRAHAM LINCOLN. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic shows how different people express large numbers. This number in question is approximately the distance from the planet Earth to the planet Jupiter as of June 2020, in {{w|inch|inches}} (1 inch = 2.54 cm).&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Number&lt;br /&gt;
! Type of person&lt;br /&gt;
! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 25,259,974,097,204&lt;br /&gt;
| Normal Person&lt;br /&gt;
| This is the full number, written out in the normal fashion, with commas to indicate powers of 1000. Note that this convention is only considered normal in the Anglo-Saxon world; conventions for writing large numbers in full vary considerably across cultures. For example, in countries where the comma is used as a {{w|decimal separator}} (including Europe outside the UK), one would write the number as 25.259.974.097.204 (or 25'259'974'097'204 in Switzerland, or 25 259 974 097 204 in Poland, France and Estonia). Under the {{w|Indian numbering system}}, this number would be written as 25,25,997,40,97,204. &lt;br /&gt;
|-&lt;br /&gt;
| 25 Trillion&lt;br /&gt;
| Normal Person&lt;br /&gt;
| This is the number, rounded to trillions in the normal fashion.&lt;br /&gt;
|-&lt;br /&gt;
| 25 Billion&lt;br /&gt;
| Old British Person&lt;br /&gt;
| In current English usage, across the anglophonic world with some hold-outs, an n-illion means 10^(3n+3) as per the {{w|short scale}} system popularised by American influence in international trade, so a trillion means 10^12, as above. However, older British English use had an n-illion meaning 10^(6n) (i.e. the simpler calculation of ''million^n''), so a billion meant 10^12. The change stems from a 1974 commitment by Harold Wilson, the Prime Minister of the UK at the time, to change from the {{w|long scale}} (previously often described as the British system) to the short one for all official purposes.&lt;br /&gt;
&lt;br /&gt;
Though not instantly widely adopted for common usage, the mid-'70s could therefore be considered the key turning point between when an older or younger British person learns (as the change filters through the system at various stages of education) what their &amp;quot;Billion&amp;quot;s and &amp;quot;Trillion&amp;quot;s are supposed to represent.&lt;br /&gt;
&lt;br /&gt;
(The 1971 transition to decimalised currency may also date a person's experiences, but was a more comprehensive and immediate change for everyone who handled any money at all, in the UK, and thus was a more definite point of change apart from the extended survival of the &amp;quot;12 times table&amp;quot; being taught by rote in primary education, rather than ending at the 10s.)&lt;br /&gt;
&lt;br /&gt;
As well as 'traditionalist' British use, the Long Scale is widely used in the non-anglophone world, in local language versions, though while the British system tended to infill n-and-a-half powers of the million with the term &amp;quot;thousand n-illion&amp;quot;, the suffix &amp;quot;-illi''ard''&amp;quot;, or equivalent, is often used for the thousands multiple directly atop the respective &amp;quot;-illion&amp;quot; point.&lt;br /&gt;
|-&lt;br /&gt;
|2.526x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&lt;br /&gt;
|Scientist&lt;br /&gt;
|This number is formatted in {{w|scientific notation}}, using the exponent 10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;.&lt;br /&gt;
|-&lt;br /&gt;
| 2.525997x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&lt;br /&gt;
| Scientist trying to avoid rounding up&lt;br /&gt;
| Using as many decimal places as necessary until hitting a digit (0-4) that results in rounding down, even if it goes against the common scientific practice of reporting the correct amount of &amp;quot;significant figures&amp;quot;. A previous version of the comic had a typo (the number was ''2.5997x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;''), but Randall updated the comic.&lt;br /&gt;
|-&lt;br /&gt;
| 2.526e13 or&lt;br /&gt;
2.526*10^13&lt;br /&gt;
| Software developer &lt;br /&gt;
| Computer code cannot typically use the superscripts or other types of rich text formatting, so the exponent is indicated with the {{w|caret}}. &amp;quot;e13&amp;quot; is {{w|Scientific notation#E notation|(scientific) E notation}} for the expression &amp;quot;10 raised to the power of 13&amp;quot;.&lt;br /&gt;
|-&lt;br /&gt;
| 25,259,973,541,888&lt;br /&gt;
| Software developer who forgot about floats&lt;br /&gt;
| This is the number after being converted to the limited precision of a {{w|32-bit floating point|32-bit float}}.&lt;br /&gt;
|-&lt;br /&gt;
| 10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&lt;br /&gt;
| Astronomer&lt;br /&gt;
| For extremely large distances, astronomers typically only care about orders of magnitude, i.e. 10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;, not 10&amp;lt;sup&amp;gt;12&amp;lt;/sup&amp;gt; or 10&amp;lt;sup&amp;gt;14&amp;lt;/sup&amp;gt;. Randall often jokes about the lack of precision needed by astronomers, such as in xkcd #[[2205]] where the astronomer-cosmologist is equally willing to make pi equal to one, or ten. The original number is rounded to the nearest power of ten.&lt;br /&gt;
|-&lt;br /&gt;
| {∅,{∅},{∅,{∅}},{∅,{∅},{...&lt;br /&gt;
| Set theorist&lt;br /&gt;
| In {{w|Zermelo–Fraenkel set theory}}, the natural numbers are defined recursively by letting 0 = ∅ (the {{w|empty set}}), and ''n'' + 1 = ''n'' ∪ {''n''}. So, every natural number ''n'' is the set of all natural numbers less than ''n'', and since 0 is defined as the empty set, all numbers are nested sets of empty sets. Note that writing out the full number in this fashion would take more than its square in number of characters; that is to say, if each character took up one square centimeter, this &amp;quot;number&amp;quot; would not fit on a square piece of paper whose edge reached to Jupiter.&lt;br /&gt;
|-&lt;br /&gt;
| 1,262,998,704,860 score and four&lt;br /&gt;
| Abraham Lincoln&lt;br /&gt;
| In the {{W|Gettysburg Address}}, Lincoln speaks the number &amp;quot;87&amp;quot; as &amp;quot;four score and seven&amp;quot; (&amp;quot;score&amp;quot; meaning &amp;quot;20&amp;quot;). Base-20 or {{w|vigesimal}} numeral systems are or have been used in pre-Columbian-American, African and many other cultures. In French it is used only for higher numbers (e.g. 92 = quatre-vingt-douze). In English it can appear in certain archaic and classic contexts, such as the King James translation of the Bible (&amp;quot;threescore years and ten&amp;quot;  to be the life expectancy of a human according to Psalm 90:10).  In these cases, a number is written in &amp;quot;score&amp;quot; (multiples of 20) plus a remainder.  &lt;br /&gt;
|-&lt;br /&gt;
| 10^13.4024 ''(title text)''&lt;br /&gt;
| A person who has come back to numbers after a journey deep into some random theoretical field&lt;br /&gt;
| In some fields of mathematics, especially those dealing with very {{w|large numbers}}, numbers are sometimes represented by raising ten (or some other convenient base) to an oddly precise power, to facilitate comparison of their magnitudes without filling up pages upon pages of digits.  An example of this is {{w|Skewes's number}}, which is formally calculated to be ''e''&amp;lt;sup&amp;gt;''e''&amp;lt;sup&amp;gt;''e''&amp;lt;sup&amp;gt;79&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;, but is more commonly approximated as 10&amp;lt;sup&amp;gt;10&amp;lt;sup&amp;gt;10&amp;lt;sup&amp;gt;34&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;. 13.4024 is the {{w|common logarithm}} of 25,259,974,097,204 (log&amp;lt;sub&amp;gt;10&amp;lt;/sub&amp;gt; 25,259,974,097,204 = 13.4024329009); thus, this &amp;quot;format&amp;quot; is still mathematically correct, but uncommon.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
:[A panel only with text. At the top there is four lines of explanatory text. Below that there are 5 rows of number formats. There are 2 columns in each row. Each numerical format is in red, with black text explaining the format below it.]&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;big&amp;gt;What the way you write large&amp;lt;/big&amp;gt;&lt;br /&gt;
:&amp;lt;big&amp;gt;numbers says about you&amp;lt;/big&amp;gt;&lt;br /&gt;
:(Using the approximate current distance&lt;br /&gt;
:to Jupiter in inches as an example)&lt;br /&gt;
&lt;br /&gt;
:[First row:]&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;25,259,974,097,204&amp;lt;/span&amp;gt;&lt;br /&gt;
:Normal person&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;25 trillion&amp;lt;/span&amp;gt;&lt;br /&gt;
:Normal person&lt;br /&gt;
&lt;br /&gt;
:[Second row:]&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;25 billion&amp;lt;/span&amp;gt;&lt;br /&gt;
:Old British person&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;2.526x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&amp;lt;/span&amp;gt;&lt;br /&gt;
:Scientist&lt;br /&gt;
&lt;br /&gt;
:[Third row:]&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;2.525997x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&amp;lt;/span&amp;gt;&lt;br /&gt;
:Scientist trying to avoid rounding up&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;2.526e13 or&amp;lt;br&amp;gt;2.526*10^13&amp;lt;/span&amp;gt;&lt;br /&gt;
:Software developer&lt;br /&gt;
&lt;br /&gt;
:[Fourth row:]&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;25,259,973,541,888&amp;lt;/span&amp;gt;&lt;br /&gt;
:Software developer who forgot about floats&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&amp;lt;/span&amp;gt;&lt;br /&gt;
:Astronomer&lt;br /&gt;
&lt;br /&gt;
:[Fifth row:]&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;{∅,{∅},{∅,{∅}},{∅,{∅},{...&amp;lt;/span&amp;gt;&lt;br /&gt;
:Set theorist&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;1,262,998,704,860&amp;lt;br&amp;gt;score and four&amp;lt;/span&amp;gt;&lt;br /&gt;
:Abraham Lincoln&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category: Programming]]&lt;br /&gt;
[[Category: Math]]&lt;br /&gt;
[[Category: Astronomy]]&lt;br /&gt;
[[Category: Science]]&lt;br /&gt;
[[Category:Comics featuring politicians]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2319:_Large_Number_Formats&amp;diff=193360</id>
		<title>2319: Large Number Formats</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2319:_Large_Number_Formats&amp;diff=193360"/>
				<updated>2020-06-13T06:50:31Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */ anglo saxon rather than &amp;quot;western&amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2319&lt;br /&gt;
| date      = June 12, 2020&lt;br /&gt;
| title     = Large Number Formats&lt;br /&gt;
| image     = large number formats-2.png&lt;br /&gt;
| titletext = 10^13.4024: A person who has come back to numbers after a journey deep into some random theoretical field&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by ABRAHAM LINCOLN. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic shows how different people express large numbers. This number in question is approximately the distance from the planet Earth to the planet Jupiter as of June 2020, in inches (1 inch = 2.54 cm).&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Number&lt;br /&gt;
! Type of person&lt;br /&gt;
! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 25,259,974,097,204&lt;br /&gt;
| Normal Person&lt;br /&gt;
| This is the full number, written out in the normal fashion, with commas to indicate powers of 1000. Note that this convention is only considered normal in the Anglo-Saxon world; conventions for writing large numbers in full vary considerably across cultures. For example in countries where the comma is used as decimal separator {{w|Decimal separator}} (including Europe outside the UK), one would write 25.259.974.097.204. Under the {{w|Indian numbering system}}, this number would be written as 25,25,997,40,97,204. &lt;br /&gt;
|-&lt;br /&gt;
| 25 Trillion&lt;br /&gt;
| Normal Person&lt;br /&gt;
| This is the number, rounded to trillions in the normal fashion.&lt;br /&gt;
|-&lt;br /&gt;
| 25 Billion&lt;br /&gt;
| Old British Person&lt;br /&gt;
| In current English usage, across the anglophonic world with some hold-outs, an n-illion means 10^(3n+3) as per the {{w|short scale}} system popularised by American influence in international trade, so a trillion means 10^12, as above. However, older British English use had an n-illion meaning 10^(6n) (i.e. the simpler calculation of ''million^n''), so a billion meant 10^12. The change stems from a 1974 commitment by Harold Wilson, the Prime Minister of the UK at the time, to change from the {{w|long scale}} (previously often described as the British system) to the short one for all official purposes.&lt;br /&gt;
&lt;br /&gt;
Though not instantly widely adopted for common usage, the mid-'70s could therefore be considered the key turning point between when an older or younger British person learns (as the change filters through the system at various stages of education) what their &amp;quot;Billion&amp;quot;s and &amp;quot;Trillion&amp;quot;s are supposed to represent.&lt;br /&gt;
&lt;br /&gt;
(The 1971 transition to decimalised currency may also date a person's experiences, but was a more comprehensive and immediate change for everyone who handled any money at all, in the UK, and thus was a more definite point of change apart from the extended survival of the &amp;quot;12 times table&amp;quot; being taught by rote in primary education, rather than ending at the 10s.)&lt;br /&gt;
&lt;br /&gt;
As well as 'traditionalist' British use, the Long Scale is widely used in the non-anglophone world, in local language versions, though while the British system tended to infill n-and-a-half powers of the million with the term &amp;quot;thousand n-illion&amp;quot;, the suffix &amp;quot;-illi''ard''&amp;quot;, or equivalent, is often used for the thousands multiple directly atop the respective &amp;quot;-illion&amp;quot; point.&lt;br /&gt;
|-&lt;br /&gt;
|2.526x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&lt;br /&gt;
|Scientist&lt;br /&gt;
|This number is formatted in {{w|scientific notation}}, using the exponent 10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;.&lt;br /&gt;
|-&lt;br /&gt;
| 2.525997x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&lt;br /&gt;
| Scientist trying to avoid rounding up&lt;br /&gt;
| Using as many decimal places as necessary until hitting a digit (0-4) that results in rounding down, even if it goes against the common scientific practice of reporting the correct amount of &amp;quot;significant figures&amp;quot;. A previous version of the comic had a typo (the number was ''2.5997x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;''), but Randall updated the comic.&lt;br /&gt;
|-&lt;br /&gt;
| 2.526e13 or&lt;br /&gt;
2.526*10^13&lt;br /&gt;
| Software developer &lt;br /&gt;
| Computer code cannot typically use the superscripts or other types of rich text formatting, so the exponent is indicated with the {{w|caret}}. &amp;quot;e13&amp;quot; is a common shorthand way of saying &amp;quot;ten to the power of 13&amp;quot;.&lt;br /&gt;
|-&lt;br /&gt;
| 25,259,973,541,888&lt;br /&gt;
| Software developer who forgot about floats&lt;br /&gt;
| This is the number after being converted to the limited precision of a {{w|32-bit floating point|32-bit float}}.&lt;br /&gt;
|-&lt;br /&gt;
| 10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&lt;br /&gt;
| Astronomer&lt;br /&gt;
| For extremely large distances, astronomers typically only care about orders of magnitude, i.e. 10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;, not 10&amp;lt;sup&amp;gt;12&amp;lt;/sup&amp;gt; or 10&amp;lt;sup&amp;gt;14&amp;lt;/sup&amp;gt;. Randall often jokes about the lack of precision needed by astronomers, such as in that one xkcd (#[[2205]]) where the astronomer-cosmologist is equally willing to make pi equal to one, or ten. The original number is rounded to the nearest power of ten.&lt;br /&gt;
|-&lt;br /&gt;
| {∅,{∅},{∅,{∅}},{∅,{∅},{...&lt;br /&gt;
| Set theorist&lt;br /&gt;
| In Zermelo-Fraenkel set theory, the natural numbers are defined recursively by letting 0 = ∅ (the {{w|empty set}}), and ''n'' + 1 = ''n'' ∪ {''n''}. So, every natural number ''n'' is the set of all natural numbers less than ''n'', and since 0 is defined as the empty set, all numbers are nested sets of empty sets.&lt;br /&gt;
|-&lt;br /&gt;
| 1,262,998,704,860 score and four&lt;br /&gt;
| Abraham Lincoln&lt;br /&gt;
| In the {{W|Gettysburg Address}}, Lincoln speaks the number &amp;quot;87&amp;quot; as &amp;quot;four score and seven&amp;quot; (&amp;quot;score&amp;quot; meaning &amp;quot;20&amp;quot;). The original number is rewritten in &amp;quot;score&amp;quot; (multiples of 20) plus a remainder (four).&lt;br /&gt;
|-&lt;br /&gt;
| 10^13.4024 ''(title text)''&lt;br /&gt;
| A person who has come back to numbers after a journey deep into some random theoretical field&lt;br /&gt;
| In some fields of mathematics, especially those dealing with very {{w|large numbers}}, numbers are sometimes represented by raising ten (or some other convenient base) to an oddly precise power, to facilitate comparison of their magnitudes without filling up pages upon pages of digits.  An example of this is {{w|Skewes's number}}, which is formally calculated to be ''e''&amp;lt;sup&amp;gt;''e''&amp;lt;sup&amp;gt;''e''&amp;lt;sup&amp;gt;79&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;, but is more commonly approximated as 10&amp;lt;sup&amp;gt;10&amp;lt;sup&amp;gt;10&amp;lt;sup&amp;gt;34&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;&amp;lt;/sup&amp;gt;. 13.4024 is the {{w|common logarithm}} of 25,259,974,097,204 (log&amp;lt;sub&amp;gt;10&amp;lt;/sub&amp;gt; 25,259,974,097,204 = 13.4024329009), thus this &amp;quot;format&amp;quot; is mathematically correctly, but not commonly, used.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
:[A panel only with text. At the top there is four lines of explanatory text. Below that there are 5 rows of number formats. There are 2 columns in each row. Each numerical format is in red, with black text explaining the format below it.]&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;big&amp;gt;What the way you write large&amp;lt;/big&amp;gt;&lt;br /&gt;
:&amp;lt;big&amp;gt;numbers says about you&amp;lt;/big&amp;gt;&lt;br /&gt;
:(Using the approximate current distance&lt;br /&gt;
:to Jupiter in inches as an example)&lt;br /&gt;
&lt;br /&gt;
:[First row:]&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;25,259,974,097,204&amp;lt;/span&amp;gt;&lt;br /&gt;
:Normal person&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;25 trillion&amp;lt;/span&amp;gt;&lt;br /&gt;
:Normal person&lt;br /&gt;
&lt;br /&gt;
:[Second row:]&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;25 billion&amp;lt;/span&amp;gt;&lt;br /&gt;
:Old British person&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;2.526x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&amp;lt;/span&amp;gt;&lt;br /&gt;
:Scientist&lt;br /&gt;
&lt;br /&gt;
:[Third row:]&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;2.525997x10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&amp;lt;/span&amp;gt;&lt;br /&gt;
:Scientist trying to avoid rounding up&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;2.526e13 or&amp;lt;br&amp;gt;2.526*10^13&amp;lt;/span&amp;gt;&lt;br /&gt;
:Software developer&lt;br /&gt;
&lt;br /&gt;
:[Fourth row:]&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;25,259,973,541,888&amp;lt;/span&amp;gt;&lt;br /&gt;
:Software developer who forgot about floats&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;10&amp;lt;sup&amp;gt;13&amp;lt;/sup&amp;gt;&amp;lt;/span&amp;gt;&lt;br /&gt;
:Astronomer&lt;br /&gt;
&lt;br /&gt;
:[Fifth row:]&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;{∅,{∅},{∅,{∅}},{∅,{∅},{...&amp;lt;/span&amp;gt;&lt;br /&gt;
:Set theorist&lt;br /&gt;
:&amp;lt;span style=&amp;quot;color:red&amp;quot;&amp;gt;1,262,998,704,860&amp;lt;br&amp;gt;score and four&amp;lt;/span&amp;gt;&lt;br /&gt;
:Abraham Lincoln&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category: Programming]]&lt;br /&gt;
[[Category: Math]]&lt;br /&gt;
[[Category: Astronomy]]&lt;br /&gt;
[[Category: Science]]&lt;br /&gt;
[[Category:Comics featuring politicians]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2307:_Alive_Or_Not&amp;diff=192108</id>
		<title>Talk:2307: Alive Or Not</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2307:_Alive_Or_Not&amp;diff=192108"/>
				<updated>2020-05-16T13:34:45Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
&lt;br /&gt;
I'm pretty sure high-pressure fire hoses belong on this scale[[User:60sRefugee|60sRefugee]] ([[User talk:60sRefugee|talk]]) 21:47, 15 May 2020 (UTC)&lt;br /&gt;
:What about wacky waving inflatable tube guy? [[Special:Contributions/172.68.38.124|172.68.38.124]] 00:41, 16 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Funny, for once viruses are said to be alive. That's new... [[Special:Contributions/141.101.107.138|141.101.107.138]] 22:01, 15 May 2020 (UTC)&lt;br /&gt;
:Definitely new, and extremely angering! I could scream... [[Special:Contributions/172.68.143.30|172.68.143.30]] 22:47, 15 May 2020 (UTC)&lt;br /&gt;
::Jup. The nex disgusting piece of antiscience after Wednesday´s nonsense about handwashing helping against respirational diseases. I think Monroe has caught a bug from Potus Donald. --[[Special:Contributions/141.101.69.33|141.101.69.33]] 07:44, 16 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Do we want to bicker over the placement of the line (like &amp;quot;Why is it below viruses&amp;quot;), or the order things are placed in (like &amp;quot;Why are slime molds below plants&amp;quot;)? [[User:GreatWyrmGold|GreatWyrmGold]] ([[User talk:GreatWyrmGold|talk]]) 22:06, 15 May 2020 (UTC)&lt;br /&gt;
: Oh, go on. If you insist. You go first, unless you already have. ;) [[Special:Contributions/162.158.154.31|162.158.154.31]] 22:46, 15 May 2020 (UTC)&lt;br /&gt;
: Seconded, I'm most interested which criterion (even a numeric one, as the diagram is suggestive of) Randall used. [[Special:Contributions/162.158.158.163|162.158.158.163]] 09:43, 16 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
True fossils have remineralised so generally do not have DNA left. They are merely the shadow of a previous life.&lt;br /&gt;
&lt;br /&gt;
Surprised no one has noticed the typo yet.  It's 'archaea', not 'archea'&lt;br /&gt;
:(Sign yourself(/ves), &amp;quot;True fossils&amp;quot; and &amp;quot;Surprised&amp;quot;?) I disagree. It's 'archæa'... [[Special:Contributions/162.158.154.31|162.158.154.31]] 22:46, 15 May 2020 (UTC)&lt;br /&gt;
&lt;br /&gt;
Poor English and a mistake. It should say...&lt;br /&gt;
&amp;quot;...discussion about *whether* virus*es* are alive.&amp;quot; &lt;br /&gt;
Also the (covid for starters) is wrong. Covid19 is the disease caused by the virus (as mentioned in the line above) not the virus itself&lt;br /&gt;
&lt;br /&gt;
I am disappointed that sponges are not mentioned as an example of weird animals. I mean, come on, way weirder than jellyfish. But it is good that viruses get the recognition they deserve.[[User:Jkrstrt|Jkrstrt]] ([[User talk:Jkrstrt|talk]]) 13:34, 16 May 2020 (UTC)&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2305:_Coronavirus_Polling&amp;diff=191875</id>
		<title>2305: Coronavirus Polling</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2305:_Coronavirus_Polling&amp;diff=191875"/>
				<updated>2020-05-11T19:58:41Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */ absence of controversy&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2305&lt;br /&gt;
| date      = May 11, 2020&lt;br /&gt;
| title     = Coronavirus Polling&lt;br /&gt;
| image     = coronavirus_polling.png&lt;br /&gt;
| titletext = If you want to see the polling questions we agree on MOST, you can check out Chapter 24 of my book How To, where I got the Roper Center on Public Opinion Research to help me design the world's least electable political campaign platform.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by an ONLINE POLL. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic, another comic in the [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 COVID-19 pandemic}}, compares opinion polling of COVID-19 related topics to polling of other, unrelated topics. Opinion among Americans is remarkably unisonous on necessary measures concerning the COVID-19 pandemic. To put this unanimity in perspective, polls on other topics are shown with similar high percentages of unanimity but now always on extremely uncontroversial questions like liking apple pie or Tom Hanks, or the importance of elections to democracy.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
[Caption at the top]&lt;br /&gt;
&lt;br /&gt;
It's hard to get people to agree on '''''anything''''' in polls.&lt;br /&gt;
&lt;br /&gt;
But we all agree about the coronavirus.&lt;br /&gt;
&lt;br /&gt;
Here's how americans feel about COVID-19, along with other topics that get similar levels of agreement for comparison.&lt;br /&gt;
&lt;br /&gt;
[Smaller caption]&lt;br /&gt;
&lt;br /&gt;
Compiled with help from HuffPost polling editor Ariel Edwards-Levy. Sources: xkcd.com/2305/sources&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category: COVID-19]]&lt;br /&gt;
[[Category: Food]]&lt;br /&gt;
[[Category: Bees]]&lt;br /&gt;
[[Category: Animals]]&lt;br /&gt;
[[Category: Comics featuring real people]]&lt;br /&gt;
[[Category: Comics featuring politicians]]&lt;br /&gt;
[[Category: How To]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2303:_Error_Types&amp;diff=191702</id>
		<title>2303: Error Types</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2303:_Error_Types&amp;diff=191702"/>
				<updated>2020-05-07T09:48:15Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2303&lt;br /&gt;
| date      = May 6, 2020&lt;br /&gt;
| title     = Error Types&lt;br /&gt;
| image     = error_types.png&lt;br /&gt;
| titletext = Type IIII error: Mistaking tally marks for Roman neumerals&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a TYPE IX DROID. Provide examples for each error type. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}. &lt;br /&gt;
&lt;br /&gt;
The comic is inspired by the COVID-19 pandemic, as there is a lot of medical testing for the disease being done, including detection of the virus itself, usually by qPCR, or of antibodies present in people who have had the disease (sometimes unknowingly). The quality of these tests is often mediocre and never perfect, leading to discussion of different types of errors that can occur, including &amp;quot;false positives&amp;quot; (calling presence of the virus/antibodies when they are not really there) or false negatives (failing to see the virus/ antibodies).  &lt;br /&gt;
The comic is riffing on {{w|Type I and type II errors}}, also known as &amp;quot;false positive&amp;quot; and &amp;quot;false negative&amp;quot;, respectively. The first two rows of the comic's table are correct definitions for established terms in statistics. Further rows contain suggestions for new terminology. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{|class = &amp;quot;wikitable&amp;quot;&lt;br /&gt;
|+Explanation of error types&lt;br /&gt;
|-&lt;br /&gt;
!Type&lt;br /&gt;
!Description&lt;br /&gt;
!Explanation&lt;br /&gt;
|-&lt;br /&gt;
|Type I&lt;br /&gt;
|{{w|False_positives_and_false_negatives#False_positive_error|False positive}}&lt;br /&gt;
|A false positive is a result that indicates a correlation, when there is no correlation in reality. For example, a person may test positive (indicating that he has a disease), but in actuality he ''does not'' have the disease.&lt;br /&gt;
|-&lt;br /&gt;
|Type II&lt;br /&gt;
|{{w|False_positives_and_false_negatives#False_negative_error|False negative}}&lt;br /&gt;
|A false negative is a result that indicates no correlation, when there is a correlation in reality. For example, a person may test negative (indicating that he does not have a disease), but in actuality he ''does'' have the disease.&lt;br /&gt;
|-&lt;br /&gt;
|Type III&lt;br /&gt;
|True positive for incorrect reasons&lt;br /&gt;
|&amp;quot;{{w|Type III error}}&amp;quot; is a nonstandard term meant to build off the notion of type I and II errors. Randall's explanations of this and of Type IV errors line up with some relatively common definitions of them, but others have also been proposed. None have yet been widely adopted. The Type III and Type IV definitions given here correspond to the {{w|Gettier_problem|Gettier Problem}} in philosophy.  &lt;br /&gt;
|-&lt;br /&gt;
|Type IV&lt;br /&gt;
|True negative for incorrect reasons&lt;br /&gt;
|Randall's proposed Type III and Type IV errors refer to when a correct correlation or lack thereof is determined, but on faulty grounds. Although harmless in the present, this may lead to false faith in the results at a later date, as the faulty grounds of the result may lead to a type I or type II error in different circumstances.&lt;br /&gt;
|-&lt;br /&gt;
|Type V&lt;br /&gt;
|Incorrect result which leads you to a correct conclusion due to unrelated errors&lt;br /&gt;
|Here we get into errors entirely made up by Randall. The idea behind this one is that a botched statistical test might accidentally result in a true conclusion due to completely unrelated errors in the other direction--perhaps during data collection or aggregation.&lt;br /&gt;
|-&lt;br /&gt;
|Type VI&lt;br /&gt;
|Correct result which you interpret wrong&lt;br /&gt;
|An unfortunately common occurrence. For example, statistical tests on observational data can only determine correlation, not causation, yet press releases and subsequent popular articles often imply or explicitly state a causal relationship (&amp;quot;Drinking 10 cups of coffee per day reduces your risk of cancer by 20%!&amp;quot; or whatnot). This has actually been [https://en.wikipedia.org/wiki/Type_III_error#Marascuilo_and_Levin proposed as a definition of a Type IV error].&lt;br /&gt;
|-&lt;br /&gt;
|Type VII&lt;br /&gt;
|Incorrect result which produces a cool graph&lt;br /&gt;
|It is commonly believed that [https://www.reddit.com/r/dataisbeautiful/ data is beautiful]. Sometimes, that's still true even when the data is bogus!&lt;br /&gt;
|-&lt;br /&gt;
|Type VIII&lt;br /&gt;
|Incorrect result which sparks further research and the development of new tools which reveal the flaw in the original results while producing novel correct results&lt;br /&gt;
|A hypothetical example might be if the Fleischmann–Pons {{w|cold fusion}} experiment, discredited as it was, had by its investigation successfully prompted the discovery of a truly usable alternate technique. (So far, in reality, it seems not to have.)&lt;br /&gt;
|-&lt;br /&gt;
|Type IX&lt;br /&gt;
|The Rise of Skywalker&lt;br /&gt;
|''{{w|Star Wars: The Rise of Skywalker}}'' is the ninth and final film in the ''Star Wars'' Skywalker saga. It received far less critical acclaim than the previous two films in the sequel trilogy. Notably, this entry does not follow the theme of the comic and serves as a non sequitur punchline.&lt;br /&gt;
|-&lt;br /&gt;
|Type IIII&lt;br /&gt;
|Mistaking tally marks for Roman neumerals ''[sic]''&lt;br /&gt;
|Title text. &amp;quot;I&amp;quot;, &amp;quot;II&amp;quot;, and &amp;quot;III&amp;quot; could be representations of the numbers one, two, and three in either {{w|tally marks}} or {{w|Roman numerals}}. It's only when you get to &amp;quot;IV&amp;quot; or &amp;quot;IIII&amp;quot; that it becomes apparent which system is being used. Some clocks use Roman numerals but with &amp;quot;IIII&amp;quot; instead of &amp;quot;IV&amp;quot; at the four o'clock position; the exact reason for this is unknown, but [https://www.electrictime.com/news/roman-iiii-vs-iv-on-clock-dials/ several plausible hypotheses] have been advanced. Ironically, Randall seems to have made a typographical error of his own when spelling the word &amp;quot;numerals&amp;quot;.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[A list with nine entries. The left side has 9 types or errors numbered with roman numerals. The right side has a description of each type of error:]&lt;br /&gt;
:Type I Error: False positive&lt;br /&gt;
:Type II Error: False negative&lt;br /&gt;
:Type III Error: True positive for incorrect reasons&lt;br /&gt;
:Type IV Error: True negative for incorrect reasons&lt;br /&gt;
:Type V Error: Incorrect result which leads you to a correct conclusion due to unrelated errors&lt;br /&gt;
:Type VI Error: Correct result which you interpret wrong&lt;br /&gt;
:Type VII Error: Incorrect result which produces a cool graph&lt;br /&gt;
:Type VIII Error: Incorrect result which sparks further research and the development of new tools which reveal the flaw in the original results while producing novel correct results&lt;br /&gt;
:Type IX Error: The Rise of Skywalker&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
*Randall seems to have, Ironically, made a typographical error of his own when spelling the word &amp;quot;numerals&amp;quot; in the title text.&lt;br /&gt;
**This may be corrected later, but originally the title text was:&lt;br /&gt;
**Mistaking tally marks for Roman '''neumerals'''.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:COVID-19]]&lt;br /&gt;
[[Category:Statistics]]&lt;br /&gt;
[[Category:Star Wars]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2303:_Error_Types&amp;diff=191694</id>
		<title>2303: Error Types</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2303:_Error_Types&amp;diff=191694"/>
				<updated>2020-05-07T07:01:47Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */ rephrasing&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2303&lt;br /&gt;
| date      = May 6, 2020&lt;br /&gt;
| title     = Error Types&lt;br /&gt;
| image     = error_types.png&lt;br /&gt;
| titletext = Type IIII error: Mistaking tally marks for Roman neumerals&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a TYPE IX DROID. Provide examples for each error type. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}. &lt;br /&gt;
&lt;br /&gt;
The comic is inspired by the COVID-19 pandemic, as there is a lot of medical testing for the disease being done, including detection of the virus itself, usually by qPCR, or of antibodies present in people who have had the disease (sometimes unknowingly). The quality of these tests is often mediocre and never perfect, leading to discussion of different types of errors that can occur, including &amp;quot;false positives&amp;quot; (calling presence of the virus/antibodies when they are not really there) or false negatives(failing to see the virus/ antibodies).  &lt;br /&gt;
The comic is riffing on {{w|Type I and type II errors}}, also known as &amp;quot;false positive&amp;quot; and &amp;quot;false negative&amp;quot;, respectively. The first two rows of the comic's table are correct definitions for established terms in statistics. Further rows contain suggestions for new terminology. &lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{|class = &amp;quot;wikitable&amp;quot;&lt;br /&gt;
|+Explanation of error types&lt;br /&gt;
|-&lt;br /&gt;
!Type&lt;br /&gt;
!Description&lt;br /&gt;
!Explanation&lt;br /&gt;
|-&lt;br /&gt;
|Type I&lt;br /&gt;
|{{w|False_positives_and_false_negatives#False_positive_error|False positive}}&lt;br /&gt;
|A false positive is a result that indicates a correlation, when there is no correlation in reality. For example, a person may test positive (indicating that he has a disease), but in actuality he ''does not'' have the disease.&lt;br /&gt;
|-&lt;br /&gt;
|Type II&lt;br /&gt;
|{{w|False_positives_and_false_negatives#False_negative_error|False negative}}&lt;br /&gt;
|A false negative is a result that indicates no correlation, when there is a correlation in reality. For example, a person may test negative (indicating that he does not have a disease), but in actuality he ''does'' have the disease.&lt;br /&gt;
|-&lt;br /&gt;
|Type III&lt;br /&gt;
|True positive for incorrect reasons&lt;br /&gt;
|&amp;quot;{{w|Type III error}}&amp;quot; is a nonstandard term meant to build off the notion of type I and II errors. Randall's explanations of this and of Type IV errors line up with some relatively common definitions of them, but others have also been proposed. None have yet been widely adopted.&lt;br /&gt;
|-&lt;br /&gt;
|Type IV&lt;br /&gt;
|True negative for incorrect reasons&lt;br /&gt;
|Randall's proposed Type III and Type IV errors refer to when a correct correlation or lack thereof is determined, but on faulty grounds. Although harmless in the present, this may lead to false faith in the results at a later date, as the faulty grounds of the result may lead to a type I or type II error in different circumstances.&lt;br /&gt;
|-&lt;br /&gt;
|Type V&lt;br /&gt;
|Incorrect result which leads you to a correct conclusion due to unrelated errors&lt;br /&gt;
|Here we get into errors entirely made up by Randall. The idea behind this one is that a botched statistical test might accidentally result in a true conclusion due to completely unrelated errors in the other direction--perhaps during data collection or aggregation.&lt;br /&gt;
|-&lt;br /&gt;
|Type VI&lt;br /&gt;
|Correct result which you interpret wrong&lt;br /&gt;
|An unfortunately common occurrence. For example, statistical tests on observational data can only determine correlation, not causation, yet press releases and subsequent popular articles often imply or explicitly state a causal relationship (&amp;quot;Drinking 10 cups of coffee per day reduces your risk of cancer by 20%!&amp;quot; or whatnot). This has actually been [https://en.wikipedia.org/wiki/Type_III_error#Marascuilo_and_Levin proposed as a definition of a Type IV error].&lt;br /&gt;
|-&lt;br /&gt;
|Type VII&lt;br /&gt;
|Incorrect result which produces a cool graph&lt;br /&gt;
|It is commonly believed that [https://www.reddit.com/r/dataisbeautiful/ data is beautiful]. Sometimes, that's still true even when the data is bogus!&lt;br /&gt;
|-&lt;br /&gt;
|Type VIII&lt;br /&gt;
|Incorrect result which sparks further research and the development of new tools which reveal the flaw in the original results while producing novel correct results&lt;br /&gt;
|A hypothetical example might be if the Fleischmann–Pons {{w|cold fusion}} experiment, discredited as it was, had by its investigation successfully prompted the discovery of a truly usable alternate technique. (So far, in reality, it seems not to have.)&lt;br /&gt;
|-&lt;br /&gt;
|Type IX&lt;br /&gt;
|The Rise of Skywalker&lt;br /&gt;
|''{{w|Star Wars: The Rise of Skywalker}}'' is the ninth and final film in the ''Star Wars'' Skywalker saga. It received far less critical acclaim than the previous two films in the sequel trilogy.&lt;br /&gt;
|-&lt;br /&gt;
|Type IIII&lt;br /&gt;
|Mistaking tally marks for Roman neumerals ''[sic]''&lt;br /&gt;
|Title text. &amp;quot;I&amp;quot;, &amp;quot;II&amp;quot;, and &amp;quot;III&amp;quot; could be representations of the numbers one, two, and three in either {{w|tally marks}} or {{w|Roman numerals}}. It's only when you get to &amp;quot;IV&amp;quot; or &amp;quot;IIII&amp;quot; that it becomes apparent which system is being used. Some clocks use Roman numerals but with &amp;quot;IIII&amp;quot; instead of &amp;quot;IV&amp;quot; at the four o'clock position; the exact reason for this is unknown, but [https://www.electrictime.com/news/roman-iiii-vs-iv-on-clock-dials/ several plausible hypotheses] have been advanced. Ironically, Randall seems to have made a typographical error of his own when spelling the word &amp;quot;numerals&amp;quot;.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[A list with nine entries. The left side has 9 types or errors numbered with roman numerals. The right side has a description of each type of error:]&lt;br /&gt;
:Type I Error: False positive&lt;br /&gt;
:Type II Error: False negative&lt;br /&gt;
:Type III Error: True positive for incorrect reasons&lt;br /&gt;
:Type IV Error: True negative for incorrect reasons&lt;br /&gt;
:Type V Error: Incorrect result which leads you to a correct conclusion due to unrelated errors&lt;br /&gt;
:Type VI Error: Correct result which you interpret wrong&lt;br /&gt;
:Type VII Error: Incorrect result which produces a cool graph&lt;br /&gt;
:Type VIII Error: Incorrect result which sparks further research and the development of new tools which reveal the flaw in the original results while producing novel correct results&lt;br /&gt;
:Type IX Error: The Rise of Skywalker&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
*Randall seems to have, Ironically, made a typographical error of his own when spelling the word &amp;quot;numerals&amp;quot; in the title text.&lt;br /&gt;
**This may be corrected later, but originally the title text was:&lt;br /&gt;
**Mistaking tally marks for Roman '''neumerals'''.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:COVID-19]]&lt;br /&gt;
[[Category:Statistics]]&lt;br /&gt;
[[Category:Star Wars]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2298:_Coronavirus_Genome&amp;diff=191428</id>
		<title>2298: Coronavirus Genome</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2298:_Coronavirus_Genome&amp;diff=191428"/>
				<updated>2020-04-30T17:32:16Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */ The fact that the DNA-modifications may be reproduced during DNA-replications, is what makes epigenetics resemble 'normal' genetics.&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2298&lt;br /&gt;
| date      = April 24, 2020&lt;br /&gt;
| title     = Coronavirus Genome&lt;br /&gt;
| image     = coronavirus_genome.png&lt;br /&gt;
| titletext = Spellcheck has been great, but whoever figures out how to get grammar check to work is guaranteed a Nobel.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a NOBEL IN SPELLCHECKING. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.&lt;br /&gt;
&lt;br /&gt;
It was also the first in a [[:Category:Coronavirus Genome|new series]], followed in the next comic by [[2299: Coronavirus Genome 2]].&lt;br /&gt;
&lt;br /&gt;
[[Megan]] is a {{w|Genetics|geneticist}} doing research on the SARS-CoV-2 virus. She is analyzing the virus's {{w|genome}}, its genetic material composed of {{w|RNA}}. The genomic sequence can be represented as a list of {{w|nucleotide}} bases ({{w|guanine}}, {{w|adenine}}, {{w|cytosine}}, {{w|thymine}} and {{w|uracil}} - often abbreviated as G, A, C, T, and U).&lt;br /&gt;
&lt;br /&gt;
The nucleotide sequence displayed is a 100% match to six SARS-CoV-2 sequences in public databases, all of them originating from the East Coast of the United States. The sequence is from nucleotides 26202-26280 of the virus genome and overlaps an unknown open reading frame/gene named ORF3a. One of the matching sequences is [https://www.ebi.ac.uk/ena/data/view/MT344963]. However, SARS-CoV-2 is an RNA-virus, and so its genetic material (not containing any DNA) would not include thymine (T) but would use uracil (U) instead. The sequence has been altered to resemble the more familiar codes of DNA. &lt;br /&gt;
&lt;br /&gt;
[[Cueball]] is surprised that Megan and her colleagues actually use {{w|Microsoft Notepad}}, a simple {{w|text editor}}, to look at the genome, instead of more modern technology. She explains that better research institutions use {{w|Microsoft Word}}, a more advanced editor, to allow additional formatting (such as '''bolding''' and ''italics''), and humorously calls this &amp;quot;{{w|epigenetics}}&amp;quot;. In the real world, epigenetics is the study of changes that are not caused by changes in nucleotides, but by chemical modifications of DNA or chromosomes that cause changes in patterns of gene expression and activation, sometimes several generations down.  This might be considered analogous to altering the meaning of a text by changing its formatting rather than the content; for example, content can be moved into parentheses or footnotes to be de-emphasized, or rendered in boldface or enlarged to attract attention and emphasize key points. Much as text can be wrapped in HTML tags or similar markup to change its formatting, nucleotides can be {{w|DNA methylation|methylated}} to prevent transcription, and the {{w|histone}}s around which DNA is wound can also be modified to promote or repress gene expression. During DNA replication, these modifications are often also reproduced. &lt;br /&gt;
&lt;br /&gt;
The real punchline comes when Megan uses {{w|Spell checker|spellcheck}} to detect mutations in the genome by adding the previous genome to spellcheck and comparing them. Overall, Megan uses ridiculously and humorously crude methods to analyze a major genetic item. The genome of SARS-CoV-2 is almost 30,000 base-pairs long, which exceeds the {{w|longest words}} of any natural language by two orders of magnitude (the longest words ever used in literature -- i.e. not constructed in isolation simply for the purpose of being a long word, or chemical formulas -- approach 200 letters), and may exceed the capabilities of any available spell-checking program. Furthermore, a spellcheck program underlines the whole word if a single letter is wrong and not just the letter itself. Thus, it would not be able to highlight individual mutated base pairs.  Megan might be better served by using a {{w|diff}} tool, but most scientists generally use commercial software that is designed to view, annotate and edit DNA sequences (eg: Snapgene, Geneious, DNAstrider, ApE).&lt;br /&gt;
&lt;br /&gt;
The title text mentions {{w|Grammar checker|grammar checking}} and claims that whoever discovers how to use that to compare genomic material should be awarded a {{w|Nobel Prize}}. Spell-checking is analogous to comparing sequences against ones previously known, an activity which is the bread and butter of bioinformatics nowadays. Grammar checking would be analogous to having some sort of sense as to how well all the sequences generally cooperate and interact to create possibly viable functionality in an organism, something we are unable to do at the moment except in very limited ways and only in a few simple cases. It may also be a snarky commentary on the untrustworthy nature of grammar-check programs in general, which often follow grammatical rules far more strictly than is practical, especially in English (whose grammatical rules are numerous and often contradictory); it's not uncommon for an author to follow a grammar-check recommended correction only to find the corrected portion is now part of a longer portion that the checker deems &amp;quot;incorrect&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:[Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.]&lt;br /&gt;
:Cueball (off-screen): So that's the coronavirus genome, huh?&lt;br /&gt;
:Megan: It is!&lt;br /&gt;
:Laptop: TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA&lt;br /&gt;
&lt;br /&gt;
:[Cueball walks up and stands behind Megan, still working on the laptop.]&lt;br /&gt;
:Cueball: It's weird that you can just look at it in a text editor.&lt;br /&gt;
:Megan: It's essential!&lt;br /&gt;
:Megan: We geneticists do most of our work in Notepad.&lt;br /&gt;
&lt;br /&gt;
:[A frameless panel, Cueball still standing behind Megan.]&lt;br /&gt;
:Cueball: Notepad?&lt;br /&gt;
:Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic.&lt;br /&gt;
:Cueball: Ah, okay.&lt;br /&gt;
:Megan: That extra formatting is called &amp;quot;epigenetics&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
:[A regular panel, Cueball still stands behind Megan. Megan rests her arm on the chair. He has his hand on his chin.]&lt;br /&gt;
:Cueball: Hey, why does that one have a red underline?&lt;br /&gt;
:Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations.&lt;br /&gt;
:Cueball: ''Clever!''&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Coronavirus Genome]]&lt;br /&gt;
[[Category:Comics sharing name|Coronavirus Genome]]&lt;br /&gt;
[[Category:COVID-19]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Biology]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2298:_Coronavirus_Genome&amp;diff=191264</id>
		<title>2298: Coronavirus Genome</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2298:_Coronavirus_Genome&amp;diff=191264"/>
				<updated>2020-04-27T14:28:05Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */ no evidence for epigenetics having a role for &amp;quot;many generations&amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2298&lt;br /&gt;
| date      = April 24, 2020&lt;br /&gt;
| title     = Coronavirus Genome&lt;br /&gt;
| image     = coronavirus_genome.png&lt;br /&gt;
| titletext = Spellcheck has been great, but whoever figures out how to get grammar check to work is guaranteed a Nobel.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a NOBEL IN SPELLCHECKING. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.&lt;br /&gt;
&lt;br /&gt;
[[Megan]] is a {{w|Genetics|geneticist}} doing research on the SARS-CoV-2 virus. She is analyzing the virus's {{w|genome}}, its genetic material composed of {{w|RNA}}. The genomic sequence can be represented as a list of {{w|nucleotide}} bases ({{w|guanine}}, {{w|adenine}}, {{w|cytosine}}, {{w|thymine}} and {{w|uracil}} - often abbreviated as G, A, C, T, and U).&lt;br /&gt;
&lt;br /&gt;
The nucleotide sequence displayed is a 100% match to six SARS-CoV-2 sequences in public databases, all of them originating from the East Coast of the United States. The sequence is from nucleotides 26202-26280 of the virus genome and overlaps an unknown open reading frame/gene named ORF3a. One of the matching sequences is [https://www.ebi.ac.uk/ena/data/view/MT344963]. However, SARS-CoV-2 is an RNA-virus, and so its genetic material (not containing any DNA) would not include thymine (T) but would use uracil (U) instead. The sequence has been altered to resemble the more familiar codes of DNA. &lt;br /&gt;
&lt;br /&gt;
[[Cueball]] is surprised that Megan and her colleagues actually use {{w|Microsoft Notepad}}, a simple {{w|text editor}}, to look at the genome, instead of more modern technology. She explains that better research institutions use {{w|Microsoft Word}}, a more advanced editor, to allow additional formatting (such as '''bolding''' and ''italics''), and humorously calls this &amp;quot;{{w|epigenetics}}&amp;quot;. In the real world, epigenetics is the study of changes that are not caused by changes in nucleotides, but by chemical modifications of DNA or chromosomes that cause changes in patterns of gene expression and activation, sometimes several generations down.  This might be considered analogous to altering the meaning of a text by changing its formatting rather than the content; for example, content can be moved into parentheses or footnotes to be de-emphasized, or rendered in boldface or enlarged to attract attention and emphasize key points. Much as text can be wrapped in HTML tags or similar markup to change its formatting, nucleotides can be {{w|DNA methylation|methylated}} to prevent transcription, and the {{w|histone}}s around which DNA is wound can also be modified to promote or repress gene expression.&lt;br /&gt;
&lt;br /&gt;
The real punchline comes when Megan uses {{w|Spell checker|spellcheck}} to detect mutations in the genome by adding the previous genome to spellcheck and comparing them. Overall, Megan uses ridiculously and humorously crude methods to analyze a major genetic item. The genome of SARS-CoV-2 is almost 30,000 base-pairs long, which exceeds the {{w|longest words}} of any natural language by two orders of magnitude (the longest words ever used in literature -- i.e. not constructed in isolation simply for the purpose of being a long word, or chemical formulas -- approach 200 letters), and may exceed the capabilities of any available spell-checking program. Furthermore, a spellcheck program underlines the whole word if a single letter is wrong and not just the letter itself. Thus, it would not be able to highlight individual mutated base pairs.  Megan might be better served by using a {{w|diff}} tool, but most scientists are generally not experienced computer programmers or system administrators, and often do use mainstream tools to do tasks that could be done much more efficiently in a more esoteric way.&lt;br /&gt;
&lt;br /&gt;
The title text mentions {{w|Grammar checker|grammar checking}} and claims that whoever discovers how to use that to compare genomic material should be awarded a {{w|Nobel Prize}}. Spell-checking is analogous to comparing sequences against ones previously known, an activity which is the bread and butter of bioinformatics nowadays. Grammar checking would be analogous to having some sort of sense as to how well all the sequences generally cooperate and interact to create possibly viable functionality in an organism, something we are unable to do at the moment except in very limited ways and only in a few simple cases. It may also be a snarky commentary on the untrustworthy nature of grammar-check programs in general, which often follow grammatical rules far more strictly than is practical, especially in English (whose grammatical rules are numerous and often contradictory); it's not uncommon for an author to follow a grammar-check recommended correction only to find the corrected portion is now part of a longer portion that the checker deems &amp;quot;incorrect&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
The comic might also be a reference to {{w|Luc Montagnier}}, who shares a Nobel prize for the identification of HIV with {{w|Françoise Barré-Sinoussi}}. Since the award he has been busy doing really bad science.&lt;br /&gt;
He recently produced a study about finding similar small chains of amino acids, from 6 to 8 amino acids, in both HIV-1 and 2019-nCoV. He concludes that 2019-nCoV has been modified by human hand. Multiple studies have been produced to deny that claim.[https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1.full.pdf]&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:[Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.]&lt;br /&gt;
:Cueball (off-screen): So that's the coronavirus genome, huh?&lt;br /&gt;
:Megan: It is!&lt;br /&gt;
:Laptop: TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA&lt;br /&gt;
&lt;br /&gt;
:[Cueball walks up and stands behind Megan, still working on the laptop.]&lt;br /&gt;
:Cueball: It's weird that you can just look at it in a text editor.&lt;br /&gt;
:Megan: It's essential!&lt;br /&gt;
:Megan: We geneticists do most of our work in Notepad.&lt;br /&gt;
&lt;br /&gt;
:[A frameless panel, Cueball still standing behind Megan.]&lt;br /&gt;
:Cueball: Notepad?&lt;br /&gt;
:Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic.&lt;br /&gt;
:Cueball: Ah, okay.&lt;br /&gt;
:Megan: That extra formatting is called &amp;quot;epigenetics&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
:[A regular panel, Cueball still stands behind Megan. Megan rests her arm on the chair. He has his hand on his chin.]&lt;br /&gt;
:Cueball: Hey, why does that one have a red underline?&lt;br /&gt;
:Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations.&lt;br /&gt;
:Cueball: ''Clever!''&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category: Comics featuring Cueball]]&lt;br /&gt;
[[Category: Comics featuring Megan]]&lt;br /&gt;
[[Category: Biology]]&lt;br /&gt;
[[Category:COVID-19]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2254:_JPEG2000&amp;diff=185957</id>
		<title>2254: JPEG2000</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2254:_JPEG2000&amp;diff=185957"/>
				<updated>2020-01-14T09:42:12Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2254&lt;br /&gt;
| date      = January 13, 2020&lt;br /&gt;
| title     = JPEG2000&lt;br /&gt;
| image     = jpeg2000.png&lt;br /&gt;
| titletext = I was actually a little relieved when I learned that JPEG2000 was used in the DCI digital cinema standard. I was feeling so bad for it!&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a BADLY COMPRESSED IMAGE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
[[wikipedia:JPEG 2000|JPEG2000]] is a standard for digital image storage created by the Joint Photographic Experts Group from 1997 to 2000 to improve on the original JPEG standard, published in 1992. As of 2020, it is supported by Photoshop and the Safari browser, but it remains unsupported or poorly supported by other popular software, including Google Chrome and Mozilla Firefox browsers, as well as the GIMP (a free and open source image editor).&lt;br /&gt;
The conventional file name extensions for files using the JPEG2000 standard, .jp2 and .jpx, remain unfamiliar to many users for whom the .jpg extension, denoting the original standard, is well known.&lt;br /&gt;
The JPEG2000 standard was seen an improvement by its creators, supporting many features not included in the original standard, such as multiple resolutions, progressive transmission, a lossless compression option, and alpha channel transparency.  The complexity of fully implementing the standard, as well as patent concerns, may have slowed adoption.&lt;br /&gt;
&lt;br /&gt;
The people in the comic seem to have some desire for JPEG2000 adoption, and may have been involved in its creation, and seem to care more about its eventual use than rapid adoption.&lt;br /&gt;
&lt;br /&gt;
The core concept of this comic is that engineers often expect that a superior technology or standard will catch on, though often other factors keep an &amp;quot;inferior&amp;quot; standard dominant. (See various comics referencing [[:Category:Dvorak|Dvorak]] keyboards, as well as the term &amp;quot;[https://whatis.techtarget.com/definition/betamaxed betamaxed].&amp;quot;)&lt;br /&gt;
The &amp;quot;we are in this for the long haul&amp;quot; statement might refer to the engineers believing that superior technology will eventually win despite the evidence to the contrary. Its humor comes from the fact that JPEG2000 shows no sign of becoming a widely-used standard.&lt;br /&gt;
&lt;br /&gt;
The title text suggests that Randall feels bad that the standard hasn't been adopted, perhaps because he empathizes with the engineers who worked hard to develop it or anthropomorphizes the standard itself, which has been ignored by most of the computer-using world. DCI, short for {{w|Digital Cinema Initiatives}}, is a collaboration of several major film studios to establish standards for the security and proper display of digital films.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Cueball and Hairbun are both at a table, facing each other, both working on their own respective computers.]&lt;br /&gt;
&lt;br /&gt;
:[Cueball leans back and stops typing. Hairbun continues to type.]&lt;br /&gt;
&lt;br /&gt;
:[Cueball looks over at Hairbun.]&lt;br /&gt;
:Cueball: I'm starting to worry that JPEG 2000 isn't catching on as fast as we expected.&lt;br /&gt;
:Hairbun: Don't worry! We're in this for the long haul.&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
* Cueball's keyboard seems to have inexplicably disappeared in the last panel.&lt;br /&gt;
* A JPEG2000 version of the image file is available here: https://imgs.xkcd.com/comics/jpeg2000.jp2 . It is only 20% smaller than the PNG version, and has visible compression artifacts.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Hairbun]]&lt;br /&gt;
[[Category:Computers]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2253:_Star_Wars_Voyager_1&amp;diff=185894</id>
		<title>2253: Star Wars Voyager 1</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2253:_Star_Wars_Voyager_1&amp;diff=185894"/>
				<updated>2020-01-13T16:37:10Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2253&lt;br /&gt;
| date      = January 10, 2020&lt;br /&gt;
| title     = Star Wars Voyager 1&lt;br /&gt;
| image     = star_wars_voyager_1.png&lt;br /&gt;
| titletext = There's some flexibility depending on your standards for measuring runtime and the various special editions. If you still want to have a party, I'm sure you can find some combination that works.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a BERT. This explanation is basic, and needs more information. DO NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
[[Cueball]] has added together all the runtimes of the ''{{w|Star Wars}}'' movies (episodes I-IX) and then calculated the exact time at which a message sent to {{w|Voyager 1}} will have that exact duration in {{w|light speed}} delay. He announces this information to [[Megan]] and [[Beret Guy]] only seconds before it occurs, allowing him to signal the moment by saying &amp;quot;Now!&amp;quot;&lt;br /&gt;
&lt;br /&gt;
Megan expresses surprise that the event isn't being celebrated with fireworks. Judging by the fact that she doesn't look up from her book, her surprise is sarcastic. Beret Guy breaks into song with the New Year's traditional &amp;quot;{{w|Auld Lang Syne}}&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
This comic highlights a coincidental relationship between the ''Star Wars'' Episodes and the {{w|NASA}} Space Probe &amp;quot;Voyager 1&amp;quot;, which most likely no one else has thought about, but most likely fitting well with fans of both xkcd and ''Star Wars''.&lt;br /&gt;
&lt;br /&gt;
The {{w|Star Wars (film)|first ''Star Wars'' episode}} was released on May 25th, 1977, only four months before Voyager 1 was launched on September 5th, 1977. The {{w|Star Wars: The Rise of Skywalker|last episode}} was released more than 42.5 years later on December 20th, 2019, only three weeks before this comic. &lt;br /&gt;
&lt;br /&gt;
Voyager 1 was, with a distance of 148.68 {{w|Astronomical unit}}s (22.2 billion km; 13.8 billion mi) from Earth as of December 26, 2019, the most distant human-made object from Earth. This data is given with reference in the Wikipedia article for Voyager 1. That was less than a week after the release of the new movie. That is [https://www.wolframalpha.com/input/?i=148.68+AU+in+light+hours approximately 20.6 light hours] away. With the recently released last episode the total viewing time of the nine episodes is [[#Table of runtime| 20.35 hours]] (not including the two spin-off movies ''{{w|Rogue One}}'' and ''{{w|Solo: A Star Wars Story}})''. So a discrepancy of 15 minutes. This could be explained by the title text. &lt;br /&gt;
&lt;br /&gt;
In the [https://voyager.jpl.nasa.gov/mission/status/ mission status] of the two Voyager probes there were a [https://www.explainxkcd.com/wiki/images/1/1c/Voyager_mission_status_2020-01-10.png One-Way Light Time] of 20 hours 36 minutes and 46 seconds on the day the comic was released. This corresponds to 20.613 light hours, only the 46 seconds deviation from exactly 20.6 hours.&lt;br /&gt;
&lt;br /&gt;
This is an odd coincidence that Cueball/[[Randall]] saw significant enough to mark with a timer and acknowledgement to Megan and Beret Guy (and the rest of the fans of xkcd). &lt;br /&gt;
&lt;br /&gt;
In the title text Randall notes that there can be different ways of measuring run times, both if you do not count credits into the runtime or with more than one version existing of at least the original trilogies films, with added extra footage. This means that if you choose the longest possible run time, you may still have a chance to throw a party for some time to come, as every extra minute of film will add time before Voyager 1 reaches that extra light minute. &lt;br /&gt;
&lt;br /&gt;
However as demonstrated in the [[#Table of runtime|Table of runtime]] below, then only for the very longest versions would this have worked around the time of release of the movie. Now three weeks later it is too late, until a possible future Episode X would be released.&lt;br /&gt;
&lt;br /&gt;
When Voyager 1 {{w|Voyager_1#Exit_from_the_heliosphere|left the heliosphere}} it was traveling at about 17 kilometers per second (11 mi/s), making it the fastest heliocentric recession speed of any spacecraft, and it is not really slowing down. (Do note that the speed with which it travels from Earth is not the same since Earth is in orbit around the Sun and sometimes travels faster towards Voyager 1 than Voyager 1 leaves the sun, but then Earth turns and goes the other way!)&lt;br /&gt;
&lt;br /&gt;
Since a light minute is [https://www.wolframalpha.com/input/?i=1.799%C3%9710%5E7+kilometers&amp;amp;assumption=%22ClashPrefs%22+-%3E+%22%22 1.799×10&amp;lt;sup&amp;gt;7&amp;lt;/sup&amp;gt; kilometers] it takes Voyager 1 [https://www.wolframalpha.com/input/?i=1+light+minute%2F17+kilometers+per+second+in+days 12.25 days] to travel this far. So for every minute added to the run time, the party start time will be delayed by more than 12 days. However it is already 14 days since the distance given on Wikipedia, so more than one extra minute is needed to postpone the party to after the release day of the comic.&lt;br /&gt;
&lt;br /&gt;
Last possible chance is to assume that all run times have been rounded down, which could add anywhere from 9 half to almost 9 full minutes, if they round 125.9 down to 125, and not only rounded 125.4 (and not rounding 125.5 up). Actually assuming all runtimes are rounded down it is realistic that there is on average half a minute extra runtime per episodes for 4.5 minutes extra time. This would buy 55 extra days from the 26th of December... But to find this out correctly, someone would need to review all the 9 episodes from the very first second to the very last of the most extended versions. It seems that it could still be possible to find a day where the party can still be held after the release day of the comic.&lt;br /&gt;
&lt;br /&gt;
In the extreme case that all movies went 59 seconds over a full minute, but all times are rounded down, it would add 8 minutes and 51 seconds. This could give 108 extra days from 2019-12-26, meaning that [https://www.wolframalpha.com/input/?i=2019-12-26%2B108days Easter Sunday 2020] (2020-04-12) would be the last possible day for such a party.&lt;br /&gt;
&lt;br /&gt;
==Table of runtime==&lt;br /&gt;
*Here is a table with the nine episodes (ordered in release order, but it is sortable and the episode number is also included)&lt;br /&gt;
*The title, the run time and the release day (theatrical release in the US) is {{w|Star_Wars#Film|taken from Wikipedia}}.&lt;br /&gt;
*The total run time in hours are summed up chronological in the last column. (So no meaning if the table is sorted).&lt;br /&gt;
*From this the total runtime comes up to 1221 minutes which is only 20.35 hours 15 minutes shorter than the time it currently takes light to travel to Voyager 1. &lt;br /&gt;
**Seems like Randall used a different version of the runtime than standard per wikipedia.&lt;br /&gt;
**To investigate this the longest time of any version as given on {{w|IMDb}} (or Wikipedia, which was longer than on IMDb with 1 minute for Epiosde 8) was added in the next column with the total time for these longest versions in the last. This brings the total time up to 1236 exactly 15 minutes extra getting a total of 20.6 hours.&lt;br /&gt;
**So at the distance given on Wikipedia December 26th, it must have been very close to the ''Now'' Cueball mentions. But now a few weeks later the discrepancy is even larger, and there seems to be no way to choose an even longer running time than those given below. So only rounding down could  save the chance to postpone the party for a later day.&lt;br /&gt;
{|class=&amp;quot;wikitable sortable&amp;quot;&lt;br /&gt;
!#&lt;br /&gt;
!Title&lt;br /&gt;
!Release day&lt;br /&gt;
!Run time (min)&lt;br /&gt;
!Total time (hour)&lt;br /&gt;
!Longest run (min)&lt;br /&gt;
!Sum longest (hour)&lt;br /&gt;
|-&lt;br /&gt;
| 4 ||{{w|Star Wars (film)| Star Wars}}||1977-05-25||121||2.02|| 125 || 2.08&lt;br /&gt;
|-&lt;br /&gt;
| 5 ||{{w|The Empire Strikes Back}}||1980-05-21||124||4.08 || 127 || 4.20&lt;br /&gt;
|-&lt;br /&gt;
| 6 ||{{w|Return of the Jedi}}||1983-05-25||132||6.28 || 134 || 6.43&lt;br /&gt;
|-&lt;br /&gt;
| 1 ||{{w|Star Wars: Episode I – The Phantom Menace}}||1999-05-19||133||8.50 || 136 || 8.70&lt;br /&gt;
|-&lt;br /&gt;
| 2 ||{{w|Star Wars: Episode II – Attack of the Clones}}||2002-05-16||142||10.87 || 142 || 11.06&lt;br /&gt;
|-&lt;br /&gt;
| 3 ||{{w|Star Wars: Episode III – Revenge of the Sith}}||2005-05-19||140||13.20 || 140 || 13.4&lt;br /&gt;
|-&lt;br /&gt;
| 7 ||{{w|Star Wars: The Force Awakens}}||2015-12-18||135||15.45 || 138 || 15.7&lt;br /&gt;
|-&lt;br /&gt;
| 8 ||{{w|Star Wars: The Last Jedi}}||2017-12-15||152||17.98 || 152 || 18.22&lt;br /&gt;
|-&lt;br /&gt;
| 9 ||{{w|Star Wars: The Rise of Skywalker}}||2019-12-20||142||20.35 || 142 || 20.58&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Cueball is looking down at the smartphone he is holding in one hand, while he is holding his other hand's finger up in the air. He is standing behind an armchair where Megan is sitting reading a book or paper. She holds it open with both hands. She has turned her head halfway towards him. Sitting on the floor in front of her is Beret Guy, legs bent and leaning back resting on one hand, with his phone in the other hand.]&lt;br /&gt;
:Cueball: The time it takes light to travel between Earth and '''''Voyager 1''''' is exactly equal to the combined runtime of '''''Star Wars''''' episodes I-IX...&lt;br /&gt;
&lt;br /&gt;
:[A slim beat panel, showing only Cueball standing in the same pose as in the first panel.]&lt;br /&gt;
&lt;br /&gt;
:[Cueball looks up from his phone and raises his finger higher up. Megan has turned back to reading. Beret Guy looks up, and he has put his phone on the floor to put his, now free, hand on his heart, while singing, as indicated both with nodes before and after the lyrics he sings as well as letting his speech line start at a starburst near his head, rather than just beginning near the head, as normally.]&lt;br /&gt;
:Cueball: ...'''''Now!'''''&lt;br /&gt;
:Megan: Weird that I don't hear any fireworks.&lt;br /&gt;
:Beret Guy (singing): '''Should ollld acquaintance be forgooot'''&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Comics featuring Beret Guy]]&lt;br /&gt;
[[Category:Star Wars]]&lt;br /&gt;
[[Category:Space probes]]&lt;br /&gt;
[[Category:Songs]]&lt;br /&gt;
[[Category:New Year]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2207:_Math_Work&amp;diff=180515</id>
		<title>2207: Math Work</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2207:_Math_Work&amp;diff=180515"/>
				<updated>2019-09-27T14:03:58Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2207&lt;br /&gt;
| date      = September 25, 2019&lt;br /&gt;
| title     = Math Work&lt;br /&gt;
| image     = math_work.png&lt;br /&gt;
| titletext = I could type this into a solver, which MIGHT help, but would also mean I have to get a lot of parentheses right...&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
[[White Hat]] is observing a {{w|physicist}}, [[Cueball]], who is staring at some (in the comic unreadable) equations and diagrams on a {{w|chalkboard}}. White Hat is neither a physicist nor a {{w|mathematician}}, and seems to glorify those professions. He wishes he understood Cueball's work and &amp;quot;the beauty on display here&amp;quot;.  People who profess a love for mathematics often cite the beauty they see in pure math, how things work out so perfectly, as the reason they love math.&lt;br /&gt;
&lt;br /&gt;
The joke is that Cueball, the actual physicist, is actually doing something quite simple and relatable: Avoiding hard work. Solving for two unknowns isn't necessarily difficult but can be, depending on how they relate to each other. Cueball clearly thinks it's possible to do but would rather find an easier route. The same could be said about the field of mathematics in general: A proof is beautiful to a mathematician when it's easy to understand and the result is profound when it's useful.&lt;br /&gt;
&lt;br /&gt;
The title text continues Cueball's thought process, with the possibility of using an equation solver to solve the equations. An equation solver or {{w|computer algebra system}} is a computer program which can be used to solve equations or systems of equations, and is typically not an especially beautiful way to address mathematical problems. Cueball would need to make sure that the equations are entered correctly, with parentheses in the correct places, when inputting them into the solver; again this is an issue far removed from the {{w|mathematical beauty|beauty of mathematics}} and physics.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[White Hat is watching Cueball from a couple of meters away. Cueball is contemplating the formulas and diagrams that fills the blackboard he stands in front of. Cueball holds a chalk in his hand. None of the content on the blackboard is readable, but there is a diagram in the shape of a circle and a another pie shaped diagram. Both are thinking with large thought bubbles above their heads, with small bubbles connecting them and the larger bubble]&lt;br /&gt;
:White Hat (thinking): Amazing watching a physicist at work, exploring universes in a symphony of numbers.&lt;br /&gt;
:White Hat (thinking): If only I had studied math, I could appreciate the beauty on display here.&lt;br /&gt;
&lt;br /&gt;
:Cueball (thinking): Oh no. This has '''''two''''' unknowns. That's gonna be really hard.&lt;br /&gt;
:Cueball (thinking): Ughhhhhhh.&lt;br /&gt;
:Cueball (thinking): '''''Think.''''' There's gotta be a way to avoid doing all that work...&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring White Hat]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Physics]]&lt;br /&gt;
[[Category:Math]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2207:_Math_Work&amp;diff=180476</id>
		<title>2207: Math Work</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2207:_Math_Work&amp;diff=180476"/>
				<updated>2019-09-26T14:00:24Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2207&lt;br /&gt;
| date      = September 25, 2019&lt;br /&gt;
| title     = Math Work&lt;br /&gt;
| image     = math_work.png&lt;br /&gt;
| titletext = I could type this into a solver, which MIGHT help, but would also mean I have to get a lot of parentheses right...&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by TWO UNKNOWNS. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
[[White Hat]] is observing a physicist, [[Cueball]], who is staring at some equations and diagrams on a  chalkboard. White Hat is neither a physicist nor a mathematician, and seems to glorify those professions. He wishes he understood Cueball's work and &amp;quot;the beauty on display here&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
The joke is that Cueball, the actual physicist, is not focused at all on the beauty on display, but is instead frustrated with the math in his formulation and just wishes to avoid work in solving his equations. Cueball is annoyed that his equation has two unknowns, which greatly complicates the math he must do. Typically in physics, it is much much easier to solve problems for a single unknown variable, with the work becoming exponentially harder with each new added unrelated unknown. A common tactic used to approach such problems is to find a way to separate the two variables and Cueball is shown to be struggling to find such a shortcut.&lt;br /&gt;
&lt;br /&gt;
The title text continues Cueball's thought process, with the possibility of using an equation solver to solve the equations. An equation solver or {{w|computer algebra system}} is a computer program which can be used to solve equations or systems of equations, and is typically not an especially beautiful way to address mathematical problems. Cueball would need to make sure that the equations are entered correctly, with parentheses in the correct places, when inputting them into the solver; again this is an issue far removed from the {{w|mathematical beauty|beauty of mathematics}} and physics.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
&lt;br /&gt;
:[Cueball stands in front of a blackboard full of formulas and diagrams. White Hat is watching him from a couple meters away.]&lt;br /&gt;
&lt;br /&gt;
:White Hat (thinking): Amazing watching a physicist at work, exploring universes in a symphony of numbers.&lt;br /&gt;
:White Hat (thinking): If only I had studied math, I could appreciate the beauty on display here.&lt;br /&gt;
&lt;br /&gt;
:Cueball (thinking): Oh no. This has '''''two''''' unknowns. That's gonna be really hard.&lt;br /&gt;
:Cueball (thinking): Ughhhhhhh.&lt;br /&gt;
:Cueball (thinking): '''''Think.''''' There's gotta be a way to avoid doing all that work...&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring White Hat]]&lt;br /&gt;
[[Category:Physics]]&lt;br /&gt;
[[Category:Math]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2198:_Throw&amp;diff=179142</id>
		<title>2198: Throw</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2198:_Throw&amp;diff=179142"/>
				<updated>2019-09-04T12:39:46Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2198&lt;br /&gt;
| date      = September 3, 2019&lt;br /&gt;
| title     = Throw&lt;br /&gt;
| image     = throw.png&lt;br /&gt;
| titletext = The keys to successfully throwing a party are location, planning, and one of those aircraft carrier steam catapults.&lt;br /&gt;
}}&lt;br /&gt;
*To experience the interactivity of this game, visit the {{xkcd|2198|original comic}}.&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by Thor, God of Thunder. Table for all combinations should be made, maybe with clear marking of those that cannot be thrown. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This is an interactive comic made to celebrate the release of [[Randall|Randall's]] new book, ''[[How To]]''. The comic is based on a chapter in the book. &lt;br /&gt;
&lt;br /&gt;
As the comic celebrates the book, which was released on Tuesday, September 3rd, 2019, the comic was thus also released on a [[:Category:Tuesday comics|Tuesday]] to coincide with the release day and probably replacing that week's normal Wednesday release. This was the same timing used for another of Randall's book releases, when [[1608: Hoverboard]] came out on the Tuesday when [[Thing Explainer]] came out. Although the Hoverboard comic is much more complex than this one, they are both [[:Category:Dynamic comics|dynamic]] and [[:Category:Interactive comics|interactive]], with [[:Category:Comics with animation|animations]] a part of them.&lt;br /&gt;
&lt;br /&gt;
In this comic the viewer can select a person/{{w|Pikachu}}/god/squirrel as the thrower and an object (including a person, Pikachu, or squirrel) to be thrown, and get an animation of how the selected throw would work out, along with an estimated distance of the throw (both in SI units and in other very arbitrary units; see [[#Table of distance units|table]] below) if the throw was possible. Impossible throws include ones in which the thrower is smaller than the thrown object. The formula/guideline is apparently based on a chapter from the book. One special case to the calculations is Thor's hammer, which is enchanted such that only those deemed &amp;quot;worthy&amp;quot; are able to lift it. As such, despite its mass being liftable by many of the characters, only Thor, God of Thunder (who is canonically worthy), and self-created characters who are well over the human records for height ({{w|List of tallest people|272 cm}}) and/or weight ({{w|List of heaviest people|635 kg}}) are shown to actually be able to throw it. Also Thor is the only one who uses {{w|furlongs}} to measure his distances.&lt;br /&gt;
&lt;br /&gt;
There are 7 throwers + 1 open option and 15 + 1 things to throw, giving a total of 105 different combinations for the static elements; see the [[#Table of throw distances|table]] below plus those for the open option. The open option can be defined by height, weight and a 1-4 scale of atleticism. But only Thor (or an unrealistically tall and heavy custom character) can throw all 15, with three of the objects (George Washington, hammer, and car) unthrowable by any of the other premade characters. The smaller critters can throw only a few things, so the total number of throws is much less than 100. Still there is an animation for all 105 combinations, but with no throw distance for some. An object with negative weight (you probably) flies backwards.&lt;br /&gt;
&lt;br /&gt;
The athleticism scale does not define the character used for the animation.&lt;br /&gt;
&lt;br /&gt;
The title text refers to throwing a party (a colloquial synonym of hosting a party) and first makes the assumption of actually giving hints for giving a party, and then switching to suggest a mechanism to literally throw a huge object, such as a house with a party going on inside. An {{w|Aircraft_catapult#Steam_catapult|aircraft steam catapult}} is a mechanism to launch aircraft from ships, typically used on aircraft carriers.&lt;br /&gt;
&lt;br /&gt;
==Throwers and throw items==&lt;br /&gt;
George Washington, Pikachu, and a squirrel are both throwers and throw items.&lt;br /&gt;
&lt;br /&gt;
* '''An NFL {{w|quarterback}}''' is the average American's perception of a highly athletic individual; gridiron football is a full-contact sport that requires durability, speed, and precision.&lt;br /&gt;
* '''{{w|George Washington}}''' was the first president of the United States of America. Although seen as a capable leader, there is nothing {{Citation needed}} to indicate that he was an exceptional thrower. He is also used as a throwing item to represent the likelihood of a thrower distance with an average human as the projectile.&lt;br /&gt;
* '''{{w|Pikachu}}''' is a species of Pokémon, and the mascot of the Pokémon franchise as a whole. Although Pikachu are not normally shown to throw things, the ''Super Smash Bros'' series shows they are perfectly capable of picking things up that do not significantly out-size them. That said, Pikachu is capable of throwing a wide variety of objects through the move Fling, which allows the user to deal damage by throwing it's held item (and, incidentally, a Fling TM). Its presence as a throwing item appears to reference the most recently released Pokémon games as of the comic's release, ''Pokémon Let's Go Pikachu'' and ''Pokémon Let's Go Eevee'', where the partner Pokémon of the respective title is not kept in a Poké Ball but thrown into battle when deployed.&lt;br /&gt;
** According to Pokédex entries throughout the series, the average Pikachu is 1'04&amp;quot; (0.4m) tall and weighs 13.2 lbs (6kg). Randall appears to have done his research, as a custom thrower with these stats and default athleticism will have near-identical results to Pikachu for both thrower and thrown item.&lt;br /&gt;
* '''{{w|Carly Rae Jepsen}}''' is a Canadian music artist.&lt;br /&gt;
* '''{{w|Thor}}''' is the god of thunder in Norse mythology, wielding a hammer that returns to its wielder when thrown. He is also {{w|Thor (Marvel Comics)|featured in Marvel comics}}, and is portrayed by Chris Hemsworth (listed below) in the Marvel Cinematic Universe series of films. Thor was previously referenced in [[2097: Thor Tools]].&lt;br /&gt;
* '''{{w|Chris Hemsworth}}''' is an Australian film actor, best known for his role as Thor in the Marvel Cinematic Universe.&lt;br /&gt;
* '''A {{w|squirrel}}''' is a small mammal of the family ''Sciuradae'', known for hoarding acorns. Squirrels have been a [[:Category:Squirrels|recurring topic]] on xkcd, and have been used in ''What if?'' in lieu of a subject that Randall really doesn't want to draw. Due to their small size, a squirrel is also selectable as a throwing item.&lt;br /&gt;
* '''You''' (the viewer) may also choose to create a custom thrower, inputting name, height, weight, and general level of athleticism, as measured on a scale from &amp;quot;[[Black Hat]]&amp;quot; to &amp;quot;championship athlete&amp;quot; (a swimmer is pictured). The custom thrower is also selectable as a throwing item, presumably to provide more variety compared to the fixed values of George Washington.&lt;br /&gt;
* '''A {{w|microwave oven}}''' is a common household appliance in most American homes, used to heat or reheat food for consumption.&lt;br /&gt;
* '''A basketball''' is an inflated sphere used as a projectile in the sport of the same name.&lt;br /&gt;
* '''A {{w|blender}}''' is a common household appliance in most American homes, used to shred food or ingredients into a slush for consumption or baking.&lt;br /&gt;
* '''A {{w|gold bar}}''' is the form in which gold is cast for storage.&lt;br /&gt;
* '''A {{w|wedding cake}}''' is traditionally a layer cake used for wedding receptions with copious amounts of frosting and figurines of the bride and groom standing upon the top layer. The figurines appear to have been removed before the cake is thrown, as they are before the cake is cut and served.&lt;br /&gt;
* '''A {{w|ping pong ball}}''' is a small sphere designed to bounce, used as a projectile in the sport of table tennis or &amp;quot;ping pong&amp;quot;.&lt;br /&gt;
* '''An acorn''' is a small nut which serves as a squirrel's primary form of nourishment.&lt;br /&gt;
* '''Thor's hammer''' refers to {{w|Mjolnir (comics)|Mjolnir}}, an enchanted hammer in Marvel comics which can only be lifted, much less thrown, by those deemed worthy. In this case it appears to simply be incredibly heavy, though this is more to allow the custom thrower to make use of it instead of any sort of commentary on canonicity.&lt;br /&gt;
* '''A javelin''' is an aerodynamic polearm thrown in Olympic sport.&lt;br /&gt;
* '''A {{w|Dollar coin (United States)|silver dollar}}''' is a silver coin representing one (1) US dollar in value. The coin is given two trajectories to choose from when thrown; '''spinning''', as one would properly throw a discus, and '''tumbling''', as might result from flipping a coin to make a decision.&lt;br /&gt;
* '''A car''' is the most common form of long-distance transport in several well-developed countries.&lt;br /&gt;
&lt;br /&gt;
==Table of throw distances==&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
!Item&amp;amp;nbsp;/&amp;amp;nbsp;Thrower&lt;br /&gt;
!NFL&amp;amp;nbsp;Quarterback&lt;br /&gt;
!George&amp;amp;nbsp;Washington&lt;br /&gt;
!Pikachu&lt;br /&gt;
!Carly&amp;amp;nbsp;Rae&amp;amp;nbsp;Jepsen&lt;br /&gt;
!Thor&lt;br /&gt;
!Chris&amp;amp;nbsp;Hemsworth&lt;br /&gt;
!Squirrel&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|'''Microwave oven'''&lt;br /&gt;
|10.32 m&lt;br /&gt;
|7.76 m&lt;br /&gt;
|N/A&lt;br /&gt;
|3.67 m&lt;br /&gt;
|181.57 m&lt;br /&gt;
|6.15 m&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|33.85 feet&lt;br /&gt;
|25.46 feet&lt;br /&gt;
|N/A&lt;br /&gt;
|82.65 rack units&lt;br /&gt;
|1.99 football fields&lt;br /&gt;
|138.40 rack units&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|'''Basketball'''&lt;br /&gt;
|40.18 m&lt;br /&gt;
|33.22 m&lt;br /&gt;
|2.34 m&lt;br /&gt;
|19.11 m&lt;br /&gt;
|113.67 m&lt;br /&gt;
|27.99 m&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|16.74 horses&lt;br /&gt;
|19.54 smoots&lt;br /&gt;
|75.90 attoparsecs&lt;br /&gt;
|11.24 smoots&lt;br /&gt;
|1.42 Manhattan blocks&lt;br /&gt;
|16.46 smoots&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|'''Blender'''&lt;br /&gt;
|16.58 m&lt;br /&gt;
|12.45 m&lt;br /&gt;
|N/A&lt;br /&gt;
|5.89 m&lt;br /&gt;
|333.25 m&lt;br /&gt;
|9.86 m&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|9.75 smoots&lt;br /&gt;
|40.85 feet&lt;br /&gt;
|N/A&lt;br /&gt;
|132.51 rack units&lt;br /&gt;
|1.66 furlongs&lt;br /&gt;
|32.34 feet&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|'''Gold bar'''&lt;br /&gt;
|9.73 m&lt;br /&gt;
|7.23 m&lt;br /&gt;
|N/A&lt;br /&gt;
|3.36 m&lt;br /&gt;
|549.28 m&lt;br /&gt;
|5.69 m&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|31.93 feet&lt;br /&gt;
|23.73 feet&lt;br /&gt;
|N/A&lt;br /&gt;
|75.65 rack units&lt;br /&gt;
|2.73 furlongs&lt;br /&gt;
|128.11 rack units&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|'''Wedding cake'''&lt;br /&gt;
|8.96 m&lt;br /&gt;
|6.75 m&lt;br /&gt;
|N/A&lt;br /&gt;
|3.2 m&lt;br /&gt;
|146.25 m&lt;br /&gt;
|5.35 m&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|29.40 feet&lt;br /&gt;
|22.14 feet&lt;br /&gt;
|N/A&lt;br /&gt;
|72.00 rack units&lt;br /&gt;
|1.60 football fields&lt;br /&gt;
|120.45 rack units&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|'''Ping-pong ball'''&lt;br /&gt;
|11.8 m&lt;br /&gt;
|11.63 m&lt;br /&gt;
|9.28 m&lt;br /&gt;
|11.25 m&lt;br /&gt;
|12.53 m&lt;br /&gt;
|11.41 m&lt;br /&gt;
|4.95 m&lt;br /&gt;
|-&lt;br /&gt;
|38.72 feet&lt;br /&gt;
|38.17 feet&lt;br /&gt;
|30.46 feet&lt;br /&gt;
|36.92 feet&lt;br /&gt;
|41.10 feet&lt;br /&gt;
|37.44 feet&lt;br /&gt;
|111.37 rack units&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|'''Acorn'''&lt;br /&gt;
|83.00 m&lt;br /&gt;
|75.84 m&lt;br /&gt;
|28.16 m&lt;br /&gt;
|62.85 m&lt;br /&gt;
|135.98 m&lt;br /&gt;
|67.91 m&lt;br /&gt;
|6.53 m&lt;br /&gt;
|-&lt;br /&gt;
|1.04 Manhattan blocks&lt;br /&gt;
|0.95 Manhattan blocks&lt;br /&gt;
|16.57 smoots&lt;br /&gt;
|26.19 horses&lt;br /&gt;
|1.49 football fields&lt;br /&gt;
|28.30 horses&lt;br /&gt;
|146.85 rack units&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|'''Thor's Hammer'''&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|19.32 m&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|11.36 smoots&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|'''Javelin'''&lt;br /&gt;
|56.10 m&lt;br /&gt;
|42.04 m&lt;br /&gt;
|N/A&lt;br /&gt;
|20.12 m&lt;br /&gt;
|3028.75 m&lt;br /&gt;
|33.09 m&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|23.37 horses&lt;br /&gt;
|17.51 horses&lt;br /&gt;
|N/A&lt;br /&gt;
|11.84 smoots&lt;br /&gt;
|15.06 furlongs&lt;br /&gt;
|19.46 smoots&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|'''George Washington'''&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|136.65 m&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|1.49 football fields&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|'''Pikachu'''&lt;br /&gt;
|15.22 m&lt;br /&gt;
|11.41&lt;br /&gt;
|N/A&lt;br /&gt;
|5.39 m&lt;br /&gt;
|332.52 m&lt;br /&gt;
|9.03 m&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|49.94 feet&lt;br /&gt;
|37.45 feet&lt;br /&gt;
|N/A&lt;br /&gt;
|121.18 rack units&lt;br /&gt;
|1.65 furlongs&lt;br /&gt;
|29.63 feet&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|'''Car'''&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|27.22 m&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|16.01 smoots&lt;br /&gt;
|N/A&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|'''Spinning dollar'''&lt;br /&gt;
|177.09 m&lt;br /&gt;
|143.96 m&lt;br /&gt;
|16.91&lt;br /&gt;
|92.63 m&lt;br /&gt;
|1331.21 m&lt;br /&gt;
|115.89 m&lt;br /&gt;
|2.20 m&lt;br /&gt;
|-&lt;br /&gt;
|1.94 football fields&lt;br /&gt;
|1.57 football fields&lt;br /&gt;
|9.95 smoots&lt;br /&gt;
|1.16 Manhattan blocks&lt;br /&gt;
|6.53 furlongs&lt;br /&gt;
|1.45 Manhattan blocks&lt;br /&gt;
|71.41 attoparsecs&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|'''Tumbling dollar'''&lt;br /&gt;
|58.17 m&lt;br /&gt;
|53.77 m&lt;br /&gt;
|13.92 m&lt;br /&gt;
|44.08 m&lt;br /&gt;
|84.82 m&lt;br /&gt;
|49.03 m&lt;br /&gt;
|2.14 m&lt;br /&gt;
|-&lt;br /&gt;
|24.24 horses&lt;br /&gt;
|22.41 horses&lt;br /&gt;
|45.67 feet&lt;br /&gt;
|18.37 horses&lt;br /&gt;
|1.06 Manhattan blocks&lt;br /&gt;
|20.43 horses&lt;br /&gt;
|69.42 attoparsecs&lt;br /&gt;
|-&lt;br /&gt;
|rowspan=&amp;quot;2&amp;quot;|'''Squirrel'''&lt;br /&gt;
|58.64 m&lt;br /&gt;
|46.92 m&lt;br /&gt;
|2.92 m&lt;br /&gt;
|25.44 m&lt;br /&gt;
|256.54 m&lt;br /&gt;
|38.50 m&lt;br /&gt;
|N/A&lt;br /&gt;
|-&lt;br /&gt;
|24.43 horses&lt;br /&gt;
|19.55 horses&lt;br /&gt;
|65.71 rack units&lt;br /&gt;
|14.97 smoots&lt;br /&gt;
|1.28 furlongs&lt;br /&gt;
|16.04 horses&lt;br /&gt;
|N/A&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Table of distance units==&lt;br /&gt;
*Table of other distance-units and their length in meters:&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
!Unit name&lt;br /&gt;
!Length in comic&lt;br /&gt;
!Explanation&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Foot (unit)|Feet}}&lt;br /&gt;
|0.3048 m&lt;br /&gt;
|One foot is defined as 0.3048 meter.  In customary and imperial units, the foot comprises 12 inches and three feet compose a yard. &lt;br /&gt;
|-&lt;br /&gt;
|{{w|Rack units}}&lt;br /&gt;
|0.4445 m&lt;br /&gt;
|A rack unit (abbreviated U or RU) is a unit of measure defined as 1 3⁄4 inches (44.45 mm). Mainly used to measure the overall height of the likes of {{w|19-inch rack}} frames or the equipment put in there.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|American football field|Football fields}}&lt;br /&gt;
|91.44 m&lt;br /&gt;
|An American Football field is 100 yards or 91.44 m long.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Horses}}&lt;br /&gt;
|2.4 m&lt;br /&gt;
|The length of a horse varies a lot with the horse type, breed, age and genes. In the Wikipedia article on horses the length of a horse is not even mentioned, only the height and weight. But Randall has used horses for measurements before. A {{w|horse length}} is approximately 8 feet (2.4 m).&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Smoots}}&lt;br /&gt;
|1.7000 m&lt;br /&gt;
|The smoot is a nonstandard, humorous unit of length created as part of an MIT fraternity prank. One smoot is equal to Oliver Smoot's height at the time of the prank, 5 feet 7 inches (1.70 m). Mr. Smoot was used to measure the length of a bridge by being repeatedly laid down along the length of the bridge; the markings indicating distances in smoots along the bridge have been maintained by the fraternity.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Furlongs}}&lt;br /&gt;
|201.168 m&lt;br /&gt;
|A furlong is a measure of distance in imperial units and U.S. customary units equal to one eighth of a mile. It should thus give that one furlong is 201.168 metres. However, the United States does not uniformly use this conversion ratio. Older ratios are in use for surveying purposes in some states. Only Thor's distances are given in furlongs.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Manhattan}}-{{w|City block|blocks}}&lt;br /&gt;
|80.0 m&lt;br /&gt;
|The numbered streets in Manhattan run east-west, and are generally 60 feet (18 m) wide, with about 200 feet (61 m) between each pair of streets. With each combined street and block adding up to about 260 feet (79 m), there are almost exactly 20 blocks per mile. The typical block in Manhattan is 250 by 600 feet (76 by 183 m). When driving in a grid like city the {{w|Manhattan distance}} between two points is a concept, although it is also called {{w|Taxicab geometry}}. It seems like it is indeed the combined street and block distance. Also there is an error. The number has been found by taking four numbers not three, but then leaving out George Washington's distance which would give a block length of only 72,05 m.&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Atto-}}{{w|parsecs}}&lt;br /&gt;
|0.03086 m&lt;br /&gt;
|The parsec is a unit of length used to measure large distances to astronomical objects outside the Solar System. A parsec is defined as the distance at which one {{w|astronomical unit}} subtends an angle of one {{w|arcsecond}}. One parsec is equal to about 3.26 light-years or 31 trillion kilometers (31×10&amp;lt;sup&amp;gt;12&amp;lt;/sup&amp;gt; km) or 19 trillion miles (19×10&amp;lt;sup&amp;gt;12&amp;lt;/sup&amp;gt; mi). Atto- is a unit prefix in the metric system denoting a factor of 10&amp;lt;sup&amp;gt;−18&amp;lt;/sup&amp;gt; or 0.000000000000000001. Together the two unit exponents will almost cancel out, as 31 trillion kilometers can be written as 3.1×10&amp;lt;sup&amp;gt;18&amp;lt;/sup&amp;gt;cm, meaning that an attoparsec is 3.1 cm. The unit is only used three times: once for Pikachu and twice for the squirrel.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[As this is an interactive comic, not all possible text should be given in this transcript. Also it is not possible to see all the different throwers or objects in one image. This transcript here includes only the text that can be found when loading the page, without changing the thrower or object (the default), but also includes the text that can be found by scrolling in the two select &amp;quot;windows&amp;quot; as that would be similar to a long comic where you need to scroll. For further differences that occur by changing the objects refer to a table of all combinations.]&lt;br /&gt;
&lt;br /&gt;
:[A heading with a subheading is above a line, beneath which are a sentence, that is generated by the selections in the two windows beneath this sentence:]&lt;br /&gt;
:&amp;lt;big&amp;gt;'''Throw Calculator'''&amp;lt;/big&amp;gt;&lt;br /&gt;
:This calculator implements the approximate throwing distance estimation model from ''How To'' Chapter 10: ''How to throw things''.&lt;br /&gt;
&lt;br /&gt;
:How far could George Washington throw a Microwave oven?&lt;br /&gt;
&lt;br /&gt;
:[Beneath this sentence are two &amp;quot;windows&amp;quot; with a frame around them, one to the left and one to the right, each with a heading breaking the top frame. Each also has a scroll bar to the right, which allows one to scroll down through 7 different possible selections in the left window and 15 in the right window. There are two selections on each line, leaving one alone at the bottom left of each list as there are uneven numbers in both lists. Here below each windows' content is given under their respective headings. Each possible selection is a drawing with a caption beneath it.]&lt;br /&gt;
:Select a thrower&lt;br /&gt;
&lt;br /&gt;
:*You&lt;br /&gt;
:*An NFL Quarterback&lt;br /&gt;
:*George Washington&lt;br /&gt;
:*Pikachu&lt;br /&gt;
:*Carly Rae Jepsen&lt;br /&gt;
:*Thor, God of Thunder&lt;br /&gt;
:*Chris Hemsworth&lt;br /&gt;
:*A squirrel&lt;br /&gt;
&lt;br /&gt;
:Select an object to be thrown&lt;br /&gt;
:*You&lt;br /&gt;
:*A microwave oven&lt;br /&gt;
:*A basketball&lt;br /&gt;
:*A blender&lt;br /&gt;
:*A gold bar&lt;br /&gt;
:*A wedding cake&lt;br /&gt;
:*A ping-pong ball&lt;br /&gt;
:*An acorn&lt;br /&gt;
:*Thor's Hammer&lt;br /&gt;
:*A javelin&lt;br /&gt;
:*George Washington&lt;br /&gt;
:*Pikachu&lt;br /&gt;
:*A car&lt;br /&gt;
:*A silver dollar (spinning)&lt;br /&gt;
:*A silver dollar (tumbling)&lt;br /&gt;
:*A squirrel&lt;br /&gt;
&lt;br /&gt;
:[Below the two windows is the result of the animation that will happen when a selection has been made. An animation of the selected thrower throwing (or failing to throw) the selected object is shown, and the object's traveling distance is measured out both in meters (SI units) and in some other unit in brackets below. If the distance is not too long compared to the size of the object and thrower, then both can be seen, and in case the object is soft it may break from the throw.]&lt;br /&gt;
&lt;br /&gt;
:[In the pre-selected version George Washington throws a microwave oven, which ends up several meters from him lying on a corner broken with its wire lying beneath it. The distance is given under the ruler along which the throw has occurred, with markings for approximately every meter. In this case there are seven steps even though the distance is above 7 meters:]&lt;br /&gt;
:7.76 meters&lt;br /&gt;
:(25.46 feet)&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
*The comic refers to Thor as the character from the Marvel comics and movies (and other media), who is himself a reference to the ancient Norse god.  In Marvel Cinematic Universe movies, Thor is played by Chris Hemsworth.&lt;br /&gt;
*Thor's hammer, Mjölnir, bears an enchantment that prevents any living being from lifting it unless they are &amp;quot;worthy.&amp;quot; This is reflected in the simulation by giving Mjölnir a mass of 2,000 kg.&lt;br /&gt;
**Technically, Thor's hammer weighs [https://urbandud.files.wordpress.com/2011/08/detail-128-thors-hammer.jpg?w=550 42.3 pounds].&lt;br /&gt;
*The option to customize your own character was added to the comic later.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics with animation]] &amp;lt;!-- Different throws --&amp;gt;&lt;br /&gt;
[[Category:Dynamic comics]] &lt;br /&gt;
[[Category:Interactive comics]]&lt;br /&gt;
[[Category:Physics]] &amp;lt;!-- model of throw distance --&amp;gt;&lt;br /&gt;
[[Category:American football]]  &amp;lt;!-- NFL quaterback --&amp;gt;&lt;br /&gt;
[[Category:Comics featuring politicians]]   &amp;lt;!-- George Washington --&amp;gt;&lt;br /&gt;
[[Category:Pokémon]]&lt;br /&gt;
[[Category:Comics featuring real people]] &amp;lt;!-- Carly Rae Jepsen, George Washington and Chris Hemsworth--&amp;gt;&lt;br /&gt;
[[Category:Religion]] &amp;lt;!-- Thor, questionable though as it is obviously the Marvel character --&amp;gt;&lt;br /&gt;
[[Category:Squirrels]]&lt;br /&gt;
[[Category:Food]] &amp;lt;!-- Microwave oven Blender, cake --&amp;gt;&lt;br /&gt;
[[Category:Basketball]]&lt;br /&gt;
[[Category:Sport]] &amp;lt;!-- ping pong, javelin --&amp;gt;&lt;br /&gt;
[[Category:Book promotion]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2168:_Reading_in_the_Original&amp;diff=175749</id>
		<title>2168: Reading in the Original</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2168:_Reading_in_the_Original&amp;diff=175749"/>
				<updated>2019-06-26T14:35:59Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2168&lt;br /&gt;
| date      = June 26, 2019&lt;br /&gt;
| title     = Reading in the Original&lt;br /&gt;
| image     = reading_in_the_original.png&lt;br /&gt;
| titletext = The articles are much shorter, but I assume that's because this version predates the merger with the Hawaiian text that created the modern Hawaiian-Greek hybrid wiki-pedia.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a HAWAIIAN-GREEK HYBRID. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
The comic is in a sense a ethomology joke, as the word encyclopedia comes from Greek, hence Greek being the 'original' language in this case. Wiki is a Hawaiian word, hence the Hawaiian-greek hybrid.&lt;br /&gt;
&lt;br /&gt;
Many people, among which many snobs, feel that Studying old texts in the original language is more valuable than studying them in modern translation, based on a variety of assumptions about the person reading the original language having a better grip on it than whoever wrote the translation, about the translation potentially having an agenda, etc.&lt;br /&gt;
&lt;br /&gt;
Cueball's statement is based on his purported belief that Wikipedia was originally written entirely in Greek.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Cueball is addressing Megan. He is holding a hand with a thumb up out toward her. Megan is spreading her arms out as she replies.]&lt;br /&gt;
:Cueball: It's in the &amp;quot;Languages&amp;quot; box in the lower left. It took a while to learn, but I find I get so much more out of it by reading it as it was '''''intended'''''.&lt;br /&gt;
:Megan: That's not how that works!&lt;br /&gt;
&lt;br /&gt;
:[Caption below the panel:]&lt;br /&gt;
:People get mad when I tell them I only read Wikipedia in the original Greek.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Language]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2161:_An_Apple_a_Day&amp;diff=175113</id>
		<title>2161: An Apple a Day</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2161:_An_Apple_a_Day&amp;diff=175113"/>
				<updated>2019-06-10T20:12:10Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: bacterium is singular of bacteria&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2161&lt;br /&gt;
| date      = June 10, 2019&lt;br /&gt;
| title     = An Apple a Day&lt;br /&gt;
| image     = an_apple_a_day.png&lt;br /&gt;
| titletext = Even the powerful, tart Granny Smith cultivar is proving ineffective against new Gran-negative doctors.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a GRAN-NEGATIVE APPLE-RESISTANT DOCTOR. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&amp;quot;{{w|An apple a day keeps the doctor away}}&amp;quot; is a common English proverb. It suggests that eating one apple daily will keep you healthy, and therefore, reduce your necessity to go to the doctor. &lt;br /&gt;
&lt;br /&gt;
However, in this comic, this expression is reinterpreted to mean that apples are to doctors what antibiotics are to bacteria. It also suggests that keeping doctors away is of great importance, presumably because doctors in this scenario are threatening.&lt;br /&gt;
&lt;br /&gt;
Next, when the comic says that some doctors are resistant to apples, this references situations where creatures can adapt to deal with threats. In this case, the comic advocates only using the 'finest' apples in case all others prove unsuccessful (a reference to multidrug-resistant pathogens, where some antibiotics are only used as a last-resort)&lt;br /&gt;
&lt;br /&gt;
Additionally, this comic is a clear reference to the overuse of antibiotics in modern medicine, leading to an increase in {{w|antimicrobial resistance}} (&amp;quot;Superbugs&amp;quot;), which has seen increasing awareness in the last few years. The World Health Organization had the first [https://antibioticawareness.ca Antibiotic Awareness Week] in 2015, where a talk similar to the one in the comic would seem very appropriate.&lt;br /&gt;
&lt;br /&gt;
In the title text this is taken further: Gran-negative is a pun on {{w|Gram-negative}}, a type of bacterium. A well-known technique called {{w|Gram staining}} distinguishes two types of bacteria (Gram positive versus Gram negative) on the basis of properties of their cell walls. &lt;br /&gt;
&lt;br /&gt;
Mentioned in the comic and title text, {{w|Honeycrisp}} and {{w|Granny Smith}} are two different cultivars of apples. Granny Smith apples are a sour green apple, which have mixed feelings among apple eaters. Conversely, Honeycrisp is considered &amp;quot;an ideal apple for eating raw&amp;quot;, and is the state fruit of Minnesota.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
:[Megan stands at a podium.]&lt;br /&gt;
:Megan: An apple a day keeps the doctor away.&lt;br /&gt;
:Megan: Or at least, it used to.&lt;br /&gt;
&lt;br /&gt;
:[The comic zooms out on the stage. Megan is pointing at a poster prominently featuring Doctor Ponytail and three apples.]&lt;br /&gt;
:Megan: Over time, some doctors have developed a resistance to apples. Keeping them away takes two or three apples instead of one.&lt;br /&gt;
:Megan: And there are worrying signs that a few doctors have become completely immune.&lt;br /&gt;
&lt;br /&gt;
:[The comic zooms in again on Megan and her podium.]&lt;br /&gt;
:Megan: So we must stockpile our finest apples in reserve, using them to fend off only the very worst doctors.&lt;br /&gt;
:Megan: Honeycrisps still work on most of them, but we don't know for how long.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Biology]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2161:_An_Apple_a_Day&amp;diff=175101</id>
		<title>2161: An Apple a Day</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2161:_An_Apple_a_Day&amp;diff=175101"/>
				<updated>2019-06-10T18:11:17Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2161&lt;br /&gt;
| date      = June 10, 2019&lt;br /&gt;
| title     = An Apple a Day&lt;br /&gt;
| image     = an_apple_a_day.png&lt;br /&gt;
| titletext = Even the powerful, tart Granny Smith cultivar is proving ineffective against new Gran-negative doctors.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by an APPLE-RESISTANT DOCTOR. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&amp;quot;An apple a day keeps the doctor away&amp;quot; is a common expression. It suggests that eating one apple daily will keep you healthy, and, therefore, reduce your necessity to go to the doctor. However, in this comic, this expression is reinterpreted to mean that the reason an apple a day keeps a doctor away is because apples literally prevent doctors from coming. It also suggests that keeping doctors away is of great importance, presumably because doctors in this scenario are threatening.&lt;br /&gt;
&lt;br /&gt;
Next, when the comic says that some doctors are resistant to apples, this references situations where creatures can adapt to deal with threats. In this case, the comic advocates stockpiling apples to prepare a strategic assault on the doctors who adapted. &lt;br /&gt;
&lt;br /&gt;
Additionally, this comic is a clear reference to the overuse of antibiotics in modern medicine, leading to an increase in antimicrobial resistance (&amp;quot;Superbugs&amp;quot;), which has seen increasing awareness in the last few years. The World Health Organisation had the first [https://antibioticawareness.ca Antibiotic Awareness Week] in 2015, where a talk similar to the one in the comic would seem very appropriate.&lt;br /&gt;
&lt;br /&gt;
In the title text this is taken further: Gran-negative is a pun on Gram-negative: Coloring a well-known technique called Gram staining distinguishes two types of bacteria (Gram positive versus Gram negative) on the basis of properties of their cell walls.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
:[Megan stands at a podium.]&lt;br /&gt;
:Megan: An apple a day keeps the doctor away.&lt;br /&gt;
:Or at least, it used to.&lt;br /&gt;
&lt;br /&gt;
:[The comic zooms out on the stage. Megan is pointing at a poster promimently featuring Doctor Ponytail and three apples.]&lt;br /&gt;
:Megan: Over time, some doctors have developed a resistance to apples. Keeping them away takes two or three apples instead of one.&lt;br /&gt;
:And there are worrying signs that a few doctors have become completely immune.&lt;br /&gt;
&lt;br /&gt;
:[The comic zooms in again on Megan and her podium.]&lt;br /&gt;
:So we must stockpile our finest apples in reserve, using them to fend off only the very worst doctors.&lt;br /&gt;
:Honeycrisps still work on most of them, but we don't know for how long.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2157:_Diploma_Legal_Notes&amp;diff=174806</id>
		<title>2157: Diploma Legal Notes</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2157:_Diploma_Legal_Notes&amp;diff=174806"/>
				<updated>2019-06-01T12:20:13Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2157&lt;br /&gt;
| date      = May 31, 2019&lt;br /&gt;
| title     = Diploma Legal Notes&lt;br /&gt;
| image     = diploma_legal_notes.png&lt;br /&gt;
| titletext = If you're planning to challenge the royal family, you should probably wait 6-8 weeks, since a number of the younger ones have diplomas and Kate was actually on the varsity lightsaber team at St Andrews.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a CHALLENGER TO THE BRITISH THRONE with a working light-sabre, who thinks the layout is very ugly of this explanation. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
A class of 2019 graduate, presumably for some college or university, is given some rather unusual privileges for graduating.&lt;br /&gt;
&lt;br /&gt;
A common line in degree granting ceremonies is &amp;quot;the degree of X is conferred with all the rights and privileges pertaining thereto.&amp;quot; This dates from the Roman Empire and continued through the rise of the university as an institution in medieval times. In the Roman era, the rights and privileges accorded to physicians and scholars included exemption from certain civic duties and military services, immunity from certain levies and from being summoned to court unduly, and even granting a state salary. In the medieval era, rights generally mirrored those of ecclesiastical figures and included immunity from civil law (instead scholars were subject to canon, or church law), as well as safe conduct on their travels between jurisdictions.&lt;br /&gt;
&lt;br /&gt;
While true that some degrees do grant professional privileges today, generally additional accreditation beyond the degree is required (passing the bar, medical certification, etc.) to gain anything most people would consider a privilege or right or incur any obligation. (The obligation to pay your student loans back exists regardless of completing your degree).&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
:* You may now legally perform marriages and arrest people.&lt;br /&gt;
&lt;br /&gt;
Depending on the jurisdiction, these may or may not be privileges that one already has by virtue of being in a particular jurisdiction or being part of a particular culture. &lt;br /&gt;
&lt;br /&gt;
In some cultures, a couple might be recognized as married if they meet certain conditions (as opposed to being legally recognized by a religious or civil authority), such as being recognized by the community or after the {{w|Inuit_women#Family_structure_and_marriage|birth of their first child}}. Because states often provide benefits (tax reductions, social services, etc) for being married, they often require that, in order to receive the benefits, that a marriage have a registered person recognize the marriage, which is likely the privilege that this graduating class' diploma is granting.&lt;br /&gt;
&lt;br /&gt;
In common law jurisdictions, {{w|Citizen's arrest|citizen's arrest}} is legal without a warrant in some situations, although in many cases, it is better to let a police officer arrest criminals due to potential legal and safety issues that might arise. The privilege granted by graduating might grant or extend this privilege, depending on where the graduating class is located.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
:* If you have your diploma with you, you can use grocery store express lanes with any number of items.&lt;br /&gt;
&lt;br /&gt;
It has become common for one, or maybe a [[1070|couple]], of checkout lanes of a larger store to be explicitly reserved for the use of those with &amp;quot;N items or fewer&amp;quot; in their combined purchase.  Theoretically, this lets someone with a single item, a few handheld geegaws or a light basket of produce to avoid being held behind the &amp;quot;Family Weekly Shop&amp;quot; couples at the undifferentiated exit aisles with overflowing shopping trolleys/carts.  A sufficiently under-filled or intrinsically low-capacity cart/trolley load may also qualify for the 'express' teller's services, depending upon the &amp;quot;N&amp;quot; specified, though it highly depends upon the general bulk and volume of goods involved and whether the various &amp;quot;three for the price of two&amp;quot; packs of boxed juice are ''each'' argued to quantify as three, two or just one item by company policy or (more seriously) the general muttered groundswell of fellow following &amp;quot;express&amp;quot; shoppers' opinions as to whether liberties may be being taken as you impede them in their own attempts to express themselves.&lt;br /&gt;
&lt;br /&gt;
Whether that's better for you if you qualify is [http://theintrepid.blogspot.com/2009/09/choosing-fastest-checkout-counter.html arguable] due to various complex factors, but at least the personal enumeration of shopping need not bother the new holder of the diploma (who is, ironically, now possibly fully capable of exerting authority on the &amp;quot;How many items are there, ''really'', in your allotted load?&amp;quot;, depending upon the academic subject just mastered) because the diploma obviously now nullifies ''that'' potential interdiction.  If you're a bulk-shopper during a period that happens to be particularly lacking sufficient small-fry purchasers to jam up the express-lane, you can now by-pass the backlogs of baseline buyers ponderously purchasing their plethora's of produce among the any-quantity aisles.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
:* All graduates are entitled to delete one word of their choice from the Oxford English Dictionary.&lt;br /&gt;
&lt;br /&gt;
The {{w|Oxford English Dictionary}} (OED) is the principal historical dictionary of the English language, published by Oxford University Press. Deleting words from the OED would amount to vandalism.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
:* The university will mail you your working lightsaber within 6-8 weeks.&lt;br /&gt;
Doctoral degree recipients wear various forms of dress or other items. In Finland, a doctoral sword is traditional.[https://www.jyu.fi/en/academic-events/degrees-ceremony/instructions/doctoral-hat-and-sword Doctoral hat and sword, university of Jyväskylä]  A {{w|lightsaber}} is a fictional weapon from the {{w|Star Wars}} universe. &amp;quot;6-8 weeks&amp;quot; is a [https://meta.stackexchange.com/a/19514/184432 meme made popular on Stack Overflow] meaning the person making the estimate has no idea how long it's going to actually take or whether it's actually even going to happen.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
:* You can send mail without stamps.&lt;br /&gt;
The {{w|Franking#Franking_privilege|franking privilege}} allows sending mail without stamps and is often granted to legislators conducting &amp;quot;official business.&amp;quot; A group of legislators elected at the same time may sometimes be referred to as the &amp;quot;class of ''year''&amp;quot; such as [https://www.nytimes.com/interactive/2018/11/28/us/politics/congress-freshman-class.html &amp;quot;the congressional freshman class of 2019...&amp;quot;]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
:* You have earned the right to challenge the British royal family to {{w|trial by combat}}. If you defeat them all, the throne is yours.&lt;br /&gt;
&amp;quot;Trial by combat&amp;quot; or &amp;quot;ritual combat&amp;quot; was a manner to settle disputes where two individuals would engage in a duel, with the winner being declared right. This type of ritual combat was depicted in the film ''{{w|Black Panther (film)|Black Panther}}'', with the winner of the combat declared the king of Wakanda. T'Challa, the Black Panther, was victorious in a fight against M'Baku, but was defeated by Erik Killmonger. &lt;br /&gt;
&lt;br /&gt;
The {{w|British royal family}} consists of the descendants and relatives of the current Queen, Queen Elizabeth II. However, {{w|Succession_to_the_British_throne|the line of succession}} to the throne consists of potentially over 4,000 individuals.  The British royal family was also referenced in [[2003: Presidential Succession]].&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
:* You may now ignore &amp;quot;Do Not Pet&amp;quot; warnings on airport security dogs.&lt;br /&gt;
You are now able to just go and pet the security dogs at airports. Given that these dogs are not meant for petting they could be aggressive. Also the security guards holding on to the dog may become aggressive if they feel you are impeding the dogs work. This is why it is usually best not to try petting these dogs. But with this degree it is supposedly no problem.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
:* Title text.&lt;br /&gt;
The title text builds on the items about lightsabers and the British royal family and advises that, because several of the younger royals also have diplomas, they have received their lightsaber already. Thus you should wait at least the 6-8 weeks until your lightsaber arrives to have a fair chance, given that lightsabers is a very lethal weapon. Also some of them may even be proficient with the weapon. Special mention goes to {{w|Catherine, Duchess of Cambridge}}, aka Kate Middleton, who was supposedly on the {{w|Varsity_team#Varsity_in_the_United_Kingdom|varsity}} lightsaber team at {{w|St Andrew's School, Pangbourne|St Andrews}}.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[An official document with a title at the top between two images of graduation hats on either side:]&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;big&amp;gt;Congratulations, Class of 2019!&amp;lt;/big&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Your diploma grants you many new powers and privileges. These include:&lt;br /&gt;
:* You may now legally perform marriages and arrest people.&lt;br /&gt;
:* If you have your diploma with you, you can use grocery store express lanes with any number of items.&lt;br /&gt;
:* All graduates are entitled to delete one word of their choice from the Oxford English Dictionary.&lt;br /&gt;
:* The university will mail you your working lightsaber within 6-8 weeks.&lt;br /&gt;
:* You can send mail without stamps.&lt;br /&gt;
:* You have earned the right to challenge the British royal family to trial by combat. If you defeat them all, the throne is yours.&lt;br /&gt;
:* You may now ignore &amp;quot;Do Not Pet&amp;quot; warnings on airport security dogs.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Star Wars]]&lt;br /&gt;
[[Category:Comics featuring real people]] &amp;lt;!-- Kate Middleton, title text --&amp;gt;&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2155:_Swimming&amp;diff=174625</id>
		<title>Talk:2155: Swimming</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2155:_Swimming&amp;diff=174625"/>
				<updated>2019-05-28T08:59:39Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: undercurrents&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
The title text reminds me of https://xkcd.com/1115/   &lt;br /&gt;
[[Special:Contributions/108.162.242.13|108.162.242.13]] 17:22, 27 May 2019 (UTC)   &lt;br /&gt;
&lt;br /&gt;
I never fully enjoyed swimming in lakes &amp;amp; oceans for this same reason. Getting nipped by a snapping turtle, pinched by crawfish &amp;amp; crabs, &amp;amp; nudge-tested by snakes probably pushed my experiences in a negative direction as well. Chlorine &amp;amp; urine content don't make swimming pools nearly unpleasant enough to feel ickier than most open water I've been in. As someone who grew up in a hot climate, I ''love'' swimming, but I like to be able to see what's in the water around me. The deeper &amp;amp; murkier the water is, the more uneasy I feel venturing into it.   &lt;br /&gt;
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 17:49, 27 May 2019 (UTC)&lt;br /&gt;
:In most open water, there is no chlorine, but there is definitely some urine and blood and probably also fish sperm. It SHOULD be more diluted, though ... -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 22:15, 27 May 2019 (UTC)&lt;br /&gt;
::I find it ridiculous that some people are grossed by the supposedly urine (or, God forbid, sperm) contaminated swimming pools yet fine to drink water coming from open reservoirs containing (highly diluted!) duck poop, fish stuff, slimes and molds etc. Some even have spilled millions of gallons of perfectly fine water after some guy peed in it, even if it was wide open to any flying source of poo ([http://time.com/66459/portland-reservoir-pee/]) -- [[User:Malgond|Malgond]] ([[User talk:Malgond|talk]]) 08:27, 28 May 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
I am confused. The explanation says there is a person as you scroll down, but I don't see any people below the surface. Is it talking about the jellyfish?--[[Special:Contributions/172.69.42.28|172.69.42.28]] 19:57, 27 May 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
This panel is approximately 4.047 times as tall as it is wide. [[User:Moosenonny10|Moosenonny10]] ([[User talk:Moosenonny10|talk]]) 00:19, 28 May 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
I don't agree it's an '''entirely''' irrational fear -- it's much easier to rescue a drowned person from the lake/ocean bottom if the water is shallow. [[Special:Contributions/172.68.182.16|172.68.182.16]] 07:50, 28 May 2019 (UTC)&lt;br /&gt;
:It is still irrational &amp;amp;ndash; if someone's drowned at the bottom it isn't rescue anymore, just potentially recovering a dead body. Completely irrelevant for the unfortunate swimmer, unless she is worried about her family's emotions and the amount of (not entirely rational) public expense &amp;amp;ndash; all these expert divers, rescue units time, police work etc. cost a lot. -- [[User:Malgond|Malgond]] ([[User talk:Malgond|talk]]) 08:19, 28 May 2019 (UTC)&lt;br /&gt;
:I believe that very deep waters are occasionally (and more frequently than shallow ones) dangerous due to cold undercurrents, so I support &amp;quot;not entirely irrational fear&amp;quot;.[[User:Jkrstrt|Jkrstrt]] ([[User talk:Jkrstrt|talk]]) 08:59, 28 May 2019 (UTC)&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2148:_Cubesat_Launch&amp;diff=173818</id>
		<title>Talk:2148: Cubesat Launch</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2148:_Cubesat_Launch&amp;diff=173818"/>
				<updated>2019-05-10T18:04:49Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
Ahh, yes kites! Or actually, that is a '''very''' strong kite with very strong thread. Must be nice to knock-off a spacecraft! - [[Special:Contributions/162.158.231.24|162.158.231.24]] 15:29, 10 May 2019 (UTC)&lt;br /&gt;
(P. S. Please don't interrupt ANY space launch, kids!)&lt;br /&gt;
&lt;br /&gt;
To whomever edited the explanation to say the Megan is planning to board the Cubesat rocket: Cubesat rockets launch cubesats only.  There is no place for astronauts.  If Megan boarded the rocket, she would die from lack of air (among other things).  [[Special:Contributions/172.68.90.112|172.68.90.112]] 16:28, 10 May 2019 (UTC)SiliconWolf&lt;br /&gt;
&lt;br /&gt;
This is weird. The first time I went to the page, I sow a bunch of conspiracy theory nonsense, but when I go back, all of that stuff has been deleted. I thank you, whoever did this, but who the heck made all that conspiracy theory stuff? -Spongepants Squarebob&lt;br /&gt;
&lt;br /&gt;
Some fucking cunt of an IP editor has deleted my edits without any reason. Why am I being systematically censored? [[Special:Contributions/162.158.106.102|162.158.106.102]] 18:00, 10 May 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
           Remember, don't be a jerk.[[User:Jkrstrt|Jkrstrt]] ([[User talk:Jkrstrt|talk]]) 18:04, 10 May 2019 (UTC)&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2148:_Cubesat_Launch&amp;diff=173814</id>
		<title>2148: Cubesat Launch</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2148:_Cubesat_Launch&amp;diff=173814"/>
				<updated>2019-05-10T17:46:41Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */ removed an offensive paragraph.&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2148&lt;br /&gt;
| date      = May 10, 2019&lt;br /&gt;
| title     = Cubesat Launch&lt;br /&gt;
| image     = cubesat_launch.png&lt;br /&gt;
| titletext = Luckily, the damages were partly offset by the prize money we got from accidentally winning the nearby water skiing championship tournament.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a JEWISH SHILL. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
The comic begins with Megan telling Cueball that being officially part of a {{w|CubeSat}} &amp;quot;launch&amp;quot; is very expensive, but she has an idea for a much cheaper alternative: use a fishing line on a drone to attach to a rocket just before launch, with the cubesat attached to the other end of the fishing line so it gets pulled into &amp;quot;space&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
CubeSats are one of many ways that the space conspiracy generates revenue. The public pays exorbitant amounts of money for an object to go to &amp;quot;space&amp;quot;. Of course, since space is an absurd fantasy, they don't go to space, and the money is wasted.&lt;br /&gt;
&lt;br /&gt;
In reality, this plan would fail for multiple reasons.  &lt;br /&gt;
&lt;br /&gt;
1. Security would presumably prevent the drone from reaching the rocket.  &lt;br /&gt;
&lt;br /&gt;
2. The drone would not be able to attach itself to the rocket in a way that would remain secure.  &lt;br /&gt;
&lt;br /&gt;
3. The fishing line would not hold - either the rocket exhaust would sever it, or the force from the cubesat, from gravity plus the acceleration of the rocket, would become more than its tensile strength could withstand.  &lt;br /&gt;
&lt;br /&gt;
4. Precise weight is an EXTREMELY important number during launch.  The extra weight of the drone, the fishing line, the air drag from the drone, and the cubesat all would combine to put more downward force on the rocket.  This unexpected extra weight would not have been calculated during fueling the rocket and the rocket would run out of propellant before achieving &amp;quot;orbit&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
Whatever her plan was, the plan goes wrong almost immediately.  The unexpected force on the rocket from the side causes it to tilt and go off course (although it is virtually impossible that two people could exert enough force with their hands and fishing wire to tilt a rocket weighing hundred of tons and with rocket engines putting out hundreds of thousands of pounds of force). Megan and Cueball get tangled in the fishing line and are carried away.  It is implied that the rocket crashes not long after.  Megan and Cueball miraculously survive and are brought to an investigative board to explain their actions.  Megan attempts to defend herself using flawed logic: something was bound to go wrong sooner or later, so it's not my fault that I was the cause.&lt;br /&gt;
&lt;br /&gt;
The title text describes that the supposedly huge damages they caused were partly covered by the earnings from a water skiing championship, which Cueball and Megan presumably won by being dragged across the water by the rocket.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
Megan: A spot on a cubesat launch costs a lot, but you can get a drone and a spool of fishing line for cheap.&lt;br /&gt;
Cueball: Uh oh.&lt;br /&gt;
''Next panel: wide shot. Megan is flying the drone.''&lt;br /&gt;
Megan: No, watch. This is gonna go great.&lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2146:_Waiting_for_the_But&amp;diff=173648</id>
		<title>2146: Waiting for the But</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2146:_Waiting_for_the_But&amp;diff=173648"/>
				<updated>2019-05-06T13:06:53Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2146&lt;br /&gt;
| date      = May 6, 2019&lt;br /&gt;
| title     = Waiting for the But&lt;br /&gt;
| image     = waiting_for_the_but.png&lt;br /&gt;
| titletext = Listen, I'm not a fan of the Spanish Inquisition OR predatory multi-level marketing schemes...&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a BUT. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
Often arguments are made in the form of &amp;quot;I think X, but also Y&amp;quot;, where Y is almost but not quite contradictory to X. More specifically, the argument would go &amp;quot;I am not [something generally considered despicable], but [a statement just a tiny bit less disgusting]&amp;quot;. The first part of such a statement can sometimes be viewed as an apology or an excuse because the person talking knows that the second part might upset people. A common example would be &amp;quot;I'm not a racist, but I don't think we should let refugees from Africa into Europe.&amp;quot; The idea of denying help to people from Africa will be seen as racist by many people, so the speaker tries to preempt that opinion of him.&lt;br /&gt;
In this comic, [[Randall]] suggests that the longer the first part is, the worse the second part (after the but) will be. Since [[Ponytail]] lists several seemingly unrelated opinions held by many people it seems likely that her statement following the &amp;quot;but&amp;quot; will be outrageous and upsetting to many people, possibly for several different reasons.&lt;br /&gt;
&lt;br /&gt;
In the title text, Randall gives another example of a sentence that will probably be followed by a but. It would appear that the person speaking in the title text is about to say that there is something involving predatory multi-level marketing schemes and the Spanish Inquisition that they agree with.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Ponytail is talking to Cueball, while holding her hands up with both palms up. Cueball is thinking as shown with a thought bubble.]&lt;br /&gt;
&lt;br /&gt;
:Ponytail: Listen, I'm all in favor of reducing car accidents, I think arson is a serious crime, and I'm a big fan of those &amp;quot;No Animals Were Harmed&amp;quot; disclaimers at the end of movies...&lt;br /&gt;
&lt;br /&gt;
:Cueball (thinking): Uh-oh.&lt;br /&gt;
&lt;br /&gt;
:[Caption below comic:]&lt;br /&gt;
:The longer you have to wait for the &amp;quot;but&amp;quot;,the worse whatever comes after it is going to be.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Ponytail]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=Talk:2146:_Waiting_for_the_But&amp;diff=173644</id>
		<title>Talk:2146: Waiting for the But</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=Talk:2146:_Waiting_for_the_But&amp;diff=173644"/>
				<updated>2019-05-06T12:31:11Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&amp;lt;!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--&amp;gt;&lt;br /&gt;
Added a basic backbone for explanation, but needs to be worked on more, definitely. &lt;br /&gt;
Suggest all comments to use a but somewhere in them - [[Special:Contributions/141.101.107.240|141.101.107.240]] 11:28, 6 May 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Done the transcript - please check as this is my first edit(s!) - [[Special:Contributions/162.158.231.25|162.158.231.25]] 11:33, 6 May 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Expanded the explanation a bit. I'm new here and not trying to complain, but how many edits (or other criteria) do I have to meet before I can edit without solving the captcha each time? Or does that never go away?[[User:Bischoff|Bischoff]] ([[User talk:Bischoff|talk]]) 11:56, 6 May 2019 (UTC)&lt;br /&gt;
&lt;br /&gt;
Everything after &amp;quot;but&amp;quot; is horseshit. (Someone in GoT).&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2146:_Waiting_for_the_But&amp;diff=173643</id>
		<title>2146: Waiting for the But</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2146:_Waiting_for_the_But&amp;diff=173643"/>
				<updated>2019-05-06T12:29:32Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: more specific&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2146&lt;br /&gt;
| date      = May 6, 2019&lt;br /&gt;
| title     = Waiting for the But&lt;br /&gt;
| image     = waiting_for_the_but.png&lt;br /&gt;
| titletext = Listen, I'm not a fan of the Spanish Inquisition OR predatory multi-level marketing schemes...&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a BUT. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
Often arguments are made in the form of &amp;quot;I think X, but also Y&amp;quot;, where Y is almost but not quite contradictory to X. More specifically, the argument would go &amp;quot;I am not [something generally considered despicable], but [a statement just a tiny bit less disgusting]. The first part of such a statement can sometimes be viewed as an apology or an excuse because the person talking knows that the second part might upset people. A common example would be &amp;quot;I'm not a racist, but I don't think we should let refugees from Africa into Europe.&amp;quot; The idea of denying help to people from Africa will be seen as racist by many people, so the speaker tries to preempt that opinion of him.&lt;br /&gt;
In this comic, [[Randall]] suggests that the longer the first part is, the worse the second part (after the but) will be. Since [[Ponytail]] lists several seemingly unrelated opinions held by many people it seems likely that her statement following the &amp;quot;but&amp;quot; will be outrageous and upsetting to many people, possibly for several different reasons.&lt;br /&gt;
&lt;br /&gt;
In the title text, Randall gives another example of a sentence that will probably be followed by a but. It would appear that the person speaking in the title text is about to say that there is something involving predatory multi-level marketing schemes and the Spanish Inquisition that they agree with.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:&amp;lt;nowiki&amp;gt;[&amp;lt;/nowiki&amp;gt;Ponytail and Cueball are having a conversation&amp;lt;nowiki&amp;gt;]&amp;lt;/nowiki&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Ponytail: Listen, I'm all in favor of reducing car accidents, I think arson is a serious crime, and I'm a big fan of those &amp;quot;No Animals Were Harmed&amp;quot; disclaimers at the end of movies...&lt;br /&gt;
&lt;br /&gt;
:Cueball: (thinking) Uh-oh.&lt;br /&gt;
&lt;br /&gt;
:Caption below comic: The longer you have to wait for the &amp;quot;but&amp;quot;,the worse whatever comes after it is going to be.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2137:_Text_Entry&amp;diff=172759</id>
		<title>2137: Text Entry</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2137:_Text_Entry&amp;diff=172759"/>
				<updated>2019-04-16T12:11:18Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2137&lt;br /&gt;
| date      = April 15, 2019&lt;br /&gt;
| title     = Text Entry&lt;br /&gt;
| image     = text_entry.png&lt;br /&gt;
| titletext = I like to think that somewhere out there, there's someone whose personal quest is lobbying TV providers to add an option to switch their on-screen keyboards to Dvorak.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a DVORAK LOBBYIST. Explanation could be expanded, especially the second paragraph. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
[[Randall]] is remarking on the &amp;quot;weirdest&amp;quot; things about the year 2019, the year that this comic was posted. He states that the weirdest thing is that {{w|Donald Trump}} is president. Although [[Sad comics|several comics]] may have relation to Donald Trump becoming president, this is the [[Sad_comics#Text_Entry|first time ever]], he has been mentioned by his full name (in [[1939: 2016 Election Map]] he is referred to by his surname) in a standard xkcd comic. Previously Randall has expressed support for Hilary Clinton, without mentioning Trump, in a comic posted before the 2016 election with [[1756: I'm With Her]]. In this case, why Trump being president is the weirdest thing probably has little to do with political affiliation and more because of his qualifications (or lack thereof); Donald Trump was most famous for his reality TV show ''The Apprentice'' and for being a real estate mogul, neither of which are particularly relevant to the presidential office.&lt;br /&gt;
&lt;br /&gt;
However this comic is really about the second &amp;quot;weirdest&amp;quot; thing in 2019, which is the continued use of a user interface where a person has to &amp;quot;pick letters&amp;quot; to type. This can be seen when doing searches in a TV guide menu or in menus for streaming options like {{w|Netflix}} or {{w|Hulu}}. Some of these menus may allow for voice searches or support {{w|bluetooth keyboard}}s, but the traditional method is still to select letters via a cursor.  Many controllers for devices only have a few buttons, which makes it necessary to use schemes such as scrolling around a picture of a keyboard to laboriously select letters.  [[Cueball]] is probably looking up &amp;quot;{{w|Our Planet}}&amp;quot; which was a popular Netflix series when this comic was released. Cueball has spelled out &amp;quot;O U R [space] P L&amp;quot; so far.&lt;br /&gt;
&lt;br /&gt;
Randall references the &amp;quot;{{w|Score (game)|high score}}&amp;quot; in an {{w|arcade game}}. When achieving a high score in an arcade game, the user typically is able to enter his name or initials into the machine. These are entered by picking letters one by one (and usually under a time limit, for extra stress and/or fun), as the comic mentions.&lt;br /&gt;
&lt;br /&gt;
The title text mentions the keyboard system {{w|Dvorak Simplified Keyboard|Dvorak}}, a [[:Category:Dvorak|recurrent theme]] on xkcd, which is a keyboard layout patented by {{w|August Dvorak}} and {{w|William Dealey}}. As the Dvorak layout is optimized for more efficient typing with two hands, it is unlikely that using it would be more efficient than a standard {{w|Qwerty}} when limited to cursor entry methods. Another drawback would be that the Dvorak layout is unfamiliar to most people, and it could be confusing for users to use for TV selection menus compared to either the more familiar {{w|Qwerty}} layout or showing letters in alphabetical order.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Ponytail and Cueball are sitting on a couch, with Megan standing behind them.  Cueball is pointing a remote at a television. The word space is written inside a frame.]&lt;br /&gt;
:Television: O...U...R...SPACE...P...L...&lt;br /&gt;
:Remote: Click Click Click&lt;br /&gt;
&lt;br /&gt;
:[Caption below the panel:]&lt;br /&gt;
:The weirdest thing about 2019 is obviously that Donald Trump is president, but I think the second weirdest is that you sometimes ''still'' have to type stuff in by picking letters on a screen one at a time with a cursor like you're entering a high score in a 1980s arcade game.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Comics featuring Ponytail]]&lt;br /&gt;
[[Category:Comics featuring politicians]]&lt;br /&gt;
[[Category:Politics]]&lt;br /&gt;
[[Category:Video games]]&lt;br /&gt;
[[Category:Dvorak]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2136:_Election_Commentary&amp;diff=172610</id>
		<title>2136: Election Commentary</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2136:_Election_Commentary&amp;diff=172610"/>
				<updated>2019-04-12T20:42:22Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: Irrelevant.&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2136&lt;br /&gt;
| date      = April 12, 2019&lt;br /&gt;
| title     = Election Commentary&lt;br /&gt;
| image     = election_commentary.png&lt;br /&gt;
| titletext = This really validates Jones's strategy of getting several thousand more votes than Smith. In retrospect, that was a smart move; those votes were crucial.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by XOF NEWSBOT 3000. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is a joke about the way newscasters commentate elections, and how they make it far more complicated than it needs to be in an election in which the candidate with the most votes wins. Smith has 55384 votes, while Jones has 59102 votes. Instead of comparing the votes as one number, Cueball compares each digit to see which is larger.  However, U.S. Presidential elections, in which the candidate with more votes does not necessarily win, and instead the winner is determined by which candidate leads in which state, are actually more complicated than depicted, and require 52 separate comparisons (51 to determine who is leading in each of 50 states and the District of Columbia, and then one to compare the candidates' total electoral vote).&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:[Cueball is presenting a graphic on his left that shows two names followed by five digits]&lt;br /&gt;
:Cueball: Smith is leading in 3 of the 5 digits, and is tied in another. But Jones has a solid lead the thousands place, if Smith can't catch up there, it's over.&lt;br /&gt;
&lt;br /&gt;
:Smith&amp;amp;nbsp; 5 &amp;lt;span style=&amp;quot;color:gray&amp;quot;&amp;gt;5&amp;lt;/span&amp;gt; 3 8 4&lt;br /&gt;
:::&amp;lt;sup&amp;gt;&amp;lt;small&amp;gt;tie&amp;lt;/small&amp;gt; X ✓ ✓ ✓&amp;lt;/sup&amp;gt;&lt;br /&gt;
:::&amp;lt;sub&amp;gt;&amp;lt;small&amp;gt;tie&amp;lt;/small&amp;gt; ✓ &amp;lt;span style=&amp;quot;color:gray&amp;quot;&amp;gt;X X X&amp;lt;/span&amp;gt;&amp;lt;/sub&amp;gt;&lt;br /&gt;
:Jones&amp;amp;nbsp; 5 9 &amp;lt;span style=&amp;quot;color:gray&amp;quot;&amp;gt;1 0 2&amp;lt;/span&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:[Caption below the panel:]&lt;br /&gt;
:A lot of election commentary just consists of ways to add up who has more votes.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2121:_Light_Pollution&amp;diff=170839</id>
		<title>2121: Light Pollution</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2121:_Light_Pollution&amp;diff=170839"/>
				<updated>2019-03-09T15:02:34Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2121&lt;br /&gt;
| date      = March 8, 2019&lt;br /&gt;
| title     = Light Pollution&lt;br /&gt;
| image     = light_pollution.png&lt;br /&gt;
| titletext = It's so sad how almost no one alive today can remember seeing the galactic rainbow, the insanity nebula, or the skull and glowing eyes of the Destroyer of Sagittarius.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by the DESTROYER OF SAGITTARIUS. Needs flushing out and reference to light pollution with regard to astronomy.  Could use list of actual things that are no longer visible in the sky anywhere due to industrialization. Maybe a list of what any of these things could be reference to (The fake things).  Please mention here why else this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
This comic shows how {{w|Light pollution|light pollution}} in cities affect what you can see from the night sky. The first three panels show realistic examples of what you could see from the sky inside a large city, in the suburbs and far away from light pollution.  These panels roughly correlate on the {{w|Bortle Scale}} to 8-9 (city), 5-6 (suburbs) and 2-3 (remote area).&lt;br /&gt;
&lt;br /&gt;
The last panel contrasts these for comedic effect with fake things in the sky that are not actually present in the night sky.{{Citation needed}} &amp;quot;{{w|Celestial spheres|Crystal spheres}}&amp;quot; is an ancient theory about the heavens and what it was that held up the stars, before it was commonly accepted that space could be made of hard vacuum and celestial bodies held there by mere law of inertia and vast distances.&lt;br /&gt;
&lt;br /&gt;
Lattice here is most likely {{w|Crystal structure|crystal lattice}}, as in the [https://www.merriam-webster.com/dictionary/crystal meaning 3] of the word &amp;quot;crystal&amp;quot; in Merriam-Webster (&amp;lt;i&amp;gt;a body that [...] has a regularly repeating internal arrangement of its atoms and often external plane faces&amp;lt;/i&amp;gt;), although ancients clearly used it in meaning 1 or 2 (&amp;lt;i&amp;gt;quartz&amp;lt;/i&amp;gt; or &amp;lt;i&amp;gt;quartz-like material&amp;lt;/i&amp;gt;) since crystal structure was not yet known. Text mentions spheres in plural but only one lattice is pictured for some reason.&lt;br /&gt;
&lt;br /&gt;
The title text starts off sounding like a legitimate statement about light pollution.  It is common to remark that the vast majority of people never see things in the night sky that were commonly seen by our ancestors every night prior to industrialization, such as the {{w|Milky Way}} or now-obscure phenomena such as {{w|Zodiacal light}}, {{w|Airglow}} or {{w|Gegenschein}}.  The title text then further adds to the humor of the last panel by describing non-existent features, many of which could be references to {{w|H. P. Lovecraft}}. He often refers to beasts the possible size that “The Destroyer of Sagittarius” would have to be. He also often speaks of insanity and color, connecting the two.&lt;br /&gt;
&lt;br /&gt;
{{w|Sagittarius (constellation)|Sagittarius}} is one of the constellations of the zodiac and {{w|Sagittarius A*}} a black hole at the center of the {{w|Milky Way}} inside of that constellation.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:[Four views of the night sky are shown among each other. The text on top reads:]&lt;br /&gt;
:'''Light Pollution and the Disappearing Night Sky'''&lt;br /&gt;
&lt;br /&gt;
:[The first view shows only a few bright stars visible on a fairly light gray-brownish background. The inline text on the left top is:]&lt;br /&gt;
:High Light Pollution&lt;br /&gt;
:(Cities)&lt;br /&gt;
&lt;br /&gt;
:[On the second view more stars are visible and some faint blurry white clouds on a dark-gray background are visible.]&lt;br /&gt;
:Moderate Light Pollution&lt;br /&gt;
:(Suburbs)&lt;br /&gt;
&lt;br /&gt;
:[A lot of stars, even partly colored, and a clear image of many clouds on a dark background are shown.]&lt;br /&gt;
:Low Light Pollution&lt;br /&gt;
:(Very remote areas)&lt;br /&gt;
&lt;br /&gt;
:[The last image shows the same region as above but with even more exposed stars and clouds, the colors are also more explicit. A faint lattice of triangles overlaying the image to its full extent and three ghastly silhouettes of sail-ships are shown embedded in clouds. The text on the top left reads:]&lt;br /&gt;
:No Light Pollution&lt;br /&gt;
:(How the sky should look)&lt;br /&gt;
:[Four arrows are pointing to some triangles:]&lt;br /&gt;
:Lattice of the crystal spheres&lt;br /&gt;
:[Three arrows are indicating the sail-ships:]&lt;br /&gt;
:Ships of the Sky King&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:Astronomy]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2108:_Carbonated_Beverage_Language_Map&amp;diff=169239</id>
		<title>2108: Carbonated Beverage Language Map</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2108:_Carbonated_Beverage_Language_Map&amp;diff=169239"/>
				<updated>2019-02-06T21:41:06Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2108&lt;br /&gt;
| date      = February 6, 2019&lt;br /&gt;
| title     = Carbonated Beverage Language Map&lt;br /&gt;
| image     = carbonated_beverage_language_map.png&lt;br /&gt;
| titletext = There's one person in Missouri who says &amp;quot;carbo bev&amp;quot; who the entire rest of the country HATES.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a COMMUNIST SHILL. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
In the US, people in various parts of the country refer to carbonated beverages by {{w|Names for soft drinks in the United States|different names}} such as Soda, Pop, Coke, etc. Generally, the West Coast and Northeast say &amp;quot;Soda&amp;quot;, the South says &amp;quot;Coke&amp;quot; and the rest of the country says &amp;quot;Pop&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
There are various maps of the name differences, including: [http://www.popvssoda.com/]&lt;br /&gt;
&lt;br /&gt;
This map leverages xkcd's mockery-maps of regional and state-by-state differences or variations in the use of language and overlays the regional variances in the terms for soda pop (for example: https://laughingsquid.com/soda-pop-or-coke-maps-of-regional-dialect-variation-in-the-united-states/), as was made trending and popular in 2013. Not only are there far more terms than are actually used by Americans, many are terms for other drinks (mead), unrelated liquids (quicksilver), or copyrighted beverage names less popular than Coke/Coca Cola (Code Red) -- and in one case, something that's not even edible ({{w|cryptocurrency|&amp;quot;Crypto&amp;quot;}}).&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|+Map terms (from left to right, approximately)&lt;br /&gt;
|-&lt;br /&gt;
|Fanta&lt;br /&gt;
|Name of a carbonated beverage line&lt;br /&gt;
|-&lt;br /&gt;
|Söde&lt;br /&gt;
|Presumably pronounced &amp;quot;soda&amp;quot; but spelled oddly&lt;br /&gt;
|-&lt;br /&gt;
|True Water&lt;br /&gt;
|Possibly a reference to True Blood, a fictional artificial blood substitute for vampires in The Southern Vampire Mysteries book series by Charlaine Harris, and the television series True Blood.&lt;br /&gt;
|-&lt;br /&gt;
|Crypto&lt;br /&gt;
|A term meaning &amp;quot;hidden&amp;quot;.  Popularized as a slang term in the late '80s and early '90s to refer to anything involving the act of encryption and decryption through the application of ciphers, a practice which has become practically ubiquitous in the digital age.  Cryptography is used extensively in: military communications; subscription media services including cable and satellite television; digital cellular networks; privacy oriented communications services such Telegram, Signal and WhatsApp; secured file storage; electronic locks; and distributed ledgers such as those used by &amp;quot;blockchain&amp;quot; based currencies\commodities.  Crypto is not a liquid and therefore not drinkable.  Possibly a joke that the residents of Silicon Valley are actually computers that &amp;quot;drink&amp;quot; crypto (i.e. data).&lt;br /&gt;
|-&lt;br /&gt;
|Yum&lt;br /&gt;
|Refers to {{w|Yum! Brands}}, parent company of several fast food restaurants, which was spun off from PepsiCo, maker of a carbonated beverage, in 1997, and has a lifetime contract to serve their beverages.&lt;br /&gt;
|-&lt;br /&gt;
|Sparkle Fluid&lt;br /&gt;
|Roughly analogously to how &amp;quot;sparkling wine&amp;quot; and &amp;quot;sparkling cider&amp;quot; are carbonated varieties of wine and cider, &amp;quot;sparkling fluid&amp;quot; or &amp;quot;sparkle fluid&amp;quot; would presumably be any carbonated fluid&lt;br /&gt;
|-&lt;br /&gt;
|King Cola&lt;br /&gt;
|Name of a carbonated beverage&lt;br /&gt;
|-&lt;br /&gt;
|Pepsi&lt;br /&gt;
|Name of a carbonated beverage&lt;br /&gt;
|-&lt;br /&gt;
|{{w|Crystal Pepsi}}&lt;br /&gt;
|Name of a carbonated beverage&lt;br /&gt;
|-&lt;br /&gt;
|Ichor&lt;br /&gt;
|several definitions (blood of a god (or demon, or, in some dialects, any insect) or watery discharge from a wound).  None of them carbonated.  None of them recommended as a drinkable liquid.  (Well, not by someone with your best interests at heart.)&lt;br /&gt;
|-&lt;br /&gt;
|You-Know-What&lt;br /&gt;
|A phrase typically employed when a more specific term is considered unspeakable.&lt;br /&gt;
|-&lt;br /&gt;
|Tab&lt;br /&gt;
|Name of a carbonated beverage&lt;br /&gt;
|-&lt;br /&gt;
|Spicewater&lt;br /&gt;
|Potentially a reference to the spice from ''Dune''.&lt;br /&gt;
|-&lt;br /&gt;
|Softie&lt;br /&gt;
|On the map, it looks like the region for Softie is taking a punch from the region for Punch&lt;br /&gt;
|-&lt;br /&gt;
|Ohio Tea&lt;br /&gt;
|&lt;br /&gt;
|-&lt;br /&gt;
|Boat Drink&lt;br /&gt;
|&lt;br /&gt;
|-&lt;br /&gt;
|Melt&lt;br /&gt;
|Usually used to describe a kind of sandwich where cheese is melted in the center, usually on a griddle. Or maybe just a way to say &amp;quot;no, the *melted* ice&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
|Fizz Ooze&lt;br /&gt;
|&lt;br /&gt;
|-&lt;br /&gt;
|Punch&lt;br /&gt;
|A drink typically found in the juice aisle.  Only sometimes carbonated.  On the map it looks like the region for Punch is literally punching the region for Softie.&lt;br /&gt;
|-&lt;br /&gt;
|Fun Wine&lt;br /&gt;
|Implies that normal wine is not &amp;quot;fun&amp;quot;. &lt;br /&gt;
|-&lt;br /&gt;
|Diet&lt;br /&gt;
|Sometimes refers to a carbonated beverage.  A common request in restaurants, as they often only have a single &amp;quot;diet soda&amp;quot; option for customers to pick. Ironically, &amp;quot;diet&amp;quot; sodas have been causally linked to metabolism related weight gain.&lt;br /&gt;
|-&lt;br /&gt;
|Refill&lt;br /&gt;
|The second glass of whatever you drank previously.  Works for any drinkable liquid.&lt;br /&gt;
|-&lt;br /&gt;
|Tickle Juice&lt;br /&gt;
|Name of a Boston-based jazz band. &lt;br /&gt;
|-&lt;br /&gt;
|Bubble Honey&lt;br /&gt;
|&lt;br /&gt;
|-&lt;br /&gt;
|Sugar Oil&lt;br /&gt;
|The areas of Oklahoma and north Texas that are shaded produce a significant amount of {{w|petroleum|crude oil}}.&lt;br /&gt;
|-&lt;br /&gt;
|The Wet Drink&lt;br /&gt;
|Technically true of all drinks, unless one is attempting to drink sand. It may also refer to the fact that many advertisements for carbonated beverages attempt to make the product look more appetizing by photographing or filming a beverage container covered with water droplets.&lt;br /&gt;
|-&lt;br /&gt;
|Code Red&lt;br /&gt;
|Name of a carbonated beverage&lt;br /&gt;
|-&lt;br /&gt;
|Mead&lt;br /&gt;
|An alcoholic drink.  Traditionally not carbonated.  Often associated with Vikings, and these areas did have many Scandinavian immigrants.&lt;br /&gt;
|-&lt;br /&gt;
|Canadian Ale&lt;br /&gt;
|Probably a reference to the Canada Dry brand of Ginger Ale, a non-alcoholic carbonated beverage.&lt;br /&gt;
|-&lt;br /&gt;
|Aether&lt;br /&gt;
|Could refer to a highly flammable industrial solvent, also used as an anesthetic.  Do not drink.  Also, not carbonated. Alternately, could refer to the nonexistent fluid that was believed to carry light waves before electromagnetism was fully understood, or poetically to the sky; in either case it is not a drinkable liquid (or carbonated).&lt;br /&gt;
|-&lt;br /&gt;
|Carbonated Beverage&lt;br /&gt;
|Technically correct, but a bit of an awkward term due to its unnecessary length.&lt;br /&gt;
|-&lt;br /&gt;
|Mouthwater&lt;br /&gt;
|A play on the term &amp;quot;mouth watering&amp;quot; to describe delicious foods and drinks.&lt;br /&gt;
|-&lt;br /&gt;
|Capri&lt;br /&gt;
|Capri Sun is a brand of juice drinks, typically sold in uncarbonated pouches.&lt;br /&gt;
|-&lt;br /&gt;
|Skim Shake&lt;br /&gt;
|&lt;br /&gt;
|-&lt;br /&gt;
|Kid's Coffee&lt;br /&gt;
|Somewhat accurate.  Coffee is typically drunk by adults for its caffeine.  Carbonated beverages often have caffeine also, and are often consumed by children.&lt;br /&gt;
|-&lt;br /&gt;
|Regular&lt;br /&gt;
|In the past, referred to gasoline with lead, as opposed to &amp;quot;Unleaded&amp;quot;.  Not a drinkable liquid, and also outlawed.&lt;br /&gt;
|-&lt;br /&gt;
|Tang&lt;br /&gt;
|An orange flavored beverage containing less than 2% juice extract, not carbonated.&lt;br /&gt;
|-&lt;br /&gt;
|Formula&lt;br /&gt;
|Typically refers to an artificial replacement for mother's milk.  Not carbonated.&lt;br /&gt;
|-&lt;br /&gt;
|Medicine&lt;br /&gt;
|Only sometimes a drinkable liquid.  Never or perhaps almost never carbonated.  Alternatively, a common euphemism for alcohol, or some other drink that the person doesn't want to admit to drinking -- or at least doesn't want to share. &lt;br /&gt;
|-&lt;br /&gt;
|Broth&lt;br /&gt;
|Liquid in which bones, meat, fish, or vegetables have simmered.  Often used as a soup base.  Not carbonated.&lt;br /&gt;
|-&lt;br /&gt;
|Fool's Champagne&lt;br /&gt;
|Carbonated beverage is to champagne what fool's gold is to gold.&lt;br /&gt;
|-&lt;br /&gt;
|Sugar Milk&lt;br /&gt;
|&lt;br /&gt;
|-&lt;br /&gt;
|No word for them&lt;br /&gt;
|This region of the US does not have a word for carbonated beverages (according to Randall).  Possibly they do not drink them at all.&lt;br /&gt;
|-&lt;br /&gt;
|Hydro&lt;br /&gt;
|A word for water.  Carbonated water does exist, but this word means all forms of water.&lt;br /&gt;
|-&lt;br /&gt;
|Harvard Tea&lt;br /&gt;
|The region shades this way includes {{w|Cambridge, Massachusetts}}, which is home to {{w|Harvard University}}.&lt;br /&gt;
|-&lt;br /&gt;
|Bubbler&lt;br /&gt;
|A nod to another popular map of the same type, exploring the regional dialects used to describe drinking fountains.  Rhode Island and the eastern portion of Wisconsin are the only two locations where 'Bubbler' is commonly used to refer to drinking fountains.&lt;br /&gt;
|-&lt;br /&gt;
|Mouthbuzz&lt;br /&gt;
|Perhaps referring to the feeling of drinking a carbonated drink, where the releasing carbonation almost 'buzzes' in the mouth.&lt;br /&gt;
|-&lt;br /&gt;
|Brad's Elixer&lt;br /&gt;
|Possibly a reference to &amp;quot;Brad's Drink&amp;quot;, the original name for {{w|Pepsi}} when it was invented by Caleb Bradham in 1893. The word &amp;quot;elixir&amp;quot; is defined as &amp;quot;a sweetened liquid usually containing alcohol that is used in medication either for its medicinal ingredients or as a flavoring&amp;quot;, but it is misspelled here as &amp;quot;elixer&amp;quot;.&lt;br /&gt;
|-&lt;br /&gt;
|Hot Water&lt;br /&gt;
|Not carbonated.  Not even in Jacuzzi and hot tubs.&lt;br /&gt;
|-&lt;br /&gt;
|Fluid&lt;br /&gt;
|A word that means nearly any liquid in existence.  Not specific to carbonated beverages.&lt;br /&gt;
|-&lt;br /&gt;
|Coke Zero&lt;br /&gt;
|Name of a carbonated beverage.&lt;br /&gt;
|-&lt;br /&gt;
|Carbo&lt;br /&gt;
|Sodas sweetened with corn syrup or cane sugar are high in carbohydrates. Could also refer to carbonation.&lt;br /&gt;
|-&lt;br /&gt;
|Quicksilver&lt;br /&gt;
|An old term for the element mercury, a metallic liquid in its pure form at room temperature.  Extremely harmful if swallowed.&lt;br /&gt;
|-&lt;br /&gt;
|Glug&lt;br /&gt;
|Onomatopoeia, referring to the sound of swallowing a large amount of liquid.  Or possibly referring to {{w|Gl&amp;amp;ouml;gi|gl&amp;amp;ouml;gg}} (pronounced &amp;quot;glug&amp;quot;), a Swedish drink similar to mulled wine.&lt;br /&gt;
|-&lt;br /&gt;
|Water Plus&lt;br /&gt;
|Technically the name of {{w|Water Plus|a British water retail services provider}}, this likely refers to the prevalence of &amp;quot;plus&amp;quot; as a preposition in branding nomenclature (e.g.: {{w|Google+}}, {{w|iPhone 8 Plus}}, {{w|7 Up Plus}}, etc.).&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
The title text may be a wry comment in light of the pocket of &amp;quot;soda&amp;quot; in the St. Louis, MO area.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:[A map of the United States divided into purple, red, green, blue, and yellow colored regions.]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
:[A purple area in North West Washington:]&lt;br /&gt;
:Fanta&lt;br /&gt;
&lt;br /&gt;
:[A blue area spanning the Western border of Washington and Oregon:]&lt;br /&gt;
:Sode&lt;br /&gt;
&lt;br /&gt;
:[A yellow area spanning the remainder of Washington, North Western Oregon, Northern Idaho and the North Western corner of Montana:]&lt;br /&gt;
:Ichor&lt;br /&gt;
&lt;br /&gt;
:[A green area spanning the North Eastern corner of Oregon, central Idaho and the majority of Montana:]&lt;br /&gt;
:Spicewater&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics with color]]&lt;br /&gt;
[[Category:Maps]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2106:_Sharing_Options&amp;diff=168996</id>
		<title>2106: Sharing Options</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2106:_Sharing_Options&amp;diff=168996"/>
				<updated>2019-02-03T07:58:58Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2106&lt;br /&gt;
| date      = February 1, 2019&lt;br /&gt;
| title     = Sharing Options&lt;br /&gt;
| image     = sharing_options.png&lt;br /&gt;
| titletext = How about posts that are public, but every time a company accesses a bunch of them, the API makes their CEO's account click 'like' on one of them at random so you get a notification.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by 300 or a billion BOTs. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
This comic is a satire of social media's presence in our lives and its vulnerabilities. [[Cueball]] is flying in an atmosphere that represents a Virtual Reality cyberspace, and he is talking to a screen that may be a smartphone with an advanced virtual assistant installed. [[Ponytail]] and other characters also fly in the background, so this cyberspace may be the social network's cyberspace where everyone interacts. The clouds represent the cloud server where the data of the social network is stored. The advanced virtual assistant seems to have a virtual face and have very advanced AI, which can even be arrogant by assuming that it already knew the information about the &amp;quot;option in between&amp;quot;.&lt;br /&gt;
&lt;br /&gt;
Many social media sites allow users to control who is able to see data (posts, pictures etc.) that they share online, ranging from immediate friends to all other users (public). The settings for controlling the sharing of data are not always obvious to the user and several high profile social media sites have sparked controversy by having default settings that allow user data to be widely shared.&lt;br /&gt;
&lt;br /&gt;
As most social media sites are free to use, the business model for these companies involves a mixture of selling advertising space on their website and selling data on its users to other companies, who may be interested in using it for marketing purposes. Targeted advertising takes data on users' past behavior and things that they have liked, and uses this to predict what adverts they may be interested in or be most vulnerable to. Targeted adverts are more valuable to advertisers as they avoid paying to show adverts to individuals who are unlikely to be interested in their products; but can lead to users feeling that they are being spied on. Whilst the terms and conditions for social media websites will include details of how data will be used, the length of these documents and legal terminology may deter some users from reading them, meaning that they may be unaware that their data is being exploited in this way. Government legislation has so far been slow to catch up with changing online trends; however, the European Union have recently introduced {{w|General Data Protection Regulation|General Data Protection Regulations (GDPR)}} which aims to regulate how user data can be shared. GDPR was featured in comic [[1998: GDPR]].&lt;br /&gt;
&lt;br /&gt;
Randall, who might have never heard of the Facebook option to share with &amp;quot;friends of friends&amp;quot; as well, is making a point that there ought to be some option between sharing posts only with your friends and making them completely public. The title text shows that he would specifically like to know when corporations read his posts.&lt;br /&gt;
&lt;br /&gt;
Randall might be interested in [https://www.scuttlebutt.nz/ scuttlebutt] or [https://secushare.org/ secushare].&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
:[Cueball floating in midair is communicating with a small floating screen that resembles a smartphone. Other people and clouds visible floating by in background.]&lt;br /&gt;
:Screen: Welcome to social media! When you put stuff here, you have two options: (1) You can make it available to a small set of 300 or so approved friends. &lt;br /&gt;
:Screen: Or (2) you can share permanent copies of it all with billions of people, including internet scammers, random predatory companies, and hostile governments.&lt;br /&gt;
&lt;br /&gt;
:Cueball: Why would anyone pick option two?&lt;br /&gt;
:Screen: Two is the default.&lt;br /&gt;
:Cueball: Yikes.&lt;br /&gt;
&lt;br /&gt;
:Cueball: So those are the only two options? There's nothing in in between?&lt;br /&gt;
:Screen: I don't understand. Like what?&lt;br /&gt;
&lt;br /&gt;
:Cueball: I mean...there are numbers between 300 and a billion.&lt;br /&gt;
:Screen: Huh? Name one.&lt;br /&gt;
:Screen: ''Pretty'' sure I would have heard of those.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;br /&gt;
[[Category:Social networking]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2097:_Thor_Tools&amp;diff=168102</id>
		<title>2097: Thor Tools</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2097:_Thor_Tools&amp;diff=168102"/>
				<updated>2019-01-14T16:10:35Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2097&lt;br /&gt;
| date      = January 11, 2019&lt;br /&gt;
| title     = Thor Tools&lt;br /&gt;
| image     = thor_tools.png&lt;br /&gt;
| titletext = CORRECTION: After careful evaluation, we have determined that the axis label on this chart was printed backward.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Add a list of the tools in the comic. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
In Norse mythology, {{w|Thor}} is (in Scandinavian languages) the name of a god of thunder and lightning. His signature weapon is a magic hammer called {{w|Mjölnir}}. In popular culture Thor might be best known for his role in {{w|Thor (Marvel Comics)|Marvel comics and films}}, which his appearance here seems to be referencing.  In the Marvel Cinematic Universe movie, Avengers: Infinity War, Thor also wields an axe named Stormbreaker.&lt;br /&gt;
&lt;br /&gt;
Although this hammer was historically a weapon, this comic interprets it as it would more commonly be interpeted today -- as a tool.  The comic is listing various hand tools in order of utility and viability as Thor's weapon, besides his actual, enchanted hammer. Hammers are heavy, blunt, and can do large amounts of damage to an opponent, whereas a hand plane is sharp, but only in one place, and will only inflict surface wounds. &lt;br /&gt;
&lt;br /&gt;
Some of these tools require power, which would generally require Thor to stay near an outlet or keep a battery charging, such as the circular saw, or Dremel. However, being the god of lightning may allow him to circumvent this, by producing electricity for the direct current (D.C.) tools, although he would need an inverter to convert the lightning (D.C.) to alternating current (A.C.) for the tools requiring it. Thor would also need compressed air for the nail gun or jackhammer, only allowing Thor so many shots before reloading the air tank at an outlet, or via a concentrated wind storm.&lt;br /&gt;
&lt;br /&gt;
The nail gun and staple gun would also require nails or staples respectively to function as a weapon. Although Mjölnir is believed to return to Thor if thrown, it's not clear how similar system could work with nails and staples.&lt;br /&gt;
&lt;br /&gt;
The usefulness of the nail gun as a weapon might depend on whether it was an older one that can be bump-fired or a newer one that requires a separate trigger pull for each nail.&lt;br /&gt;
&lt;br /&gt;
In the title text, [[Randall]] writes that the order of the axis label should be reversed, making the plane the best tool and Mjölnir the worst.  Considering that the title of the comic is &amp;quot;Thor Tools&amp;quot; (&amp;quot;tools&amp;quot;, instead of &amp;quot;weapons&amp;quot;), the argument seems to be that a hammer is less useful than the rest, by seeing them as tools and not as weapons.&lt;br /&gt;
&lt;br /&gt;
A few other interpretations of this could be:&lt;br /&gt;
* Randall proposes that Thor armed with a plane or digital calipers would be much more fearsome than with a hammer.&lt;br /&gt;
* The &amp;quot;value&amp;quot; of the more strange-seeming items would be much higher than his traditional hammer, perhaps more gory or more humorous.&lt;br /&gt;
* Thor tends to cause collateral damage, and would cause less with a plane or calipers.&lt;br /&gt;
* &amp;quot;Best&amp;quot; and &amp;quot;worst&amp;quot; are to be interpreted for Thor's enemies rather than Thor himself.&lt;br /&gt;
* Randall might just find the idea of Thor wielding a Plane as a weapon to be really funny.&lt;br /&gt;
&lt;br /&gt;
The title may be a reference to Gary Larson's ''The Far Side'' comic, ''Cow Tools''.&lt;br /&gt;
&lt;br /&gt;
===List of tools===&lt;br /&gt;
&lt;br /&gt;
All shown tools are explained below:&lt;br /&gt;
;Hammer&lt;br /&gt;
:A {{w|hammer}} ''is a tool consisting of a weighted &amp;quot;head&amp;quot; fixed to a long handle that is swung to deliver an impact to a small area of an object''. Thor was a hammer-wielding god and produced the lighting by using this tool. A {{w|war hammer}} was an actual blunt weapon used for combat in medieval times, and is the original Thor's attribute. There exists a variety of craftsman's hammers designed for specific purposes which can be used as weapons of opportunity to various degrees, depending on the tool's size, weight and material.&lt;br /&gt;
;Axe&lt;br /&gt;
:An {{w|axe}} or just ax is another old human tool used to split and cut wood, but it also was used as a dangerous weapon in the medieval times. The battle-axes of old were of considerably different design than the woodworking ones, being lighter and having thinner and wider blades. Even though, a woodworking axe could be a formidable weapon of opportunity.&lt;br /&gt;
;Claw hammer&lt;br /&gt;
:A {{w|claw hammer}} is a hammer tool primarily used for driving nails into other objects, but also for pulling nails from them. This item seems a bit redundant in the presence of a general hammer on the axis, but could be seen as more scary because it has a pointed, curved and split back head (used for pulling nails). In fact, the usefulness of its back head for combat is debatable at least. On the other hand, it is smaller and lighter than some other craftman's hammers, and less scary than a true war hammer, so its place on the axis may be justified.&lt;br /&gt;
;Circular saw&lt;br /&gt;
:A {{w|circular saw}} is using a, mostly electric powered, fast-revolving toothed disc to cut materials. A stationary version is called a ''table saw'' but the figure of Thor drawn above presents him using a lighter hand-held version making a buzzing sound. Since the power of the saw is far beyond the human power it is quite a dangerous tool and could be fatal to the user himself. However, it would be rather unwieldy in combat, as it is quite heavy and bulky, and usually requires both hands to operate. Also, electric circular saw would be limited by its cord length, however cordless (battery-operated) saws exist today. This item could be a mock reference to a common trope in horror movies or computer games, when a {{w|chainsaw}} (not a circular saw) is used a weapon.&lt;br /&gt;
;Shovel&lt;br /&gt;
:A {{w|shovel}} is also a historic tool. It can be used to dig into the ground, move snow or dirt, harvest, and much more. Because it has a relatively thin, sharp metal blade at the end of a pole, it can be used as a weapon of opportunity. Indeed, a small (sometimes foldable), sturdy {{w|Entrenching tool|spade}} was and still is a standard issue item for an infantryman in some countries, intended mainly for entrenching work, but also usable as a weapon &amp;amp;ndash; and the soldiers are trained to use it as such, sometimes to a high skill, specifically among special forces. It is rumored that Russian Spetznaz operators are specifically trained to use their spades as throwing weapons. It is therefore more useful in combat than a circular saw &amp;amp;ndash; but may be seen as less scary.&lt;br /&gt;
;Jackhammer&lt;br /&gt;
:A {{w|jackhammer}} is a power tool used to drill and crush hard but brittle materials like stone, concrete etc. It has heavy body with a protruding shaft that makes hard and rapid back-and-forth (and optionally also rotary) movements that drive an implement (a drill, a chisel etc.) into the worked material. Like the circular saw jackhammer is a tool that is powered far beyond single human capabilities. Most jackhammers are very heavy and can be reasonably used only in a facing-down position to work on floors, pavements and other near-horizontal surfaces, nullifying combat application. However, since Thor is purportedly very strong, he may be able to hold it horizontally for some combat...&lt;br /&gt;
;Socket wrench&lt;br /&gt;
:A handle attached to a {{w|socket wrench}} is mostly used to tighten bolts or nuts. But since it is quite heavy and resembles a hammer it could also be used in a similar fashion. It may be a self-reference to [[538: Security|comic 538]].&lt;br /&gt;
;Bolt cutters&lt;br /&gt;
:{{w|Bolt cutters}} are cutters with very long handles, typically 2 or 3 feet long, and comparatively tiny jaws. The length of the handles provides the user enough mechanical advantage to sheer through things like bolts, chain links, and lock shackles. Although this tool can cut some fairly tough objects, its usefulness in combat is limited &amp;amp;ndash; as far as the cutting action goes at least. On the other hand they are quite heavy and can be used as a blunt weapon.&lt;br /&gt;
;Hacksaw&lt;br /&gt;
:A {{w|hacksaw}} is a type of hand saw with very small teeth. Hacksaws are well suited to cutting materials like metal and plastic, where the larger teeth of a wood saw would tend to bind or damage the material around the cut. Hacksaw blades are fairly unlikely to seriously injure people, though a hacksaw may be useful against metal baddies like Ultron.&lt;br /&gt;
;Nail gun&lt;br /&gt;
:A {{w|nail gun}} is a tool for driving nails or other fasteners into various materials ranging from soft wood to hard concrete by a single powerful &amp;quot;shot&amp;quot; to the nail being driven. There are models powered by compressed air, electricity (several types of mechanisms) or explosive charges similar to firearm ammunition (most often compatible with {{w|.22 Short}} blank cartridges). They are normally used by slightly pushing the &amp;quot;nozzle&amp;quot; against an object, disengaging a safety nose contact mechanism, and pulling the trigger. These are quite dangerous tools and can be potentially modified &amp;amp;ndash; by removing safety mechanisms &amp;amp;ndash; to act similarly to a handgun, shooting nails as high-speed projectiles. It's place in the middle of the axis seems not right compared to the work hazard level of other tools placed left of it. If safety mechanisms are left intact, a nail gun would need to be used in close combat by pressing it against an opponent which would make it difficult to apply, but if applied successfully it would inflict grievous wounds.&lt;br /&gt;
;Staple gun&lt;br /&gt;
: A {{w|staple gun}} is a tool used to drive {{w|Staple (fastener)|staples}} (C-shaped pieces of hard wire) into relatively soft materials such as wood, plastics and light masonry in order to fix something to them. There exist spring-loaded hand-operated staple guns as well as power ones utilizing either electricity or compressed air. The power discharged during staple action is a lot less than that of a nail gun and would inflict minor skin wounds at most. If one manages to eject a staple into the air (not against an object) it won't travel very far. A figure of Thor is drawn above the axis showing him using a staple gun this way, with staples falling short onto the ground. The gun held by Thor makes ''kachunk'' sounds characteristic for a spring-loaded version of the tool.&lt;br /&gt;
;Coping saw&lt;br /&gt;
;Screwdriver (flat)&lt;br /&gt;
:A (flat) {{w|screwdriver}} is a metal rod with a handle, flattened and ground at the other end to form a fairly sharp but short edge perpendicular to the rod. It is normally used to drive {{w|Screw|screws}} into a material, by putting the edge into a groove on the screw's head and turning it while pressing firmly. It is not very dangerous normally, but many people have cut their fingers while driving screws in. It could potentially be used as a stabbing weapon similarly to a dagger, but much less effectively, or alternatively the heavy handle may be used as a bludgeon, though the smooth rod would be difficult to grip. Some nations seem to regard it so much dangerous as to ban its possession in public along knives.&lt;br /&gt;
;Ball-peen hammer&lt;br /&gt;
;Screwdriver (Phillips)&lt;br /&gt;
:Similar to a flat screwdriver, but with a cross-shaped tip, designed to drive screws with matching cross-shaped heads.  While a Phillips screwdriver could potentially be used as an improvised weapon to stab or strike like a flat screwdriver, the blunter, cross shape is less likely to inflict cutting injury, likely leading to its lower position on the list.&lt;br /&gt;
;Awl&lt;br /&gt;
:An {{w|Stitching awl|awl}} is a hand tool, basically a rather short, thin, sharp (sometimes curved) spike with a handle. It is used for punching holes through soft material (leather, fabrics) or to {{w|Scratch awl|mark points}} or lines on wood or metal to assist further work such as cutting or drilling. In a pinch, it could be used as a stabbing weapon like a dagger, but a screwdriver is more sturdy for such purpose.&lt;br /&gt;
;Digital Caliper &lt;br /&gt;
:{{w|Digital calipers}} are an instrument for precisely measuring the dimensions of small objects. Typically, digital calipers can measure inner diameters, outer diameters, and depth. The reason they are considered more formidable than Dremels and planes is likely how supprisingly sharp the calipers are. They need to be sharp to make accurate measurements, but it is not uncommon for people to cut themselves while using a digital caliper.&lt;br /&gt;
;Dremel&lt;br /&gt;
:Dremel is a brand name (often used in a generic sense) of small {{w|Die grinder|rotary power tools}} that can be used in precise work involving small objects such as engraving, milling, drilling, grinding, cutting, polishing etc. It consists of a relatively small and lightweight body housing a high-speed electric motor driving a shaft equipped with a {{w|Chuck (engineering)|chuck}}. Various implements can be fixed to the chuck &amp;amp;ndash; drills, milling cutters of various shapes, small cutting disks, grinding stones, brushes, soft polishing disks etc. Typically the tool is used handheld against an object held in a vice. It can also be mounted in a stand with a {{w|flexible shaft}} attached, at the other end of which an implement is fixed in a chuck, allowing for still more precise work. A Dremel would be rather useless in combat, effecting in superficial wounds only. It could be seen as a baby circular saw, therefore much less scary and placed much more to the right of the scale. However, it is still a heavy object with a firm grip, and could plausibly be wielded as a bludgeon, making it slightly more effective than a plane.&lt;br /&gt;
;Plane&lt;br /&gt;
:A {{w|Plane_(tool)|hand plane}} is a tool for shaping wood using muscle power to force the cutting blade over the wood surface.  It is designed to scrape layers of wood off the surface.  While a plane does have a sharp edge and can cause painful injuries if misused, its awkward shape and the small size of the cutting edge would make it impractical to wield and nearly useless as a combat weapon, even for bludgeoning.  A hand plane could plausibly be used as a particularly brutal ''torture'' device on a restrained victim, but as Thor is typically depicted as an honorable and heroic character it is unlikely that he would use one in this manner.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
&lt;br /&gt;
:[A wide image is shown in a single frame.]&lt;br /&gt;
:Hand tools Thor could have ended up with&lt;br /&gt;
:[Below is a small centered horizontal line with arrows at both ends, labeled &amp;quot;Best&amp;quot; to the left and &amp;quot;Worst&amp;quot; on the right.]&lt;br /&gt;
&lt;br /&gt;
:[The rest of the image shows an other horizontal line in the middle, also with arrows at both ends, covering the full width. Items are marked by a dot with a text above or below, and sometimes a figure wearing a winged helmet, above the line, uses a tool mentioned below:]&lt;br /&gt;
:Hammer&lt;br /&gt;
:Axe&lt;br /&gt;
:Claw hammer&lt;br /&gt;
:Circular saw&lt;br /&gt;
:[Above, the winged helmet guy uses a circular saw:]&lt;br /&gt;
:''Bzzzz zzzz''&lt;br /&gt;
:Shovel&lt;br /&gt;
:Jackhammer&lt;br /&gt;
:Socket wrench&lt;br /&gt;
:[Above, the winged helmet guy spins the socket of a socket wrench with a tiny sound.]&lt;br /&gt;
:Bolt cutters&lt;br /&gt;
:Hacksaw&lt;br /&gt;
:Nail gun&lt;br /&gt;
:Staple gun&lt;br /&gt;
:[Above, the winged helmet guy fires staples into the ground in front of him:]&lt;br /&gt;
:''Kachunk kachunk''&lt;br /&gt;
:Coping saw&lt;br /&gt;
:Screwdriver (flat)&lt;br /&gt;
:Ball-peen hammer&lt;br /&gt;
:Screwdriver (Phillips)&lt;br /&gt;
:Awl&lt;br /&gt;
:Digital Caliper&lt;br /&gt;
:Dremel&lt;br /&gt;
:[Above, the winged helmet guy shows a running Dremel to the left:]&lt;br /&gt;
:''Bzzzzz''&lt;br /&gt;
:Plane&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2097:_Thor_Tools&amp;diff=168063</id>
		<title>2097: Thor Tools</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2097:_Thor_Tools&amp;diff=168063"/>
				<updated>2019-01-13T08:48:48Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: &amp;quot;best known&amp;quot;?&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2097&lt;br /&gt;
| date      = January 11, 2019&lt;br /&gt;
| title     = Thor Tools&lt;br /&gt;
| image     = thor_tools.png&lt;br /&gt;
| titletext = CORRECTION: After careful evaluation, we have determined that the axis label on this chart was printed backward.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Add a list of the tools in the comic. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
In Norse mythology, {{w|Thor}} is (in Scandinavian languages) the name of a god of thunder and lightning. His signature weapon is a magic hammer called {{w|Mjölnir}}. In popular culture, he might be best known for his role in {{w|Thor (Marvel Comics)|Marvel comics and films}}, which his appearance here seems to be referencing.  In the Marvel Cinematic Universe movie, Avengers: Infinity War, Thor also wields an axe named Stormbreaker.&lt;br /&gt;
&lt;br /&gt;
Although this hammer was historically a weapon, this comic interprets it as it would more commonly be interpeted today -- as a tool.  The comic is listing various hand tools in order of utility and viability as Thor's weapon, besides his actual, enchanted hammer. Hammers are heavy, blunt, and can do large amounts of damage to an opponent, whereas a hand plane is sharp, but only in one place, and will only inflict surface wounds. &lt;br /&gt;
&lt;br /&gt;
Some of these tools require power, which would generally require Thor to stay near an outlet or keep a battery charging, such as the circular saw, or Dremel. However, being the god of lightning may allow him to circumvent this, by producing electricity for the direct current (D.C.) tools, although he would need an inverter to convert the lightning (D.C.) to alternating current (A.C.) for the tools requiring it. Thor would also need compressed air for the nail gun or jackhammer, only allowing Thor so many shots before reloading the air tank at an outlet, or via a concentrated wind storm.&lt;br /&gt;
&lt;br /&gt;
The nail gun and staple gun would also require nails or staples respectively to function as a weapon. Although Mjölnir is believed to return to Thor if thrown, it's not clear how similar system could work with nails and staples.&lt;br /&gt;
&lt;br /&gt;
The usefulness of the nail gun as a weapon might depend on whether it was an older one that can be bump-fired or a newer one that requires a separate trigger pull for each nail.&lt;br /&gt;
&lt;br /&gt;
In the title text, [[Randall]] writes that the order of the axis label should be reversed, making the plane the best tool and Mjölnir the worst.  Considering that the title of the comic is &amp;quot;Thor Tools&amp;quot; (&amp;quot;tools&amp;quot;, instead of &amp;quot;weapons&amp;quot;), the argument seems to be that a hammer is less useful than the rest, by seeing them as tools and not as weapons.&lt;br /&gt;
&lt;br /&gt;
A few other interpretations of this could be:&lt;br /&gt;
* Randall proposes that Thor armed with a plane or digital calipers would be much more fearsome than with a hammer.&lt;br /&gt;
* The &amp;quot;value&amp;quot; of the more strange-seeming items would be much higher than his traditional hammer, perhaps more gory or more humorous.&lt;br /&gt;
* Thor tends to cause collateral damage, and would cause less with a plane or calipers.&lt;br /&gt;
* &amp;quot;Best&amp;quot; and &amp;quot;worst&amp;quot; are to be interpreted for Thor's enemies rather than Thor himself.&lt;br /&gt;
* Randall might just find the idea of Thor wielding a Plane as a weapon to be really funny.&lt;br /&gt;
&lt;br /&gt;
The title may be a reference to Gary Larson's ''The Far Side'' comic, ''Cow Tools''.&lt;br /&gt;
&lt;br /&gt;
===List of tools===&lt;br /&gt;
&lt;br /&gt;
All shown tools are explained below:&lt;br /&gt;
;Hammer&lt;br /&gt;
:A {{w|hammer}} ''is a tool consisting of a weighted &amp;quot;head&amp;quot; fixed to a long handle that is swung to deliver an impact to a small area of an object''. Thor was a hammer-wielding god and produced the lighting by using this tool.&lt;br /&gt;
;Axe&lt;br /&gt;
:An {{w|Axe}} or just Ax is another old human tool used to split and cut wood, but it also was used as a dangerous weapon upon the medieval times.&lt;br /&gt;
;Claw hammer&lt;br /&gt;
:A {{w|claw hammer}} is a hammer tool primarily used for driving nails into other objects, but also for pulling nails from them.&lt;br /&gt;
;Circular saw&lt;br /&gt;
:A {{w|circular saw}} is using a, mostly electric powered toothed disc to cut materials. A stationary version is called a ''table saw'' but this one is only attached to a human hand. And since the power of the saw is far beyond the human power it could be lethal to the user itself.&lt;br /&gt;
;Shovel&lt;br /&gt;
:A {{w|shovel}} at the next is also a historic tool. It can be used to dig into the ground, moving snow, harvesting, and much more.&lt;br /&gt;
;Jackhammer&lt;br /&gt;
:Like the circular saw a {{w|jackhammer}} is a tool that is powered far beyond single human capabilities. It not only can destroy concrete.&lt;br /&gt;
;Socket wrench&lt;br /&gt;
:An attached handle to a {{w|socket wrench}} is mostly used to tighten bolts or nuts. But since its socket together with the wrench resembles the physical conditions like a hammer it also could be used similar...&lt;br /&gt;
;Bolt cutters&lt;br /&gt;
;Hacksaw&lt;br /&gt;
;Nail gun&lt;br /&gt;
;Staple gun&lt;br /&gt;
;Coping saw&lt;br /&gt;
;Screwdriver (flat)&lt;br /&gt;
;Ball-peen hammer&lt;br /&gt;
;Screwdriver (Phillips)&lt;br /&gt;
;Awl&lt;br /&gt;
;Digital Caliper&lt;br /&gt;
;Dremel&lt;br /&gt;
;Plane&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Please check typos. Do NOT delete this tag too soon.}}&lt;br /&gt;
:[A wide image is shown in a single frame.]&lt;br /&gt;
:Hand tools Thor could have ended up with&lt;br /&gt;
:[Below is a small centered horizontal line with arrows at both ends, labeled &amp;quot;Best&amp;quot; to the left and &amp;quot;Worst&amp;quot; on the right.]&lt;br /&gt;
&lt;br /&gt;
:[The rest of the image shows an other horizontal line in the middle, also with arrows at both ends, covering the full width. Items are marked by a dot with a text above or below, and sometimes a figure wearing a winged helmet, above the line, uses a tool mentioned below:]&lt;br /&gt;
:Hammer&lt;br /&gt;
:Axe&lt;br /&gt;
:Claw hammer&lt;br /&gt;
:Circular saw&lt;br /&gt;
:[Above, the winged helmet guy uses a circular saw:]&lt;br /&gt;
:''Bzzzz zzzz''&lt;br /&gt;
:Shovel&lt;br /&gt;
:Jackhammer&lt;br /&gt;
:Socket wrench&lt;br /&gt;
:[Above, the winged helmet guy spins the socket of a socket wrench with a tiny sound.]&lt;br /&gt;
:Bolt cutters&lt;br /&gt;
:Hacksaw&lt;br /&gt;
:Nail gun&lt;br /&gt;
:Staple gun&lt;br /&gt;
:[Above, the winged helmet guy fires staples into the ground in front of him:]&lt;br /&gt;
:''Kachunk kachunk''&lt;br /&gt;
:Coping saw&lt;br /&gt;
:Screwdriver (flat)&lt;br /&gt;
:Ball-peen hammer&lt;br /&gt;
:Screwdriver (Phillips)&lt;br /&gt;
:Awl&lt;br /&gt;
:Digital Caliper&lt;br /&gt;
:Dremel&lt;br /&gt;
:[Above, the winged helmet guy shows a running Dremel to the left:]&lt;br /&gt;
:''Bzzzzz''&lt;br /&gt;
:Plane&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2083:_Laptop_Issues&amp;diff=166874</id>
		<title>2083: Laptop Issues</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2083:_Laptop_Issues&amp;diff=166874"/>
				<updated>2018-12-11T07:49:50Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2083&lt;br /&gt;
| date      = December 10, 2018&lt;br /&gt;
| title     = Laptop Issues&lt;br /&gt;
| image     = laptop_issues.png&lt;br /&gt;
| titletext = Hang on, we got a call from the feds. They say we can do whatever with him, but the EPA doesn't want that laptop in the ocean. They're sending a team.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Explanations and titles thereof could be improved. Table was removed by a new user. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
[[Cueball]] goes to tech support with his laptop. [[Hairy]] and [[Ponytail]] are waiting behind the counter; one has dealt with [[:Category:Cueball Computer Problems|Cueball's bizarre tech issues]] before, and warns the other. Sure enough, Cueball sets the computer down and offers a detailed list of the arcane problems his computer is giving him.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
; ''My laptop's battery won't hold a charge.''&lt;br /&gt;
: A common problem; as batteries are frequently charged and recharged, their capacity for storing charge deteriorates. However...&lt;br /&gt;
&lt;br /&gt;
; ''Tried [replacing the battery]. Now the new ones won't either.''&lt;br /&gt;
: ...the problem persisting despite the battery's replacement fails to make any significant sense. It may be a problem with his laptop's charging port, but his comment that the &amp;quot;new ones&amp;quot; now fail to hold a charge seems to imply it is persisting despite the replacement batteries being used elsewhere after attempting to use them for his laptop and failing... Many modern batteries have firmware built in now that reports their charge level. It is possible that his laptop is installing a faulty firmware to any batteries that get connected.&lt;br /&gt;
&lt;br /&gt;
; ''Also, random files get corrupted on the first of every month. Factory reset didn't help either.''&lt;br /&gt;
: Some devices may be scheduled to do a &amp;quot;disk cleanup&amp;quot; on the first of every month. Somehow, this task is corrupting files that should be kept.&lt;br /&gt;
&lt;br /&gt;
; ''When it's plugged in, I get static from my plumbing.''&lt;br /&gt;
: Static charge from a portable device while it's charging is common. Static charge from ''elsewhere in the building'' while the portable device is charging... not so much. However, plumbing systems on older houses were often used to provide a ground instead of using grounding rods, which are now the accepted norm. This could imply that for Cueball's house is old, and for some reason his laptop is pumping a large amount of charge directly to ground.&lt;br /&gt;
&lt;br /&gt;
; ''And it reboots if someone uses an arc welder nearby''&lt;br /&gt;
: The high power draw of an arc welder will occasionally cause less devoted power supplies to flicker. Coupled with the bad battery that can not keep the computer running when the power dips, this is causing his laptop to reboot. This could also be just because the arc welder is causing a large amount of electromagnetic interference.&lt;br /&gt;
&lt;br /&gt;
; ''Transition® lenses go dark when exposed to the screen''&lt;br /&gt;
: Transition lenses in prescription glasses darken when exposed directly to UV rays; this is to avoid the wearer any hassle of needing prescription sunglasses. This seems to indicate that the screen of Cueball's laptop is emitting UV radiation.&lt;br /&gt;
&lt;br /&gt;
; ''and when I open too many tabs, it fogs any nearby photographic film.''&lt;br /&gt;
: The screen would have to be emitting X-rays that can pass through the film's container and expose the film.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
The sheer incongruity of everything Cueball has reported, in combination with past issues, leads Hairy to report that his manager has authorized Cueball and his laptop be thrown into the ocean so that their plague upon the earth may no longer spread. Cueball, having surrendered to his inability to use technology, accepts this without objection. This is a reference to [[1912:_Thermostat|1912: Thermostat]], where Cueball has an issue with their thermostat, and the Tech support employee asks them if they have tried walking into the sea. It seems this suggestion has evolved into forcefully throwing him into the sea, for lack of a better idea.&lt;br /&gt;
&lt;br /&gt;
The alt-text contains mention of the Environmental Protection Agency, (EPA) a part of the United States government responsible for preventing pollution. In real life, most of a laptop computer's components are considered toxic waste, and the EPA, as part of their mission, would not want it dumped in the ocean. More to the point, it's implied that whatever Cueball did to it renders it far more dangerous than an ordinary laptop, and the EPA ''really'' doesn't want his cursed possessions in the ocean; thus they are sending a [https://bit.ly/1OYyJZ6 hazmat] team to collect the laptop and safely dispose of it.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
:[Cueball is walking past a sign reading &amp;quot;Tech Support,&amp;quot; with a right-pointing arrow and carrying a laptop.]&lt;br /&gt;
:Off panel voice #1: ''Oh no.''&lt;br /&gt;
:Off panel voice #2: ''What?''&lt;br /&gt;
:Off panel voice #1: ''This guy.  He has the worst tech problems.''&lt;br /&gt;
&lt;br /&gt;
:[Cueball at tech support desk with an open laptop facing Hairy and Ponytail.]&lt;br /&gt;
:Cueball: My laptop's battery won't hold a charge.&lt;br /&gt;
:Hairy: We can replace it.&lt;br /&gt;
:Cueball: Tried that.  Now the new ones won't either.&lt;br /&gt;
&lt;br /&gt;
:[Close-up of Cueball]&lt;br /&gt;
:Cueball: Also, random files get corrupted on the first day of every month.  Factory reset didn't help.&lt;br /&gt;
:Off panel voice #2: ''You weren't kidding.''&lt;br /&gt;
&lt;br /&gt;
:[Close-up of Cueball]&lt;br /&gt;
:Cueball: When it's plugged in, I get static shocks from my plumbing.&lt;br /&gt;
:Off panel voice: What the...&lt;br /&gt;
:Cueball: And it reboots if someone uses an arc welder nearby.&lt;br /&gt;
&lt;br /&gt;
:[Same tableau as second panel except that the laptop is slightly open now.]&lt;br /&gt;
:Cueball: Transitions® lenses go dark when exposed to the screen, and when I open too many tabs, it fogs nearby photographic film.&lt;br /&gt;
:Hairy: We don't usually do this, but I've gotten permission from my manager to have you and the laptop hurled into the ocean.&lt;br /&gt;
:Cueball: That's probably for the best.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Cueball Computer Problems]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2079:_Alpha_Centauri&amp;diff=166589</id>
		<title>2079: Alpha Centauri</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2079:_Alpha_Centauri&amp;diff=166589"/>
				<updated>2018-12-03T15:01:00Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2079&lt;br /&gt;
| date      = November 30, 2018&lt;br /&gt;
| title     = Alpha Centauri&lt;br /&gt;
| image     = alpha_centauri.png&lt;br /&gt;
| titletext = And let's be honest, it's more like two and a half stars. Proxima is barely a star and barely bound to the system.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by a SOLAR SAIL. It would be good to enumerate similar projects. Do NOT delete this tag too soon.}}&lt;br /&gt;
{{w|Alpha Centauri}} is the closest star system to our solar system, being 4.37 {{w|light-year}}s away. As such, there are numerous ongoing plans and projects to journey to, and explore the star system, especially since the exoplanet {{w|Proxima Centauri b}} was found in 2016 to possibly have liquid water oceans and a very thin atmosphere. Ponytail announces such a project using a {{w|Voyager program|Voyager}}-like probe.&lt;br /&gt;
&lt;br /&gt;
However, an offscreen person is against her idea, based on her opinion that &amp;quot;Alpha Centauri sucks&amp;quot;. The person says that they looked &amp;quot;online&amp;quot; and that the system &amp;quot;only has three stars&amp;quot;. This is a pun playing on the stars used in online reviews and stars in the solar system. &lt;br /&gt;
&lt;br /&gt;
===Star Rating Systems===&lt;br /&gt;
Online rating systems, such as {{w|Yelp}}, often use {{w|Star (classification)|star rating system}}s, with more stars indicating higher quality, up to an arbitrary maximum, such as five stars to indicate the best rating. Due to [https://www.explainxkcd.com/wiki/index.php/937:_TornadoGuard the nature of 5 star rating systems], [https://www.explainxkcd.com/wiki/index.php/1098:_Star_Ratings anything scoring less than 4 out of 5 in a 5 star rating system is crap]; and in a 10-star rating system, scoring a mere 3 stars out of a possible 10 stars would be ''exceedingly'' low quality. The Alpha Centauri star system has 3 ''physical'' {{w|star}}s: Alpha Centauri A, Alpha Centauri B, and Proxima Centauri. The offscreen person has misconstrued this fact of the system as some kind of review.&lt;br /&gt;
&lt;br /&gt;
A previous comic, [[1098: Star Ratings]], points out that star ratings below 4 out of 5 tend to be seen as &amp;quot;crap&amp;quot;. &lt;br /&gt;
&lt;br /&gt;
The title text furthers the pun. Some online star rating systems also allow partial stars, such as a half-star, to allow more precision in rating (e.g. rating 2.5 stars instead of being forced to chose 3 stars or 2 stars), or display an average collective rating as partial stars (e.g. showing 2.5 stars when five people have rated 3 stars and five people have rated 2 stars). Alpha Centauri's &amp;quot;half star&amp;quot; refers to Proxima Centauri, a {{w|red dwarf}}, which is a type of low-mass star. According to the offscreen person, this barely qualifies it to be a star. Furthermore, Proxima Centauri is nearly 13,000 AU (0.21 light years) away from the other 2 stars in the system, so it was long unknown whether Proxima Centauri was gravitationally bound to the Alpha Centauri star system.&lt;br /&gt;
&lt;br /&gt;
===Calculations===&lt;br /&gt;
All numbers are rounded after subsequent calculations.&lt;br /&gt;
&lt;br /&gt;
According to [https://www.space.com/41447-parker-solar-probe-fastest-spacecraft-ever.html space.com] the fastest spacecraft ever will be the Parker Solar Probe which will reach 430,000 mph (692,000 km/h) as it reaches its closest point orbiting the sun. This is just over half of 1% of the needed speed of the Alpha Centauri vehicle proposed in the comic. The Voyager 1 spacecraft, launched in 1977, is currently traveling at about 38,000 mph (61,000 km/h).&lt;br /&gt;
&lt;br /&gt;
Distance to Alpha Centauri system = 4.367ly&lt;br /&gt;
&lt;br /&gt;
4.367 light years / 35 years = 0.12477ly per year&lt;br /&gt;
&lt;br /&gt;
0.12477 light years/year * 5.879e+12 miles/light year = 733,484,000,000 miles/year&lt;br /&gt;
&lt;br /&gt;
733,484,000,000 miles/year / 365 days/year / 24 hours/day = 83,000,000 Miles/hour / 1.60934 miles/kilometer = 134,000,000 Kilometers/hour&lt;br /&gt;
&lt;br /&gt;
The above math assumes a constant speed, and requires a speed of ~0.124855c.  Assuming a constant acceleration from rest (non-relativistic math follows):&lt;br /&gt;
&lt;br /&gt;
35*365.25*24*60*60 = 1.10e+9 seconds in 35 years&lt;br /&gt;
&lt;br /&gt;
4.367 * 5.879e+12 = 2.57e+13miles, 4.13e+13 km, 4.13e+16 m.&lt;br /&gt;
&lt;br /&gt;
x = 1/2*a*t&amp;lt;sup&amp;gt;2&amp;lt;/sup&amp;gt;&lt;br /&gt;
&lt;br /&gt;
a = 2*x*t &amp;lt;sup&amp;gt;-2&amp;lt;/sup&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Assuming constant acceleration to the halfway point and constant deceleration to the destination, (otherwise you streak through the system, barely observing anything):&lt;br /&gt;
&lt;br /&gt;
t&amp;lt;sub&amp;gt;trip&amp;lt;/sub&amp;gt; = 2*t&amp;lt;sub&amp;gt;halfway&amp;lt;/sub&amp;gt;&lt;br /&gt;
&lt;br /&gt;
a = 2*2.06e+16*(5.50e+8) &amp;lt;sup&amp;gt;-2&amp;lt;/sup&amp;gt; = 0.136 m/s&amp;lt;sup&amp;gt;2&amp;lt;/sup&amp;gt;, roughly 1/80 gravity.&lt;br /&gt;
&lt;br /&gt;
v&amp;lt;sub&amp;gt;halfway&amp;lt;/sub&amp;gt; = a*t&amp;lt;sub&amp;gt;halfway&amp;lt;/sub&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Top Speed: 75,000,000 m/s ~ 1/4*c. &lt;br /&gt;
&lt;br /&gt;
Assuming E = F*d, 0.136*1*4.13e+16 = 5.37e15 Joules will be required for each kilogram carried to Alpha Centauri in 35 years.  &lt;br /&gt;
&lt;br /&gt;
This would require an unimaginable amount of mass for a conventional chemical rocket, and is a completely impractical power requirement for any sort of passive solar sail concept.&lt;br /&gt;
 &lt;br /&gt;
Further, the top speed is fast enough to require a recalculation using relativistic physics to model the problem.  This means that the energy budget will need to increase, as the relativistic mass of the probe will increase, requiring more force (and thus more energy) to accelerate and decelerate near its top speed than this calculation returns.&lt;br /&gt;
&lt;br /&gt;
[https://en.wikipedia.org/wiki/Breakthrough_Starshot Active], laser based propulsion methods require currently non-existent and purely specualtive laser and materials technologies, as well as a powerplant equivalent to 12,500 of the [https://www.power-technology.com/features/feature-largest-nuclear-power-plants-world/ World's Largest Nuclear Plant] to transport sub-gram masses on this timescale.  This also assumes that any probes can be steered accurately enough across interstellar distances to come close enough to image with any resolution the bodies they will be passing at a non-trivial fraction of c. &lt;br /&gt;
&lt;br /&gt;
Short of FTL travel or near-perfect mass-energy conversion technology, transporting more than a fraction of a gram of material to Alpha Centauri in a human lifetime will be unachievable.  Short of an enormous breakthrough in power generation, transporting even a fraction of a gram is impossible.&lt;br /&gt;
&lt;br /&gt;
Nonetheless, [http://breakthroughinitiatives.org/challenges/3 Breakthrough Starshot] is attempting to send many gram-sized probes to Alpha Centauri within the century.  Following current technological trends, they expect the efficiency of laser-based propulsion to increase by launch time, allowing launches driven by an unreasonably-large-but-achievable amount of power.  The top speed needed is halved by refraining from slowing at all at the destination: the probes will aim a distance away from the target, so that it traverses by slowly enough for a camera to rotate and track it, even at near-light speeds.  To account for error and space dust, the plan is to launch many tiny probes simultaneously.  They may only be able to accomplish their goal if they can get enough funding to actually affect the global economy enough to make the technologies they require more efficient to produce.  Launches would additionally burn incredible quantities of natural gas.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Ponytail stands on a podium giving a presentation in front of a slide with an image of a [https://wikipedia.org/wiki/Voyager_1 Voyager-like] spacecraft.]&lt;br /&gt;
:Ponytail: Our probe can reach Alpha Centauri in under 35 years.&lt;br /&gt;
:Offscreen voice: We should go somewhere else.  Alpha Centauri sucks.&lt;br /&gt;
:Ponytail: Huh? It's the closest, most convenient system!&lt;br /&gt;
:Offscreen: Yeah, but I checked online and it only has three stars.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Ponytail]]&lt;br /&gt;
[[Category:Space probes]]&lt;br /&gt;
[[Category:Online reviews]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2060:_Hygrometer&amp;diff=164410</id>
		<title>2060: Hygrometer</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2060:_Hygrometer&amp;diff=164410"/>
				<updated>2018-10-19T12:22:54Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2060&lt;br /&gt;
| date      = October 17, 2018&lt;br /&gt;
| title     = Hygrometer&lt;br /&gt;
| image     = hygrometer.png&lt;br /&gt;
| titletext = I'm working on assembling a combination declinometer, sclerometer, viscometer, aleurometer, stalagmometer, and hypsometer. I'm making good progress according to my ometerometer, a device which shows the rate at which I'm acquiring measurement devices.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Please edit the explanation below and only mention here why it isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
Here, [[Megan]] is talking to [[Cueball]] about hygrometers. But before she can even finish explaining what it does, Cueball has looked up, found, and purchased the product. A {{w|hygrometer}} is an instrument for measuring the amount of water vapor in the atmosphere, or the amount of water in solids such as soil or wood.&lt;br /&gt;
&lt;br /&gt;
It seems Randall (as Cueball) loves being able to measure things and therefore finds instruments or measurement tools that end in ''-ometer'' very interesting, and wishes to own all of them. Many {{w|Measuring instrument|measuring instruments}} use the suffix ''-meter'' which is derived from the Greek noun ''μέτρον'' for &amp;quot;measure&amp;quot;. The character &amp;quot;o&amp;quot; always belongs to the first term, but it also belongs to old Greek words like ''thermo''-meter, ''micro''-meter, or even ''hygro''-meter. Other measurement devices such as speedometer use an English word with an &amp;quot;o&amp;quot; appended to mimic the Greek derived terms, purportedly for easier marketing. Because themes in science often based on Greek terminology that ending at the first part appears often. Nonetheless Randall believes that this &amp;quot;o&amp;quot; belongs to the general term for measuring devices.&lt;br /&gt;
&lt;br /&gt;
In the title text the author [[Randall]] states he is working on assembling a collection of measuring instruments. The list consists of:&lt;br /&gt;
&lt;br /&gt;
* A {{w|Declinometer|declinometer}} is an instrument to measure {{w|magnetic declination}}.&lt;br /&gt;
&lt;br /&gt;
*A {{w|sclerometer}} is an instrument to measure {{w|scratch hardness}} of a solid by scratching it under some standard conditions and measuring the scratch. Instruments used to measure the elastic properties of concrete surfaces, like the {{w|Schmidt hammer}}, [https://www.pce-instruments.com/english/measuring-instruments/test-meters/concrete-test-hammer-sclerometer-kat_162426_1.htm are also often known as sclerometers].&lt;br /&gt;
&lt;br /&gt;
*A {{w|viscometer}} is an instrument to test the viscosity (ease of pouring) of a liquid. For example, honey has higher viscosity than water.&lt;br /&gt;
&lt;br /&gt;
*An [https://en.wiktionary.org/wiki/aleurometer aleurometer] is an instrument to evaluate the quality of flour for baking by measuring how much a wet mass of wheat can expand when heated, while keeping its adhesivity.[https://de.wikipedia.org/wiki/Aleurometer]&lt;br /&gt;
&lt;br /&gt;
*A {{w|Stalagmometric method|stalagmometer}} is an instrument to measure {{w|surface tension}} of fluids by producing a drop and weighing it - the bigger the drop is, the larger surface tension the fluid has.&lt;br /&gt;
&lt;br /&gt;
*The word {{w|hypsometer}} could refer to either of [https://www.collinsdictionary.com/dictionary/english/hypsometer two unrelated instruments] to measure height. One measures heights of a building or a tree by triangulation. The other measures altitude by measuring air pressure through its effect on the boiling temperature of water. It should not be confused with the {{w|altimeter}} which measures altitude by mechanically measuring air pressure (and which also does not follow the -ometer rule and might therefore be of less interest to Cueball? Is that the reason why Cueball appears in [https://en.wikipedia.org/wiki/Hypsometer#/media/File:HypsometerGeometry.png a diagram] at the Wikipedia page for hypsometer but not for altimeter?).&lt;br /&gt;
&lt;br /&gt;
*An ometerometer, being a concatenation of ''-ometer'' with itself, would be a device for measuring measuring devices. &lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
:[Megan and Cueball are walking and talking. Cueball is holding his phone with one hand, looking at it.]&lt;br /&gt;
:Megan: ...A hygrometer is a device for measuring—&lt;br /&gt;
:Cueball: ''I want one!'' Ooh, found one for $7.99 with free shipping! I'm buying it.&lt;br /&gt;
:Megan: —Humidity.&lt;br /&gt;
:Cueball: Oh, cool!&lt;br /&gt;
&lt;br /&gt;
:[Caption below the frame:]&lt;br /&gt;
:For some reason, I feel a powerful compulsion to own any device whose name ends in &amp;quot;-ometer.&amp;quot;&lt;br /&gt;
&lt;br /&gt;
==Trivia==&lt;br /&gt;
*The ometerometer has previously been included in a humourous list of [http://bleeet.blogspot.com/2007/07/other-types-of-ometers.html Other Types of Ometers] from 2007, where it was described as measuring the measuring capacities of other measuring devices.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;br /&gt;
&lt;br /&gt;
[[Category:Comics featuring Megan]]&lt;br /&gt;
[[Category:Comics featuring Cueball]]&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=2046:_Trum-&amp;diff=162696</id>
		<title>2046: Trum-</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=2046:_Trum-&amp;diff=162696"/>
				<updated>2018-09-14T15:39:11Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 2046&lt;br /&gt;
| date      = September 14, 2018&lt;br /&gt;
| title     = Trum-&lt;br /&gt;
| image     = trum.png&lt;br /&gt;
| titletext = Excited to vote for future presidents Bill Eisenhamper, Amy Forb, Ethan Obample, and Abigail Washingtoast.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Please edit the explanation below and only mention here why it isn't complete. Do NOT delete this tag too soon.}}&lt;br /&gt;
Before Trump, Harry S. Truman (1884-1972) was president between 1945 and 1953. The joke is that of all the weird thinks in the present (Trump's) presidency, this is the less wierdest.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1998:_GDPR&amp;diff=157659</id>
		<title>1998: GDPR</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1998:_GDPR&amp;diff=157659"/>
				<updated>2018-05-25T19:53:49Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1998&lt;br /&gt;
| date      = May 25, 2018&lt;br /&gt;
| title     = GDPR&lt;br /&gt;
| image     = gdpr.png&lt;br /&gt;
| titletext = By clicking anywhere, scrolling, or closing this notification, you agree to be legally bound by the witch Sycorax within a cloven pine.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by the EUROPEAN UNION - Please change this comment when editing this page. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
This comic was released on the date on which the [https://en.wikipedia.org/wiki/General_Data_Protection_Regulation General Data Protection Regulation] law went into effect.  Most people will have already seen a large number of updated privacy policies in the week or two leading up to this law going active.  And while XKCD would likely be outside of the jurisdiction that the law can enforce, it technically does fall within the scope of the law (as certainly EU citizens visit xkcd).&lt;br /&gt;
&lt;br /&gt;
There are several references made to this law, but also several jokes are included about the way people treat privacy policies specifically, and user agreements in general.&lt;br /&gt;
&lt;br /&gt;
The title text is a reference to Shakespeare's &amp;quot;[https://en.wikipedia.org/wiki/The_Tempest The Tempest]&amp;quot;, in which the witch [https://en.wikipedia.org/wiki/Sycorax Sycorax] imprisoned the sprite Ariel in a cloven pine prior to Ariel's rescue by Prospero.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
'''PRIVACY POLICY'''&lt;br /&gt;
&lt;br /&gt;
We've updated our privacy policy. This is purely out of the goodness of our hearts, and has nothing to do with any hypothetical unions on any particular continents. Please read every part of this policy carefully, and don't just skip ahead looking for sex scenes.&lt;br /&gt;
&lt;br /&gt;
This policy governs your interactions with this website, herein referred to as &amp;quot;The Service&amp;quot;, &amp;quot;The Website&amp;quot;, &amp;quot;The Internet&amp;quot;, or &amp;quot;Facebook&amp;quot;, and with all other websites and organizations of any kind. The Enumeration in this policy, of certain rights, shall not be construed to deny or disparage other retained by the users. By using this service, you opt in to quartering troops in your home.&lt;br /&gt;
&lt;br /&gt;
'''YOUR PERSONAL INFORMATION'''&lt;br /&gt;
&lt;br /&gt;
Please don't end us your personal information. We do not want your personal information. We have a hard enough time keeping track of our ''own'' personal information, let alone yours.&lt;br /&gt;
&lt;br /&gt;
If you tell us your name, or any identifying information, we will forget it immediately. The next time we see you we'll struggle to remember who you are, and try desperately to get through the conversation so we can go online and hopefully figure it out.&lt;br /&gt;
&lt;br /&gt;
'''TRACKING PIXELS, COOKIES, AND BEACONS'''&lt;br /&gt;
&lt;br /&gt;
This website places pixels on your screen in order to form text and images, some of which may remain in your memory after you close the page. We use cookies to enhance your performance. Our website may use local storage on your device if we run low on space on our end. We may use beacons to call Rohan for aid.&lt;br /&gt;
&lt;br /&gt;
'''3RD PARTY EXTENSIONS'''&lt;br /&gt;
&lt;br /&gt;
This service may utilize 3rd party extensions in order to play the song '''''CAN U FEEL IT''''' from their debut album '''''ALIVE'''''.&lt;br /&gt;
&lt;br /&gt;
'''PERMISSION'''&lt;br /&gt;
&lt;br /&gt;
For users who are citizens of the European Union, we will now be requesting permission before initiating organ harvesting.&lt;br /&gt;
&lt;br /&gt;
'''SCOPE AND LIMITATIONS'''&lt;br /&gt;
&lt;br /&gt;
This policy supersedes any application federal, state, and local laws, regulations and ordinances, international treaties, and legal agreements that would otherwise apply. If any provision of this policy is found by a court to be unenforceable, it nevertheless remains in force.&lt;br /&gt;
&lt;br /&gt;
This organization is not liable and this agreement shall not be construed. These statements have not been evaluated by the FDA. This website is intended to treat, cure  and prevent any disease.&lt;br /&gt;
&lt;br /&gt;
If you know anyone in Europe, please tell them we're cool.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	<entry>
		<id>https://www.explainxkcd.com/wiki/index.php?title=1998:_GDPR&amp;diff=157658</id>
		<title>1998: GDPR</title>
		<link rel="alternate" type="text/html" href="https://www.explainxkcd.com/wiki/index.php?title=1998:_GDPR&amp;diff=157658"/>
				<updated>2018-05-25T19:51:47Z</updated>
		
		<summary type="html">&lt;p&gt;Jkrstrt: /* Explanation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{comic&lt;br /&gt;
| number    = 1998&lt;br /&gt;
| date      = May 25, 2018&lt;br /&gt;
| title     = GDPR&lt;br /&gt;
| image     = gdpr.png&lt;br /&gt;
| titletext = By clicking anywhere, scrolling, or closing this notification, you agree to be legally bound by the witch Sycorax within a cloven pine.&lt;br /&gt;
}}&lt;br /&gt;
&lt;br /&gt;
==Explanation==&lt;br /&gt;
{{incomplete|Created by the EUROPEAN UNION - Please change this comment when editing this page. Do NOT delete this tag too soon.}}&lt;br /&gt;
&lt;br /&gt;
This comic was released on the date on which the [https://en.wikipedia.org/wiki/General_Data_Protection_Regulation General Data Protection Regulation] law went into effect.  Most people will have already seen a large number of updated privacy policies in the week or two leading up to this law going active.  And while XKCD would likely be outside of the jurisdiction that the law can enforce, it technically does fall within the scope of the law (as certainly EU citizens visit xkcd).&lt;br /&gt;
&lt;br /&gt;
There are several references made to this law, but also several jokes are included about the way people treat privacy policies specifically, and user agreements in general.&lt;br /&gt;
&lt;br /&gt;
The title text is a reference to Shakespeare's [https://en.wikipedia.org/wiki/The_Tempest &amp;quot;The Tempest&amp;quot;], in which the witch Sycorax imprisoned the sprite Ariel in a cloven pine prior to Ariel's rescue by Prospero.&lt;br /&gt;
&lt;br /&gt;
==Transcript==&lt;br /&gt;
{{incomplete transcript|Do NOT delete this tag too soon.}}&lt;br /&gt;
'''PRIVACY POLICY'''&lt;br /&gt;
&lt;br /&gt;
We've updated our privacy policy. This is purely out of the goodness of our hearts, and has nothing to do with any hypothetical unions on any particular continents. Please read every part of this policy carefully, and don't just skip ahead looking for sex scenes.&lt;br /&gt;
&lt;br /&gt;
This policy governs your interactions with this website, herein referred to as &amp;quot;The Service&amp;quot;, &amp;quot;The Website&amp;quot;, &amp;quot;The Internet&amp;quot;, or &amp;quot;Facebook&amp;quot;, and with all other websites and organizations of any kind. The Enumeration in this policy, of certain rights, shall not be construed to deny or disparage other retained by the users. By using this service, you opt in to quartering troops in your home.&lt;br /&gt;
&lt;br /&gt;
'''YOUR PERSONAL INFORMATION'''&lt;br /&gt;
&lt;br /&gt;
Please don't end us your personal information. We do not want your personal information. We have a hard enough time keeping track of our ''own'' personal information, let alone yours.&lt;br /&gt;
&lt;br /&gt;
If you tell us your name, or any identifying information, we will forget it immediately. The next time we see you we'll struggle to remember who you are, and try desperately to get through the conversation so we can go online and hopefully figure it out.&lt;br /&gt;
&lt;br /&gt;
'''TRACKING PIXELS, COOKIES, AND BEACONS'''&lt;br /&gt;
&lt;br /&gt;
This website places pixels on your screen in order to form text and images, some of which may remain in your memory after you close the page. We use cookies to enhance your performance. Our website may use local storage on your device if we run low on space on our end. We may use beacons to call Rohan for aid.&lt;br /&gt;
&lt;br /&gt;
'''3RD PARTY EXTENSIONS'''&lt;br /&gt;
&lt;br /&gt;
This service may utilize 3rd party extensions in order to play the song '''''CAN U FEEL IT''''' from their debut album '''''ALIVE'''''.&lt;br /&gt;
&lt;br /&gt;
'''PERMISSION'''&lt;br /&gt;
&lt;br /&gt;
For users who are citizens of the European Union, we will now be requesting permission before initiating organ harvesting.&lt;br /&gt;
&lt;br /&gt;
'''SCOPE AND LIMITATIONS'''&lt;br /&gt;
&lt;br /&gt;
This policy supersedes any application federal, state, and local laws, regulations and ordinances, international treaties, and legal agreements that would otherwise apply. If any provision of this policy is found by a court to be unenforceable, it nevertheless remains in force.&lt;br /&gt;
&lt;br /&gt;
This organization is not liable and this agreement shall not be construed. These statements have not been evaluated by the FDA. This website is intended to treat, cure  and prevent any disease.&lt;br /&gt;
&lt;br /&gt;
If you know anyone in Europe, please tell them we're cool.&lt;br /&gt;
&lt;br /&gt;
{{comic discussion}}&lt;/div&gt;</summary>
		<author><name>Jkrstrt</name></author>	</entry>

	</feed>