explain xkcd - User contributions [en]

2299: Coronavirus Genome 2

2020-04-28T16:44:03Z

PeterMortensen: /* Explanation */ Some copy editing (e.g. ref. <https://en.wikipedia.org/wiki/Internet> and <https://en.wiktionary.org/wiki/laudable#Adjective>).

{{comic
| number = 2299
| date = April 27, 2020
| title = Coronavirus Genome 2
| image = coronavirus_genome_2.png
| titletext = [moments later, checking phone] Okay, I agree my posting it was weird, but it's somehow even more unnerving that you immediately liked the post.
}}

==Explanation==
{{incomplete|Created by a SANITIZED PHONE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.

It is also a direct continuation of the previous comic, [[2298: Coronavirus Genome]], making this a [[:Category:Coronavirus Genome|new series]].

[[Megan]] sent her copy of the coronavirus genome to [[Cueball]], who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the Internet, though not in a form that can actually make people sick with COVID-19 (which may seem obvious, but then some people [https://www.forbes.com/sites/brucelee/2020/04/09/5g-networks-and-covid-19-coronavirus-here-are-the-latest-conspiracy-theories/ believe 5G causes coronavirus].) If his post catches on and is widely shared, it might be described as "going viral".

He first attempts to tweet it, but Twitter has a 280 character limit, and the coronavirus genome is much larger than that. He decides to use Facebook instead, which has a character limit of 63,206.

This strip draws humor from the contrast between the costly physical precautions that are being taken to prevent the spread of coronavirus between people and the blitheness with which Cueball attempts to share (the genome of) the coronavirus electronically. Cueball's response (that it's okay, because he sanitized his phone before posting) could be taken as a sarcastic rebuttal, given that Megan sent the genome to him without knowing why he wanted it, or a commentary on the useless or counterproductive behaviors of clueless people (e.g. people who wear gloves before touching potentially-contaminated surfaces, but then scratch their noses while still wearing the possibly-contaminated gloves).

The title text deals with the almost inevitable outcome of the resulting message being 'liked' by some other party. In this case Megan, although she just told Cueball it was weird that he shared it. Sometimes people ''like'' a social media posting for an element they appreciate, such as a well composed photograph, blind to the fact that they seem to be tacitly supporting the subject of the photo which may depict something not entirely laudable. "Liking" this message, which defines a potentially deadly disease, may seem to be even more misanthropic of the liker.

==Transcript==
:[Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.]
:Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?
:Megan: Sure.
:Megan: ...Why?

:[Megan has turned to her her laptop typing on it, Cueball is off-panel.]
:Cueball (off-panel): Nothing.
:Megan: I ... see.
:Megan: Well, here you go.
:Laptop: Click

:[In "two" frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square "speech bubble" with a "speech line" going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.]
:Phone:
::GAAAGGTAAGATGGAGAGGCCTTGTC
:<div style="background-color:red; padding:5px; width:fit-content; margin-left: 2em">CCTGGTTCAACGAGAA</div>
::-29,602 (+)
:<div style="background-color:cyan; padding:5px; width:fit-content; margin-left: 2em">Tweet</div>

:[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]
:Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post.
:Megan: Unsettling that your first instinct is "share it online."
:Cueball: It's cool, I sanitized my phone before posting.

{{comic discussion}}

[[Category:Comics with color]]
[[Category:Coronavirus Genome]]
[[Category:Comics sharing name|Coronavirus Genome]]
[[Category:COVID-19]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Biology]]
[[Category:Social networking]]

541: TED Talk

2020-04-15T11:57:43Z

PeterMortensen: /* Explanation */ Grammar, etc.

{{comic
| number = 541
| date = February 9, 2009
| title = TED Talk
| image = ted_talk.png
| titletext = The IAU ban came after the 'redefinition of the 'planet' to include the IAU president's mom' incident.
}}

==Explanation==
The comics shows Randall as a presenter at the highly prestigious {{w|TED conference}}, a symposium about technology, entertainment and design. The illustrious {{w|list of TED speakers|list of former presenters}} includes amongst others Bill Clinton, Al Gore, Larry Page, Richard Dawkins and Gordon Brown. The conference is regarded as a forum for {{w|digerati}}. Every talk has a length of at most 20 minutes and is supposed to be as captivating as possible.

Randall's presentation, however, reduces the purpose of the conference to absurdity: The topic he wishes to point out to his listeners, is that of how to put an emoticon at the end of a parenthetical statement. This question is of little practical consequence, although it received a lot of attention after publication of the comic. In the last panel, the TED conference is another item to add to his list of conferences from which he has been banned. On the list are other conferences from all sorts of fields, including every American furry convention.

The title text about Randall's ban from the {{w|IAU}} conference is a reference to the popular maternal insults called {{w|Maternal insult|"yo momma" jokes}}. A common representative of the genre runs "Yo mama so fat, scientists have declared her the 10th planet." Those kind of jokes are a [[:Category:Your Mom|recurring theme]] on xkcd

It can be inferred from [[629: Skins]], that Randall was banned from North American furry conventions due to being a "Skin", which is a furry whose fursona prefers going around disguised as a human. Depending on Randall's behavior, such an action could generate a lot of drama and, presumably, lead to convention bans.

Getting banned from attending a conference is a [[:Category:Banned from conferences|recurring theme]] on xkcd. This was so far the last of six comics to directly mention conference banns. The first to do so was [[153: Cryptography]].

The {{w|PyCon}} organizers made a response to this comic - see below under [[#PyCon response|PyCon response]].

===Conferences where Randall is banned from===
Here is a list of the conferences Randall has been banned for according to this comic.
{| class="wikitable"
|-
! Conference
! Description
! Website
|-
| Siggraph
| Special Interest Group on Graphics and Interactive Techniques
| http://www.siggraph.org
|-
| Eurocrypt
| Annual International Conference on the Theory and Applications of Cryptographic Techniques
| http://www.iacr.org/meetings/eurocrypt/
|-
| Defcon
| DEF CON® Hacking Conference
| https://www.defcon.org/
|-
| Pycon
| Python Conference
| http://www.pycon.org/
|-
| International Astronomical Union
| The IAU's mission is to promote and safeguard the science of astronomy in all its aspects through international cooperation
| https://www.iau.org/science/meetings/
|-
| Canadian Paleontology Conference
| The main goal of the CPC and its predecessors has been to provide a relatively small, informal forum for presentation and discussion of current paleontological research
| http://www.gacpaleodivision.com/pd-meetings.html
|-
| Every American Furry Convention
| There are many Furry Conventions in America (see the [https://en.wikipedia.org/wiki/List_of_furry_conventions Wikipedia page] for more details), but to be banned from all of them would probably require action by the Furry Convention Leadership Roundtable, the coordinating body for furry conventions.
|
|-
| American Baking Society
(American Bakers Association)
| ABA represents the interests of bakers before the U.S. Congress, federal agencies, and international regulatory authorities
| http://www.americanbakers.org/meetings/
|-
| Asian Dolphin-Training Conference
| International Marine Animal Trainers' Association
| https://www.imata.org/
|-
| TED
| Technology, Entertainment, Design.
| https://ted.com
|}

==Transcript==
:[Randall, drawn as Cueball, on stage.]
:Randall: Hi. I'm Randall. Welcome to my TED talk.
:Randall: It's an honor to speak to you, some of the brightest innovators from so many fields, about a problem in desperate need of your attention:
:Randall: How DO you end parenthetical statements with emoticons? I can't figure out a good way.
:[Screen next to him shows two statements, both crossed out in red.]
:"Linux (or BSD :) would..." looks mismatched
:"Linux (or BSD :)) would..." looks mismatched and weird

:[Randall writing on a desk.]
:Randall's List - Conferences I'm banned from:
:Siggraph
:Eurocrypt
:Defcon
:Pycon
:International Astronomical Union
:Canadian Paleontology Conference
:Every American Furry Convention
:American Baking Society
:Asian Dolphin-Training Conference
:TED

==PyCon response==
In response to this comic, PyCon organizers jokingly [http://pycon.blogspot.com/2009/02/randall-munroe.html announced] that Randall Munroe was banned from PyCon 2009 due to "last year's disgraceful keynote, 'Web Spiders vs. Red Spiders'." They also said they instructed their volunteers to refuse admission to him and "any stick figures who may attempt to register, particularly if they are wearing hats."

Messages on the PyCon-Organizers mailing list show that this joke was intended to get Randall to come to PyCon: (The links will only work if you're subscribed to the mailing list.)
:PyCon mentioned briefly in today's xkcd:
:http://xkcd.com/541/
:We've still never gotten Randall Munroe to actually attend, have we? Anybody want to take charge of twisting his arm this time? I think we can still offer him a "press pass" (free registration). [...] [http://mail.python.org/mailman/private/pycon-organizers/2009-February/011224.html]
::An invite would seem most appropriate given the cartoon. :-)
::We could also have an official PyCon blog post confirming his ban... [http://mail.python.org/mailman/private/pycon-organizers/2009-February/011225.html]
:::How about a public blog post LIFTING the ban and inviting him? [http://mail.python.org/mailman/private/pycon-organizers/2009-February/011226.html]
::::Confirming the ban is far funnier... He's definitely a disturbing influence on programmers. [http://mail.python.org/mailman/private/pycon-organizers/2009-February/011227.html]
:::::Agreed, especially if we invite him concurrently with confirming the ban. [http://mail.python.org/mailman/private/pycon-organizers/2009-February/011239.html]
:::::(a few posts later)
:::::I'm happy to participate in actually throwing some thin guy out of the conference, and then get some graphics savvy person to animate a stick figure over that. :) [...][http://mail.python.org/mailman/private/pycon-organizers/2009-February/011274.html]
::::::here's a rough idea of what would show up if you invited him to actually do any speaking...
::::::http://www.youtube.com/watch?v=zJOS0sV2a24
::::::it's fairly long. he shows up in the beginning around 3:25. [http://mail.python.org/mailman/private/pycon-organizers/2009-February/011275.html]
:::::::For the record, I did try to convince him to come when got the art for the tshirt last year. He didn't seem super psyched, but then again emotions are hard to read via IRC.
:::::::I love the idea of "officially" banning him, however. ;-) [http://mail.python.org/mailman/private/pycon-organizers/2009-February/011241.html]
::::::::(a few posts later)
::::::::OK - posted to the PyCon blog, by the power vested in me as publicity chair. With Michael Foord's excellent sentence added.
::::::::Now let him know that since he's banned, he HAS to come. [http://mail.python.org/mailman/private/pycon-organizers/2009-February/011251.html]

==Trivia==

Randall has since this comic given a TED talk in March 2014. [https://www.ted.com/talks/randall_munroe_comics_that_ask_what_if Randall Munroe Comics that ask "what if?"].

{{comic discussion}}
[[Category:Comics featuring Randall Munroe]]
[[Category:Comics with color]]
[[Category:Furries]]
[[Category:Banned from conferences]]
[[Category:Your Mom]]

1833: Code Quality 3

2019-07-21T12:42:09Z

PeterMortensen: /* Explanation */ Spelling/case (ref. <https://en.wikipedia.org/wiki/JavaScript> and <http://en.wikipedia.org/wiki/Forth_%28programming_language%29>).

{{comic
| number = 1833
| date = May 5, 2017
| title = Code Quality 3
| image = code_quality_3.png
| titletext = It's like a half-solved cryptogram where the solution is a piece of FORTH code written by someone who doesn't know FORTH.
}}

==Explanation==
This comic is the third in the [[:Category:Code Quality|Code Quality]] series and is a direct continuation of [[1695: Code Quality 2]] released a good year before this one. It was followed
almost half a year later by [[1926: Bad Code]], where the name changed but the code quality did not. Again in this comic, as in the previous, Cueball does not directly appear, only speaking off-panel; however, as it is a continuation of the series, it is clear that this is Cueball's code.

In the first panel, Ponytail references {{w|query string|query strings}}, which store information, such as search queries or page numbers, relevant to the URL. Query strings are not meant to be especially human-readable, so a song based on one would likely not be a good one.

A tactical flashlight is a light that can be mounted on a gun for use in low-light scenarios. They tend to be very durable and very bright. Different models have different features and capabilities, so they are given cool-sounding model numbers. [http://www.json.org/ JSON] (JavaScript Object Notation) is a subset of JavaScript used, by many programming languages, as a convenient way of recording structured data. It's not clear what else would be in the table (tables typically have more than one column) and JSON technically has arrays and objects (dictionaries) but not tables, but a JSON array of objects of these model numbers would look something like:

[ { "model": "TACT X700"},
{ "model": "Atomic Beam USA 5000" },
{ "model": "E2D LED Defender" },
{ "model": "J5 Tactical V1-Pro" }
]

{{w|Alan Turing}} was a British theoretical computer scientist, often considered the father of the field. His [https://www.cs.virginia.edu/~robins/Turing_Paper_1936.pdf 1936 paper] outlined Turing machines, a theoretical model for computing, as well as computability and the halting problem. Theoretical computer science is very different from practical coding; understanding the contents of the paper would not at all help a coder to understand today's algorithms, design patterns, and best practices. This is not helped by a page of JavaScript example code. {{w|JavaScript}} is a popular programming language which makes web pages responsive to user inputs, and while JavaScript arguably solves the problem in a practical manner (as opposed to Turing's very theoretical work), it does get a lot of criticism - for instance it is {{w|Strong and weak typing|nearly untyped}}, which allows the programmer to do very interesting things, like {{w|JSFuck}}. Then, example code is used to explain a concept in programming or demonstrate how a program works, but it does not actually run on any computer. "Guessing everything in between" would involve attempting to write code using skills that could range anywhere from the most basic programming to Turing's extremely advanced ideas.

In the final panel, Ponytail references {{w|leet|leet-speak}}, in which symbols are replaced with similar-looking symbols, and a {{w|manifesto}}, a statement of a person or group's beliefs and intentions. A manifesto from a survivalist cult leader might be nonsensical, even before being translated to leet-speak. Memory allocation is a low-level computer programming concept; most modern languages have features that take care of memory allocation for the programmer, possibly implying that Cueball does not know how to use these features.

At this point Cueball, quickly becoming impatient with Ponytail's sass in what is supposed to be a formal code review, retorts that if she can't start giving him the constructive criticism that he's looking for, he can always find someone else to replace her. Ponytail smugly responds that nobody else would be able to stomach his code for more than one sitting, and that she's the only one he's got.

{{w|Forth_(programming_language)#Programmer.27s_perspective|Forth}} is an old programming language that tends to be difficult to read. It is stack-based, meaning that values to be operated on are moved on a {{w|Stack (abstract data type)|stack}} before the operation to be performed is given. Using stacks can be considered different from programming languages that resemble natural human language (e.g. {{w|COBOL}}). While stack-based computing makes some problems very simple (for example, it is relatively simple to design a Forth compiler, or reversing the order of an array) and uses less computing resources, such programming languages are not easy to learn. Since Forth allows the programmer to rewrite the language, or define their own language, and it does not enforce restrictions like data types, it may be especially easy for novices to write cryptic code.

A {{w|cryptogram}} is a cipher puzzle, generally one easy enough to be solved manually. The title text implies that the code is so bad that it looks like unreadable Forth code that is missing random characters.

==Transcript==
:[Ponytail sitting in front of a computer screen typing. Cueball speaks only off-panel, but since this is a direct continuation of comic 1513 and 1695: Code Quality and Code Quality 2 where Cueball is shown, there can be no doubt it is him.]
:Ponytail: Your code looks like song lyrics written using only the stuff that comes after the question mark in a URL.
:Cueball (off-panel): Sorry.
:[Zoom in on Ponytail's upper body.]
:Ponytail: It's like a JSON table of model numbers for flashlights with "tactical" in their names.
:[Zoom back out again. Ponytail has lifted her hands off the table and is slightly leaning back against the chair.]
:Ponytail: Like you read Turing's 1936 paper on computing and a page of JavaScript example code and guessed at everything in between.
:[Zoom in again on Ponytail's face.]
:Ponytail: It's like a leet-speak translation of a manifesto by a survivalist cult leader who's for some reason obsessed with memory allocation.
:Cueball (off-panel): I can get someone else to review my code.
:Ponytail: Not more than once, I bet.

{{comic discussion}}

[[Category:Code Quality]]
[[Category:Comics sharing name|Code Quality 03]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Ponytail]]
[[Category:Programming]]
[[Category:Computers]]
[[Category:Cueball Computer Problems]]

2116: .NORM Normal File Format

2019-03-08T07:13:44Z

PeterMortensen: Copy edited.

{{comic
| number = 2116
| date = February 25, 2019
| title = .NORM Normal File Format
| image = norm_normal_file_format.png
| titletext = At some point, compression becomes an aesthetic design choice. Luckily, SVG is a really flexible format, so there's no reason it can't support vector JPEG artifacts.
}}

==Explanation==
[[File:XKCD2116.norm.jpg|thumb|150px|An example of what Cueball might have seen, but presumably with numbers or other data rather than words.]]

Cueball's friend seems to have sent him a rather unusual datafile passed off as a new "normal" standard.

People who work with data, and need data sent to them electronically, typically need it sent in a way that they can easily use it – either in a text format that can be copy-pasted, or as a spreadsheet or CSV file that can be imported into a spreadsheet program, or such.
Information sent by Cueball's friend in this fashion – a photograph of a spreadsheet embedded into a word processing file – is not only aesthetically unpleasing, but essentially useless for any purpose beyond being looked at. The recipient has no choice but to retype the entire data set, or attempt to use optical character recognition (OCR), and hope that no mistakes are made in the process.

Any functional relationships between data (such as formulas used to compute data values) have been lost. Further, the size of the data is bloated by being converted first from numbers and formulas into text, then text into graphics, and then from graphics to embedded graphics in a word processing document. This adds nothing to the content, and only adds steps to the process of retrieving the data.

However useless this kind of data manipulation might be, it is becoming more and more common, especially as more non-computer literate people find "creative" ways to exchange information. Usually, their job is getting the data together in a Word file, and the only file they have is a screenshot of the spreadsheet, not the original file, so they just put screenshot in the Word file. Cueball's friend suggests that this is now a normal way to send files, and that Cueball should update his system to support this new type of file, represented by a ".norm" suffix.

The caption acknowledges that this has become a ''de facto'' standard and that we should just accept and formalize it.

The comic image links to a [https://twitter.com/openelex/status/853977391747801088 tweet by OpenElections] that displays an Excel file produced by the City of Detroit that contains a lookup table for the city's absentee precincts in 2016. The data had been input as clip art (images) of the values, instead of being entered in the spreadsheet cells.

This comic is reminiscent of the comic [[763:_Workaround|Workaround]], which also describes convoluted formats.

The title text suggests that eventually compression (or at least compression with data/quality loss) will be unnecessary as technology improves in the future. SVG ({{w|Scalable Vector Graphics}}) is a vector graphic format that is fundamentally a lossless format, representing images using geometric figures. {{w|JPEG}} is a lossy format, representing images as an array of rectangles approximating the original image. Randall suggests that some people in the future may choose to include JPEG artifacts to SVG vector graphics for its "aesthetics", perhaps as a throwback to when lower quality JPEG images were commonplace, or as a form of {{w|glitch art}}. It is possible that some in the future will view JPEG artifacts as giving their images a quaint/retro feel, much the way that some people today use sepia-tone filters on their images. (And much like some people today use JPEG artifacts to give their images [http://www.mspaintadventures.com/sweetbroandhellajeff/ an intentionally low-quality appearance].)

This is made even more reasonable by the fact that the SVG specification employs a lot of filters and already can embed regular pixel-based JPEG files. Furthermore, it allows JavaScript to be used to manipulate objects, meaning such an effect may be implementable in the current SVG 2.0 specification.

==Transcript==
:[Cueball is at a computer. Someone is talking to him from off-panel.]
:Voice: I sent you the data.
:Cueball: Thanks!
:Cueball: …this is a Word document containing an embedded photo you took of your screen with the spreadsheet open.
:Voice: Yeah? Does your computer not support .NORM files? Maybe you need to update.

:[Caption below the panel:]
:Since everyone sends stuff this way anyway, we should just formalize it as a standard.

[[Category:Comics featuring Cueball]]
[[Category:Computers]]

==Trivia==
Several days after this comic release Microsoft announced support for loading pictures into Excel. A photo of a printed data table shall be converted it into a fully editable table. See: [https://www.theverge.com/2019/3/1/18246429/microsoft-excel-covert-photos-data-tables-editable-table-ai-feature Microsoft Excel will now let you snap a picture of a spreadsheet and import it (theverge.com)]

{{comic discussion}}

2117: Differentiation and Integration

2019-03-08T07:06:30Z

PeterMortensen: Copy edited.

{{comic
| number = 2117
| date = February 27, 2019
| title = Differentiation and Integration
| image = differentiation_and_integration.png
| titletext = "Symbolic integration" is when you theatrically go through the motions of finding integrals, but the actual result you get doesn't matter because it's purely symbolic.
}}

==Explanation==
{{incomplete|Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}

This comic illustrates the old saying [https://mathoverflow.net/q/66377 "Differentiation is mechanics, integration is art."] It does so by providing a {{w|flowchart}} purporting to show the process of differentiation, and another for integration.

{{w|Derivative|Differentiation}} and {{w|Antiderivative|Integration}} are two major components of {{w|calculus}}. As many Calculus 2 students are painfully aware, integration is much more complicated than the differentiation it undoes.

However, Randall dramatically overstates this point here. After the first step of integration, Randall assumes that any integration can not be solved so simply, and then dives into a step named "????", suggesting that it is unknowable how to proceed. The rest of the flowchart is (we can assume deliberately) even harder to follow, and does not reach a conclusion. This is in contrast to the simple, straightforward flowchart for differentiation. The fact that the arrows in the bottom of the integration part leads to nowhere indicates that "Phone calls to mathematicians", "Oh no" and "Burn the evidence" are not final steps in the difficult journey. The flowchart could be extended by Randall to God-know-where extents.

It should be noted that Randall slightly undermines his point by providing four different methods, and an "etc", and a "No"-branch for attempting differentiation with no guidelines for selecting between them.

===Differentiation===
'''{{w|Chain rule}}'''

For any <math> \frac{d}{dx}f(x)=f'(x)</math> and <math> \frac{d}{dx}g(x)=g'(x) </math>, it follows that <math> \frac{d}{dx}(f(g(x)))=f'(g(x))\cdot g'(x)</math>.

'''{{w|Power Rule}}'''

For any <math> f(x)=x^a </math>, it follows that <math> \frac{d}{dx}f(x)=a\cdot x^{a-1} </math>.

'''{{w|Quotient rule}}'''

For any <math> \frac{d}{dx}f(x)=f'(x)</math> and <math> \frac{d}{dx}g(x)=g'(x) </math>, it follows that <math> \frac{d}{dx} \frac{f(x)}{g(x)}=\frac{f'(x)\cdot g(x)-f(x)\cdot g'(x)}{(g(x))^2}</math> if <math>g(x)\ne 0</math>.

'''{{w|Product rule}}'''

For any <math> \frac{d}{dx}f(x)=f'(x)</math> and <math> \frac{d}{dx}g(x)=g'(x) </math>, it follows that <math> \frac{d}{dx}(f(x)\cdot g(x))=f'(x)\cdot g(x)+f(x)\cdot g'(x)</math>.

===Integration===
'''{{w|Integration by parts}}'''

The "product rule" run backwards. Since <math>(uv)' = uv' + u'v</math>, it follows that by integrating both sides you get <math> uv = \int u dv + \int v du</math>, which is more commonly written as <math>\int u dv = uv - \int v du</math>. By finding appropriate values for functions <math>u, v</math> such that your problem is in the form <math>\int u dv</math>, your problem ''may'' be simplified. The catch is, there exists no algorithm for determining what functions they might possibly be, so this approach quickly devolves into a guessing game - this has been the topic of an earlier comic, [[1201: Integration by Parts]].

'''{{w|Integration by substitution|Substitution}}'''

The "chain rule" run backwards. Since <math> d(f(u)) = (df(u))du</math>, it follows that <math>f(u) = \int df(u) du</math>. By finding appropriate values for functions <math>f, u</math> such that your problem is in the form <math>\int df(u) du</math> your problem ''may'' be simplified.

'''{{w|Cauchy's integral formula|Cauchy's Formula}}'''

Cauchy's Integral formula is a result in complex analysis that relates the value of a contour integral in the complex plane to properties of the singularities in the interior of the contour. It is often used to compute integrals on the real line by extending the path of the integral from the real line into the complex plane to apply the formula, then proving that the integral from the parts of the contour not on the real line has value zero.

'''{{w|Partial_fraction_decomposition#Application_to_symbolic_integration|Partial Fractions}}'''

Partial fractions is a technique for breaking up a function that comprises one polynomial divided by another into a sum of functions comprising constants over the factors of the original denominator, which can easily be integrated into logarithms.

'''Install {{w|Mathematica}}'''

Mathematica is a modern technical computing system spanning most areas. One of its features is to compute mathematical functions. This step in the flowchart is to install and use Mathematica to do the integration for you. Here is a description about the [https://reference.wolfram.com/language/tutorial/IntegralsThatCanAndCannotBeDone.html intricacies of integration and how Mathematica handles those]. (It would be quicker to try [https://www.wolframalpha.com Wolfram Alpha] instead of installing Mathematica, which uses the same backend for mathematical calculations.)

'''{{w|Riemann integral|Riemann Integration}}'''

The Riemann integral is a definition of definite integration. <math>\sum_{i=0}^{n-1} f(t_i) \left(x_{i+1}-x_i\right).</math> Elementary textbooks on calculus sometimes present finding a definite integral as a process of approximating an area by strips of equal width and then taking the limit as the strips become narrower. Riemann integration removes the requirement that the strips have equal width, and so is a more flexible definition. However there are still many functions for which the Riemann integral doesn't converge, and consideration of these functions leads to the {{w|Lebesgue integration|Lebesgue integral}}. Riemann integration is not a method of calculus appropriate for finding the anti-derivative of an elementary function.

'''{{w|Stokes' Theorem}}'''

Stokes' theorem is a statement about the integration of differential forms on manifolds. <math>\int_{\partial \Omega}\omega=\int_\Omega d\omega\,.</math> It is invoked in science and engineering during control volume analysis (that is, to track the rate of change of a quantity within a control volume, it suffices to track the fluxes in and out of the control volume boundary), but is rarely used directly (and even when it is used directly, the functions that are most frequently used in science and engineering are well-behaved, like sinusoids and polynomials).

'''{{w|Risch Algorithm}}'''

The Risch algorithm is a notoriously complex procedure that, given a certain class of symbolic integrand, either finds a symbolic integral or proves that no elementary integral exists. (Technically it is only a semi-algorithm, and cannot produce an answer unless it can determine if a certain symbolic expression is {{w|Constant problem|equal to 0}} or not.) Many computer algebra systems have chosen to implement only the simpler Risch-Norman algorithm, which does not come with the same guarantee. A series of extensions to the Risch algorithm extend the class of allowable functions to include (at least) the error function and the logarithmic integral. A human would have to be pretty desperate to attempt this (presumably) by hand.

'''{{w|Bessel function}}'''

Bessel functions are the solution to the differential equation <math> x^2 \frac{dy^2}{dx^2}+x \frac{dy}{dx}+(x^2-n^2)*y=0</math>, where n is the order of Bessel function. Though they do show up in some engineering, physics, and abstract mathematics, in lower levels of calculus they are often a sign that the integration was not set up properly before someone put them into a symbolic algebra solver.

'''Phone calls to mathematicians'''

This step would indicate that the flowchart user, desperate from failed attempts to solve the problem, contacts some more skilled mathematicians by phone, and presumably asks them for help. The connected steps of "Oh no" and "Burn the evidence" may suggest the possibility that this interaction might not play out very well and could even get the caller in trouble.
Specialists and renowned experts being bothered - not to their amusement - by strangers, often at highly inconvenient times or locations, is a common comedic trope, also previously utilized by xkcd (for example in [[163: Donald Knuth]]).

'''Burn the evidence'''

This phrase parodies a common trope in detective fiction, where characters burn notes, receipts, passports, etc. to maintain secrecy. This may refer to the burning of one's work to avoid the shame of being associated with such a badly failed attempt to solve the given integration problem. Alternatively, it could be an ironic hint to the fact that in order to find the integral, it may even be necessary to break the law or upset higher powers, so that the negative consequences of a persecution can only be avoided by destroying the evidence.

'''{{w|Symbolic integration}}'''

Symbolic algebra is the basic process of finding an antiderivative function (defined with symbols), as opposed to numerically integrating a function. The title text is a pun that defines the term not as integration that works with symbols, but rather as integration as a symbolic act, as if it were a component of a ritual. A symbolic act in a ritual is an act meant to evoke something else, such as burning a wooden figurine of a person to represent one’s hatred of that person. Alternatively, the reference could be seen as a joke that integration might as well be a symbol, like in a novel, because Randall can't get any meaningful results from his analysis.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
:[Two flow charts are shown.]

:[The first flow chart has four steps in simple order, one with multiple recommendations.]
:DIFFERENTIATION
:Start
:Try applying
::Chain Rule
::Power Rule
::Quotient Rule
::Product Rule
::Etc.
:Done?
::No [Arrow returns to "Try applying" step.]
::Yes
:Done!

[The second flow chart begins like the first, then descends into chaos.]
:INTEGRATION
:Start
:Try applying
::Integration by Parts
::Substitution
:Done?
:Haha, Nope!

:[Chaos, Roughly from left to right, top to bottom, direction arrows not included.]
::Cauchy's Formula
::????
::???!?
::???
::???
::?
::Partial Fractions
::??
::?
::Install Mathematica
::?
::Riemann Integration
::Stokes' Theorem
::???
::?
::Risch Algorithm
::???
::[Sad face.]
::?????
::???
::What the heck is a Bessel Function??
::Phone calls to mathematicians
::Oh No
::Burn the Evidence
::[More arrows pointing out of the image to suggest more steps.]

{{comic discussion}}
[[Category:Analysis]]
[[Category:Flowcharts]]

1285: Third Way

2019-01-06T16:16:41Z

PeterMortensen: Copy edited (ref. <http://en.wikipedia.org/wiki/Internet>).

{{comic
| number = 1285
| date = November 1, 2013
| title = Third Way
| image = third way.png
| titletext = 'The monospaced-typewriter-font story is a COMPLETE FABRICATION!  WAKE UP, SHEEPLE' 'It doesn't matter! Studies support single spaces!' 'Those results weren't statistically significant!' 'Fine, you win. I'm using double spaces right now!' 'Are not!  We can all hear your stupid whitespace.'
}}

==Explanation==
This comic refers to the debate occurring in the United States about the correct {{w|Sentence spacing|number of space characters after a period at the end of a sentence}}.

While typewriter typists in the United States were traditionally taught to use two spaces between sentences, this is becoming less common and many sources now recommend having only one space, although this topic is still {{w|Sentence spacing#Controversy|controversial}}.

[[Cueball]] is advocating a line break after every sentence, the eponymous "third way".

This obviates the problem, as a period will always appear at the end of a line and the spacing after it becomes moot.

A line break after every sentence is sometimes called "[http://rhodesmill.org/brandon/2012/one-sentence-per-line/ semantic linefeeds]".

This is particularly useful when plain text files based on a markup language (such as {{w|HTML}}, {{w|TeX}}, or {{w|Wiki markup}}) are edited by multiple people using a {{w|Revision control|version control system}} where it helps to facilitate comparison of changes and avoid merge conflicts.

In most markup languages, a single line feed in the source is rendered as a simple space, while two linefeeds generate a paragraph break.

This approach allows the source to be easily manipulated and versioned, while the rendered output still keeps the regular flow and justification abilities of running text.

(Incidentally, HTML and languages derived from it such as {{w|BBCode}} and {{w|Wiki markup}} will generally render multiple consecutive whitespace characters as a single space, so pretty much every page on the Internet uses single spacing whether the author wants to or not.)

The title text uses single spaces between the back-and-forth quotations; but within each quotation, the quoted speaker's preferred spacing is used.

In particular, when the single-spacing advocate claims to be using double spacing, this is indeed a lie.

However, realistically, it is implausible that one can hear whitespace{{Citation needed}}.

Sentence spacing was previously mentioned in the titletext of [[1070: Words for Small Sets]].

Note that this is not the first time Randall has [[:Category:Compromise|proposed a controversial third way]].

Randall's mocking characterization in the title text of overzealous advocates using the phrase "WAKE UP, SHEEPLE" has appeared in previous comics [[496: Secretary: Part 3]] and [[1013: Wake Up Sheeple]].

This debate is later referenced in [[1989: IMHO]].

==Transcript==
:[To the left a group with three Cueballs, a Ponytail and Megan at the front which face another group with two Cueballs, a Ponytail and a black haired ponytail at the front. Each group has a placard. A Cueball in the left group has a cutlass and a Cueball in the right group has a spear as they are angrily facing off against each other. Off to the far right side stands a lone Cueball also with a placard.]
:Left placard: '''Two''' spaces after a period
:Middle placard: '''One''' space after a period
:Right placard: Line break after every sentence

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring Megan]]
[[Category:Multiple Cueballs]]
[[Category:Sheeple]]
[[Category:Compromise]]
[[Category:Language]]

1988: Containers

2018-12-08T11:40:03Z

PeterMortensen: /* Explanation */ Spelling (ref. <http://stackoverflow.com/legal/trademark-guidance> (the last section)). (Stack Overflow is not a forum - see e.g. <http://meta.stackexchange.com/a/92115>).)

{{comic
| number = 1988
| date = May 2, 2018
| title = Containers
| image = containers.png
| titletext = All services are microservices if you ignore most of their features.
}}

==Explanation==

{{w|Docker (software)|Docker}} is a computer program that performs {{w|Operating-system-level virtualization|operating-system-level virtualization}} also known as containerization. [[White Hat]] notices that many people are using Docker for "everything," implying that he does not understand what all the fuss is about. [[Cueball]] then explains the fundamental idea behind Docker with a simple story.

He notes how difficult it can be to combine two programs and have them work together as one. This is something all programmers can relate to. His specific example is to get two separate programs to display side-by-side on a tablet. The main joke is that Cueball's solution is a surprising twist to solving the problem. Instead of writing a lot of complicated code to deal with the problem at hand, he sidesteps the problem by using two separate devices, literally gluing them together. Containerization software, like Docker, uses the same general idea but the "glue" and the "multiple computers" are done in software, instead of literally gluing two computers together.

Cueball states that he achieved "software enlightenment" when he "solved" the problem by sidestepping it.

White Hat's initial confusion comes from the fact that Cueball did not write any software, yet achieved "software enlightenment." A good programmer doesn't necessarily need to be able to write programs or even understand how they work, provided that he/she has the skills needed to combine existing programs to solve tasks. An alternate interpretation is that someone with little programming experience is able to create a working program simply by copy/pasting code snippets from a coding site such as Stack Overflow and "gluing" them together without really understanding how they work.

The title text makes a joke about developers writing code for use in a containerized environment. The ideal is to only write "microservices" which are modules that do just one thing and do it well. The joke here is that even when a module does many different things, you can pretend it is a "microservice" by just ignoring all of its features but one (hopefully one that it does well).

==Transcript==
:[White Hat is sitting at a laptop. Cueball is standing behind him.]
:White Hat: Man, Docker is being used for everything.
:White Hat: I don't know how I feel about it.
:Cueball: Story time!

:[Cueball is standing by himself.]
:Cueball: Once, long ago, I wanted to use an old tablet as a wall display.

:[A picture of Cueball's imagined tablet with two applications open side by side. The app on the left is "LiveCam". The app on the right is Google Calendar.]
:Cueball: I had an app and a calendar webpage that I wanted to show side by side, but the OS didn't have split-screen support.
:Cueball: So I decided to build my own app.

:[White Hat and Cueball as before, but White Hat has turned to face Cueball.]
:Cueball: I downloaded the SDK and the IDE, registered as a developer, and started reading the language's docs.

:[A picture of two smartphones glued together side by side, held on a backing board. The same two applications shown earlier are open on different phones.]
:Cueball: ...Then I realized it would be '''way''' easier to get two smaller phones on eBay and glue them together.
:Cueball: On that day, I achieved software enlightenment.

:[White Hat and Cueball still facing each other, with White Hat's arm resting on the back of the chair.]
:White Hat: But you never learned to write software.
:Cueball: No, I just learned how to glue together stuff that I don't understand.
:White Hat: I...OK, fair.

{{comic discussion}}

[[Category:Comics featuring White Hat]]
[[Category:Comics featuring Cueball]]
[[Category:Comics with color]]

550: Density

2018-10-07T14:18:30Z

PeterMortensen: /* Explanation */ Spelling/case.

{{comic
| number = 550
| date = March 2, 2009
| title = Density
| image = density.png
| titletext = If only I had asked 4chan for ideas for what I should do to prevent this!
}}

==Explanation==
This comic depicts a sex scene with [[Cueball]] in bed together with [[Megan]], and a sentence being spoken by Cueball. The sentence's overt meaning suggests Megan doesn't wish to become pregnant, but Cueball has prematurely or unintentionally {{w|ejaculated}} inside her. The sentence contains five popular (at the time) {{w|Internet meme|memes}}:
*'''[http://knowyourmeme.com/memes/xzibit-yo-dawg Yo Dawg]''': With the full meme having the form "Yo Dawg, I herd you like (noun X), so I put an (noun X) in your (noun Y) so you can (verb Z) while you (verb Z)", this is the largest meme used in the sentence, and lays out the overall structure of the sentence. The greeting at the beginning can be changed to "Sup Dawg" as in this comic.
*'''[http://knowyourmeme.com/memes/i-herd-u-like-mudkips I herd u liek Mudkips]''': The misspelling of words "herd" (heard) and "liek" (like) come from this meme. While this meme is usually used with {{w|Mudkip}} (a {{w|Pokémon}}), in this case the noun has been replaced by something she didn't like.
*'''[http://knowyourmeme.com/memes/how-is-babby-formed How is babby formed?]''': The expression "forming babby" (with the misspelling of "baby") comes from this meme. This meme comes from a question that was originally asked on Yahoo! Answers. The full question was "how is babby formed / how girl get pragnent". This meme was also referenced in the title text of [[481: Listen to Yourself]] and in [[522: Google Trends]].
*'''[http://knowyourmeme.com/memes/i-accidentally I Accidentally]''': This meme carries the pattern of omitting an important verb, leaving the reader wondering what had happened accidentally. In this case the omitted verb is presumably "came" or "ejaculated". This meme was referenced again in [[997: Wait Wait]].
*'''[http://knowyourmeme.com/memes/in-ur-base In your base]''': This meme might be used for its relation to {{w|baseball metaphors for sex}}, which was also referenced in [[540: Base System]]).

In plain English, the sentence roughly means:
: ''Hey girl, I heard that you don't want to have a baby but I accidentally came inside you.''

The comic then goes to describe the pros and cons of the situation. "Ruined life" is listed as a major downside, as he may have caused a girl to become pregnant against her wishes, and may have to father a child with her. The usage of memes in response to the situation also conveys an uncaring attitude that is likely to put a damper on their relationship even if she did not get pregnant. On the other hand, it is noted that the sentence could set a new record for the density of memes (most memes packed into the fewest number of words) which can be considered a positive. This explains the title of the comic, though it will be a very superficial and meaningless record, especially when weighed against the downsides.

The reason Cueball chose to construct the sentence with so many memes is not clear. Since the comic lists "ruined life" as one of the cons of this scene, it would seem that the accident, as well as the subsequent use of memes, were not planned. It's possible that Cueball had too many memes in his head and couldn't think of anything else to say amid the nervous tension. If this were another character, say Black Hat, then it would be easier to believe that the entire night could have been staged just to give him an opportunity to use the sentence and set a record.

The title text references {{w|4chan}}, a site known for its memes, {{w|Troll (Internet)|trolls}} and other assorted Internet clutter, and sarcastically implies that any advice they might give would in any way be at all helpful. Due to its population of trolls and other unhelpful sorts, advice given by 4chan would normally be useless at best and actively detrimental at worst; however, the title text implies that Cueball regrets that he did not ask 4chan for advice, and maybe have used them for this earlier.

==Transcript==
:[Cueball is in a bed with Megan.]
:Cueball: Sup dawg, I herd you didn't liek forming babby, but I accidentally in your base.
:[Below the frame:]
:Cons: Ruined life.
:Pros: Sentence set the new meme density record.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Sex]]

386: Duty Calls

2018-08-10T18:19:42Z

PeterMortensen: Spelling/case.

{{comic
| number = 386
| date = February 20, 2008
| title = Duty Calls
| image = duty calls.png
| titletext = What do you want me to do? LEAVE? Then they'll keep being wrong!
}}

==Explanation==
[[Cueball]], and many Internet {{w|nerd}}s, feel an {{Wiktionary|irrepressible}} urge to correct people on the Internet, and often get intensely invested in arguments over mundane or insignificant topics. In this comic, Cueball is presented as an exaggerated example of one such arguer. His statement that "This is important" shows his excessive investment in whatever [unnamed] topic he is arguing about. Additionally, Cueball's interpretation of the argument as "someone is wrong, I need to correct them" rather than "someone disagrees with me, I should learn from them" parodies Internet arguers' insistence in the obvious, objective superiority of their viewpoint.

The title text reinforce this satire. The phrase "Duty Calls" used in the title is traditionally used in much more dramatic contexts [say, by a police officer, firefighter, doctor, etc. when talking about their job], so applying it to the job of arguing on the Internet is a humorous mismatch that puts Cueball's disproportionate investment into perspective. Cueball's exasperated, all-or-nothing retort "What do you want me to do? LEAVE?" in the alt text further highlights the absurd nature of his emotional investment in this argument. His reasoning that "they'll keep being wrong!" if he leaves suggests that the only solution he sees is to continue to argue until everyone on the Internet has agreed with him on all issues–a ridiculously impossible plan. By taking this satire to its logical conclusion–an eternity of arguing on the Internet with no time for pleasure in real life–Randall reminds the reader that getting emotionally involved in Internet arguments at the expense of real life is a terrible, terrible idea.

In [[955: Neutrinos]] another incarnation of Cueball is cured of a similar disease. A much later comic is simply called [[1731: Wrong]], but here it is not the other people who are wrong!

==Transcript==
:[Cueball is behind a computer.]
:Voice outside frame: Are you coming to bed?
:Cueball: I can't. This is important.
:Voice: What?
:Cueball: Someone is WRONG on the Internet.

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Internet]]

Talk:1972: Autogyros

2018-03-30T12:46:13Z

PeterMortensen: Added reference to external discussion.

;Land vertically?

Hi, searching 'autogyro' has led me to find autogyros can't land vertically. Could this be a mistake on Randall's part, or am I missing a joke here?

[[Special:Contributions/172.69.186.58|172.69.186.58]] 13:55, 26 March 2018 (UTC)

:I just read about them on Wikipedia and I see that they can't take off vertically, but there are kinds (possibly all) that can land vertically [[Special:Contributions/108.162.219.76|108.162.219.76]] 14:01, 26 March 2018 (UTC)

::The Wikipedia article was edited this morning to claim that they could not land vertically, but the edit was short-lived and reverted. So, be careful what you trust. [[User:JohnHawkinson|JohnHawkinson]] ([[User talk:JohnHawkinson|talk]]) 14:37, 26 March 2018 (UTC)

::It appears they can land vertically with the correct wind conditions. Here is a YouTube video: https://www.youtube.com/watch?v=GAoK9zM8FFQ - and they say "Actually it is a 'Zero GROUND Speed Landing' approx. 25 kts headwind".

::Here is a YouTube video of a zero ground speed takeoff: https://www.youtube.com/watch?v=Kd7_V4pW--Q

::I think the confusion here is that yes, it can land vertically: for that matter, so can any airplane. What matters isn't ground speed but airspeed, and as long as there's as much headwind as the landing airspeed of the aircraft, it will land vertically. Now, with fixed wing airplanes the landing speed is at least 40-50 mph, and you don't often find headwinds like that. The much lower landing airspeed of an autogyro makes that feasible. [[User:Gbisaga|Gbisaga]] ([[User talk:Gbisaga|talk]]) 21:26, 26 March 2018 (UTC)

::: "Landing vertically"...having so little forward airspeed on touchdown that it is negligible[[Special:Contributions/108.162.216.208|108.162.216.208]] 23:40, 26 March 2018 (UTC)
:::: I disagree with this. If that were the case, an autogyro could NOT land vertically or anything close to it. I think it's clear that "vertical" refers to movement relative to the ground, as movement relative to airflow is invisible. I'm having a hard time finding hard numbers on minimum airspeed for an autogyro (and unlike fixed wing aircraft, I've never flown one myself, so I don't have practical experience to fall back on). However I've seen a typical autogyro's best rate of climb speed is 50-50 mph, versus almost 70 for a 152; so I'll project about 30 mph for a minimum speed in landing configuration. Landing in that kind of headwind is certainly not unreasonable (though it would probably be not that much fun). [[User:Gbisaga|Gbisaga]] ([[User talk:Gbisaga|talk]]) 12:56, 27 March 2018 (UTC)

::: I'd expect an autogyro to be capable of landing the same way a helicopter with an engine malfunction lands - autorotate the rotor to store energy and then stop while relying on the rotor to slow the descent. Does not sound like the safest of procedures, but it certainly gives you a vertical landing. [[User:Mat|Mat]] ([[User talk:Mat|talk]]) 08:30, 27 March 2018 (UTC)

::: Doesn't the downward motion of the autogyro during descent contribute to the autorotation of the rotor, thereby providing lift while descending even through air that is calm laterally? [[Special:Contributions/162.158.154.43|162.158.154.43]] 14:29, 27 March 2018 (UTC)

Thanks for the comments, guys. I'm not the original commenter, but I had a [https://i.imgur.com/52JZlwf.png severe misunderstanding] of what "landing vertically" meant. [[Special:Contributions/172.68.26.71|172.68.26.71]] 13:54, 27 March 2018 (UTC)

;Cannot hover?

I would assume that autogyros ''can'' hover in some conditions (i.e. in a headwind). This is the same argument as the one for "Land Vertically?"; namely that it's the wind that matters. Is Randall wrong here or is this just an impractical edge case? Here is a [https://www.youtube.com/watch?v=DU7uAEvV_PU YouTube video] [[User:Kosak2000|Kosak2000]] ([[User talk:Kosak2000|talk]]) 15:58, 27 March 2018 (UTC)

:It can ''hover'' in the sense that any fixed wing airplane can hover - by having a fast enough headwind. I've "hovered" in a Piper Cub before - even flown backward! But that isn't the conventional use of "hover" by aircraft pilots. Hover it meant to refer to purposeful powered flight over a stationary spot 'with no wind'. Such as a Helicopter can do. An autogyro cannot do this, as it must maintain forward movement (compared to the air) to maintain lift. However, with some "trick piloting," you ''can'' vertically land an autogyro. You're not hovering because you're not holding your altitude, but if you come in with some forward speed and high-ish descent rate, you can flare a few feet above the ground to a horizontal stop, turning your formerly forward speed in to slowing the descent rate to an acceptable descent rate to land at. [[Special:Contributions/172.68.174.94|172.68.174.94]] 03:21, 28 March 2018 (UTC)

;Trivia
First successful flight of an autogyro was in 1923, so they have been around for close to 100 years. [[User:Rtanenbaum|Rtanenbaum]] ([[User talk:Rtanenbaum|talk]]) 17:04, 26 March 2018 (UTC)
The 1981 movie ''Mad Max II'' prominently featured an autogyro as part of the action. [[User:Rtanenbaum|Rtanenbaum]] ([[User talk:Rtanenbaum|talk]]) 17:04, 26 March 2018 (UTC)
Also James Bond 007 flew the autogyro 'Little Nellie' in " You Only Live Twice". Reputedly prompting a bit of an autogyro revival. [[User:RIIW - Ponder it|RIIW - Ponder it]] ([[User talk:RIIW - Ponder it|talk]]) 17:46, 26 March 2018 (UTC)

There was also an autogyro in the 1980 adaptation of Ray Bradbury's "[https://en.wikipedia.org/wiki/The_Martian_Chronicles_(miniseries) The Martian Chronicles]" --[[User:Mr. I|Mr. I]] ([[User talk:Mr. I|talk]]) 00:51, 30 March 2018 (UTC)

First of all, I've converted section headings to bold labels - we should avoid them in discussion content. Secondly, my take on how to order the labels around the autogyro is down the left side, then across the top, and finally down the right side. I realize it's entirely up to the reader, but that order makes the most sense to me instead of clockwise - the text on the lower-right seems to be climactic in a strange Randell-esque way. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 18:15, 26 March 2018 (UTC)
:Agree with your entire comment, and have changed the order in the transcript --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:03, 26 March 2018 (UTC)

Has Megan been seen wearing goggles before? [[User:Herobrine|Herobrine]] ([[User talk:Herobrine|talk]]) 23:05, 26 March 2018 (UTC)

"Powered parachute"? Sounds to me like [https://en.wikipedia.org/wiki/Paramotor this awesome thing]. [[User:Fabian42|Fabian42]] ([[User talk:Fabian42|talk]]) 08:50, 27 March 2018 (UTC)
:It's actually [https://en.wikipedia.org/wiki/Paraplane this similar awesome thing] and I've updated the main descriptions to link there. [[User:N0lqu|-boB]] ([[User talk:N0lqu|talk]]) 20:14, 27 March 2018 (UTC)

;Section Headings
Re-converted section headings to bold labels in discussion content - please avoid re-adding them because they can interfere with auto-layout templates in the explainxkcd page system. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 17:04, 27 March 2018 (UTC)

I feel like the "Not popular in the U.S., popular in Europe" should say "Self explanatory", then link to a page showing stats about popularity. (I can't find anything quickly, and am in a hurry right now). [[User:NiceGuy1|NiceGuy1]] ([[User talk:NiceGuy1|talk]]) 07:19, 30 March 2018 (UTC)

;Stack Exchange question

FYI: This xkcd was a subject on the Avionics Stack Exchange site: ''[https://aviation.stackexchange.com/questions/49894 Is this XKCD comic list about autogyro features accurate?]'' --[[User:PeterMortensen|PeterMortensen]] ([[User talk:PeterMortensen|talk]]) 12:46, 30 March 2018 (UTC)

1965: Background Apps

2018-03-21T22:22:07Z

PeterMortensen: /* Explanation */ Copy edited.

{{comic
| number = 1965
| date = March 9, 2018
| title = Background Apps
| image = background_apps.png
| titletext = My plane banner company gets business by flying around with a banner showing a <div> tag, waiting for a web developer to get frustrated enough to order a matching </div>.
}}

==Explanation==
Background apps (apps in the recently used list) on both iOS and Android are in one of several paused states and do not usually consume much battery power; they only take up some memory. Closing them means that if you want to use the app again later, it will need to reload fully which likely uses up "very slightly" more battery. ''Wired'' had a [https://www.wired.com/2016/03/closing-apps-save-battery-makes-things-worse/ detailed article] on this topic a couple years ago. However, a much better reason to close the apps is to free up RAM/memory to make the programs run faster or even prevent them from crashing. Ultimately, whether or not you should close your apps depends on whether you prioritize battery lifetime or performance. (In [[Randall|Randall's]] case, low batteries tend to be something of a problem, and he references this in other comics as in [[1373: Screenshot]], [[1802: Phone]] and [[1872: Backup Batteries]].)

The joke at first is that the misconception is so prevalent and irritating that a person would go to the trouble of renting a banner plane just to dispel it. However, the reasoning behind such an extreme action is then questioned by a second person, not only for the extreme measure of renting a plane but also for feeling the need to correct the misconception at all; however, following the internal logic of the comic, the second person also communicates via banner plane. (This is arguably hypocritical, as they themselves are chartering a plane for an equally, if not more, inane reason. Obviously, this would not happen in real life.{{Citation needed}}) The first person responds, again via plane, once again just to apologize to the second person and explain their actions.

At this point, the comic has left the initial joke about battery use entirely behind, and becomes a commentary about the logic of a world where people can converse via banner planes. In the final panel, the second person rents the plane yet again to respond to the first person's response, being no less smug or hypocritical than before. Meanwhile, four more people have chartered four different planes:
* One to urge the first two people to have their conversation somewhere private (typical comment in on-line forums)
* Another to comment on how surprisingly cheap the banners are to rent, thus explaining how the logic of the comic is possible in the first place
* A third just to show off their own banner
* A fourth displaying the HTML <marquee> "marquee" </marquee> tag, a proprietary non-standard extension to HTML, now obsolete and deprecated<ref>[https://www.w3.org/wiki/Html/Elements/marquee W3C]</ref> tag that many web organizations advise against using, which is used to cause a message to scroll across the web page, much as the plane is flying across the sky.

The fairly obvious parallel here is to using various Internet forums for "unsolicited tech advice to strangers," smug responses, comments on others' advice, off-topic rejoinders, and all the other things that go on there constantly. It seems ludicrous to rent airplane banners for such trivial purposes, but there are non-trivial resources involved in the global distribution of electronic communication, as well, and their use for purposes such as this seems ludicrous once Randall makes one think about it, and underlines that none of what is written on the banner may have anything to do with Randall's own opinions.

Participants in online discussions sometimes become so focused on pointing out the perceived mistakes of others that they neglect good online practices and their computers crash.

In the comic, the third plane is pointing at the second plane. The fourth plane is pointed at the third plane. The third and fourth plane have no vertical separation and far less than the three miles of horizontal separation normally required for uncoordinated airplanes flying without vertical separation. It seems likely that the planes may also be about to crash because their operators are more concerned with pointing out each others mistakes and participating in a silly discussion than they are with safety. In other words, they are like the computers used for the discussions.

The title text is spoken by a plane banner company owner, who uses the insidious tactic of flying around with a banner of an unmatched HTML, just to compel obsessive people into renting banner space to make it syntactically correct. This may be a reference to [[859: (]] or [[1144: Tags]].

The theme of the mis/use of airplanes and banners has previously been explored in [[1355: Airplane Message]].

==Transcript==
:[A small airplane with a trailing banner is flying across the panel from left to right with four small clouds spread out beneath the banner. The long banner reads:]
:Banner: People! Closing background apps when you're not using them makes your phone battery drain ''faster'', not slower! Stop it!

:[A beat panel without a plane, but just the sky with two birds to the left and three clouds.]

:[The same airplane flies back from right to left, trailing a new banner with clouds both above and beneath the banner/plane, and a bird to the right.]
:Banner: What kind of person charters a plane to give unsolicited tech advice to strangers?

:[A second beat panel follows without a plane, but just the sky with three clouds.]

:[The plane returns once again from the left with another banner. Two clouds are in front/below the plane and two birds can be seen.]
:Banner: OK, fair. Sorry. I guess I'm just angry about other stuff and it's coming out here.

:[Without a beat panel the original plane returns at the top of the panel, once again returning from right to left with another very long banner. But no less than four other planes, each with smaller and smaller banners are also shown flying beneath it among three clouds and three birds. The planes alter direction so the second plane below the original planes banner is flying to the right, the third plane is right below the second flying the other way towards left, and just beneath that is the fourth plane flying to the right. A final plane is flying to the left, beneath the third planes banner, at the same height as the fourth, they look as if they are on a collision course. This last planes banner is very short and the bottom end is partly beneath the panels frame, partly obscuring the text. All five planes are clearly different types, thus making it clear that the plane from the first three panels and the top one in this panel are the same plane, hired by two different persons.]
:Banner 1: No worries. Just maybe spend as much time reflecting on your own motivation for correcting people as you have on theirs for closing apps.
:Banner 2: Can you two please have this conversation somewhere else?
:Banner 3: Wow, these banners are surprisingly cheap to rent.
:Banner 4: Haha, I got one, too!
:Banner 5: <Marquee>

==References==
<references/>

{{comic discussion}}

[[Category:Social networking]]
[[Category:Animals]]

1969: Not Available

2018-03-21T22:17:43Z

PeterMortensen: /* Explanation */ Copy edited.

{{comic
| number = 1969
| date = March 19, 2018
| title = Not Available
| image = not_available.png
| titletext = If my country ever picks a new national flag, this is on my shortlist for designs to argue for, but I think in the end I'll go with the green puzzle piece or broken image thumbnail.
}}

==Explanation==
{{incomplete|Needs to be expanded. What is a "broken image icon", please provide examples. Do NOT remove this tag too soon.}}

A very common, yet frustrating, issue on the Internet is finding a broken link, taking you to an "{{w|HTTP 404|Error 404}}" page (see "missing xkcd comic" [[404: Not Found]]). The purpose of the page is to tell the user that the content they were looking for has been either moved or deleted or was never there in the first place.

Randall has suggested replacing the standard "page not found" text, to "This content is not available in your country". This could fool the user into thinking the media they are looking for is actually there, but is {{w|Regional lockout|region locked}}, which is another great source of frustration for Internet users. Using a {{w|VPN}} and/or {{w|Tor (anonymity network)|TOR}} to try and access the content from another country wouldn't work, because it isn't actually region locked; it is just an error 404 page, wasting even more time, most likely frustrating the user a great deal in the process. Error code for "content blocked for legal reasons" is actually {{w|HTTP 451|451}}, referencing ''Fahrenheit 451''.

The title text suggests setting the picture as a national flag. This would be very ironic, as it would suggest that the country's flag itself, something that is used to represent the country across the globe, is region locked. The country in the title text likely does not refer to the United States, but rather to the new country featured in [[1815: Flag]]. The first flag of this country included a phone notification bar, so changing it to a "page not found" icon would continue with a trend of technology imagery. Instead he argues for a green puzzle piece, which was Firefox's "plugin is missing" icon (now it's a grey Lego brick). Chrome also has a comparable "plugin is missing" puzzle piece icon which is gray. He also argues for an equally frustrating broken image icon (which is used in lieu of a photo that is either missing or incompatible with the browser).

==Transcript==
:[A gray box on a black background with white text:]
:This content is not available in your country.

:[Caption below the panel:]
:If you ever ''really'' want to make people mad, set this as your 404/"Not Found" page.

{{comic discussion}}

[[Category:Internet]]

345: 1337: Part 5

2018-02-26T18:46:54Z

PeterMortensen: /* Explanation */ Some copy editing (e.g. ref. <http://en.wikipedia.org/wiki/Uniform_resource_locator>).

{{comic
| number = 345
| date = November 16, 2007
| title = 1337: Part 5
| image = 1337_part_5.png
| titletext = This digital music thing will probably reach its endgame sometime in the next decade or so. These are very exciting times.
}}

==Explanation==
This is the fifth and last part of five in the "[[:Category:1337|1337]]" series. The title 1337 is "L-eet", or "elite", using the {{w|Leet}} alphabet.

All comics in the series:
*[[341: 1337: Part 1]]
*[[342: 1337: Part 2]]
*[[343: 1337: Part 3]]
*[[344: 1337: Part 4]]
*[[345: 1337: Part 5]]
This series was released on 5 consecutive days (Monday-Friday) and not over the usual Monday/Wednesday/Friday schedule.
The comic is narrated by [[Cueball]] as seen in part 2 comic, but that Cueball is not shown here, but still he is part of this comic series, and thus also this comic, as he narrates the epilogue.

{{w|Richard Stallman}} is the ardent defender of freedom and believer in {{w|copyleft}}, he also founded the {{w|GNU Project}}. (He is not really a sword fighter but is always depicted with swords when [[:Category:Comics featuring Richard Stallman|featured in xkcd]], which is in this series and in [[225: Open Source]]).

In the previous part he came to the rescue of [[Mrs. Roberts]] and her Daughter [[Elaine Roberts]]. Stallman and Elaine quickly overpower the two enemies with black bowler hats that represent the {{w|Motion Picture Association of America}}, (MPAA) and the {{w|Recording Industry Association of America}} (RIAA) use the {{w|Digital Millenium Copyright Act}} who had found out about the Roberts hacking.

Just when the two men have been defeated Elaine asks how Stallman knew they where in trouble and he tells it was his friend that told him about it. The friend enters by climbing down a rope from the sky with red cape and goggles. It turns out it is {{w|Cory Doctorow}}, a blogger, journalist, and science fiction author who serves as co-editor of the weblog {{w|Boing Boing}}. He is an activist in favor of liberalizing copyright laws and a proponent of the {{w|Creative Commons}} organization. He does not really travel around in a balloon or (usually) wear a red cape, but [[Randall]] introduced this idea in [[239: Blagofaire]] and has continued it in later [[:Category:Comics featuring Cory Doctorow|comics featuring Cory Doctorow]]. So he in climbing down from his balloon.

He uses the balloon to construct the {{w|Blogosphere}}, which is a name used to refer to all blogs on the Internet, many of which frequently link to and refer to other blogs. Here, the Stallman character talks about it as though Cory Doctorow actually constructs it and Cory Doctorow talks about it as if it were a portion of the atmosphere 20 km up over the tag clouds...

Blogs often label posts with keywords, known as tags. A {{w|tag cloud}} is a way of displaying the tags on a site where the more common tags appear in larger type than less-common ones. It has no relationship to actual water vapor clouds in the sky, but in the comic, the Doctorow character suggests that tag clouds are actually in the air, below the new blogosphere.

At this point we see that Mrs. Roberts is still programming while this fight and discussion takes place. Her son [[Little Bobby Tables]] comes and tells her he is hungry, but she tells him that she does not have time when she is coding, and that he ate yesterday. It seems that he is still a kid, even though it must have been some years since the young Elaine left and grew up. However, she may still be a very young adult, in which case her little brother could still be shorter than his mom (we see in Part 2 that, from age 11, she studied with Donald Knuth for four years, making her 15 when she left. However, it is not clear how long she was away from home after that).

Stallman gives Elaine a proposal to join {{w|GNU}} as a coder. GNU is supposed to be the pinnacle of open source; an operating system with no restriction, allowing the user to modify and customize anything they want about the computer. Stallman likely wants Elaine for her coding abilities, similar devotion to open source and freeware, and use her reputation as a hacker and open source pioneer to spread the word and further his project. This may also be a reference to the infamous "Free Software Song", [https://en.wikipedia.org/wiki/Free_Software_Song]sung by Stallman in which he exhorts hackers to "join us now and share the software". But she is not ready yet as she wished to take down the industry of MPAA and RIAA as ''Music doesn't need these assholes.'' In the meantime Cory Doctorow throws the bowler hat guys out and asks them never to "darken our comment threads again".

Stallman is against her idea of going for straight war with the industry, and suggest she helps encourage sharing in the public mind. And then Doctorow chimes in with a suggestion that she has the ability to build a better {{w|P2P}} systems. To which she asks if they mean straight up piracy? And this leads up to the punch line of the pun, when Doctorow says she would make a wonderful Dread Pirate Roberts!

Peer-to-peer (often abbreviated P2P) system is a network system where tasks are partitioned between participants with equal privileges, in contrast with the client-server model, where the client makes requests and the server provides service. A common example of a peer-to-peer system is the BitTorrent file-sharing protocol, which is often (mis)used for distribution of pirated software and media.

The {{w|Dread Pirate Roberts}} is a fictional character from the book and movie {{w|The Princess Bride}}. Roberts is the most feared pirate on the seas. But, "Dread Pirate Roberts" is merely a title that has been passed down as previous "Roberts" have gained enough money (from piracy) to retire comfortably. Westley, one of the main characters from The Princess Bride, becomes the Dread Pirate after being taken prisoner by the preceding Pirate Roberts. It is anyone's guess whether the entire 5-comic story, starting from the choice of Mrs. Roberts' name, began as just a lead-up to this one joke. At the end of the movie, Inigo Montoya has won the vengeance he has sought all his life, and expresses to Westley that he doesn't know what to do next. Westley suggests Montoya succeed him as Roberts, saying, "Have you ever considered piracy? You'd make a wonderful Dread Pirate Roberts." Cory Doctorow's line in the comic therefore mimics that line from the movie.

{{w|Silk Road (marketplace)|Silk Road}} was an online black market designed to allow criminals to trade in drugs, guns and other illegal items, run by a person also using the pseudonym Dread Pirate Roberts. However, this black market did not exist until four years after this comic was published.

In the epilogue several items of interest is revealed about the Roberts later life.

Elaine shared her ideas with {{w|Bram Cohen}} who went on from that to found {{w|BitTorrent}}, a distributed method of downloading files. People can and do use BitTorrent both for lawful file downloads and also for sharing media files unlawfully. Its distributed nature, where someone does not download a file from just one other computer but rather in many pieces from many other computers with the same file, makes it more difficult for record and movie industry groups to police, and therefore a person with Elaine's motivations might be interested in helping design such a system.

Mrs. Roberts developed for {{w|Ubuntu}} which is probably the most well known distribution of GNU/{{w|Linux}}. A GNU/Linux distribution (often referred to simply as "Linux") is any operating system that is based on GNU software and the Linux {{w|kernel}}.

She also went after any website (defacing them) that made {{w|Your Mom|''Your'' mom}} jokes about her daughter. To deface a website is like putting up graffiti or tearing down signs; she likely replaces the URL's content from the original site to another image, text box, or other message as revenge. This is a [[:Category:Your Mom|recurring theme]] on xkcd. Defacing websites is generally considered a low-level hacking activity, generally carried out by script kiddies using pre-packaged exploits rather than by highly skilled hackers like Elaine.

Finally a bit more info is given on how Elaine continues her fight, joins communities, help with codes, etc. And then sometimes she streams her music live on an IP address, and if you happen to find one of these with a streaming audio player you can hear her rock out (a reference to her music career mentioned at the end of the third part).

The final phrase "Happy Hacking" often accompanies an autograph from Richard Stallman.

The title text is likely referring to the argument over {{w|Digital Rights Management}}, or DRM-locked content. These so-called 'DRM wars' are concerned about how DRM restricts the freedoms of people who buy them legitimately, and how it restricts creativity and innovation on the Internet. A large part of the debate is digital music, or music you would buy and download on the Internet through sites like Amazon or iTunes. The title text states that the DRM wars will end in the next decade or so and we are living through very exiting times as we can see these wars unfold and eventually end.

In 2009, iTunes did remove DRM from any music they sold, which was a huge milestone at the time. Due to the rise in music streaming services (all of which use DRM to keep clients from downloading their songs) in the mid- to late 2010s this achievement has been made void again.

==Transcript==
:[The two men in black bowler hats (RIAA and MPAA agents as known from the previous comic) with their katanas are attacked by Elaine Robert with her folding knife and Richard Stallman with his own two katanas. Elaine kicks the RIAA man to the left in the back of his leg, while Stallman jumps over the MPAA man to the right, flying high over him from right to left in a flying maneuver hitting his sword while hanging parallel to the ground above the man.]
:Elaine: Thanks, Stallman!
:Richard Stallman: 'Tis my pleasure.

:[Elaine stands to the left with her knife in one hand having folded it down again. Richard Stallman stands between the two men with bowler hats who are now lying on the floor on either side of him each with one of Stallman's sword pointing at their throat. Stallman has both arms fulle stretched towards them as he looks straight out of the panel. The left (RIAA) man lies flat on his back his hat and katana sword lying behind him. The right (MPAA) man is sitting on his knee leaning as far back as he can, since the sword is almost touching his skin on his throat. He wears his hat, but the sword lies behind him, out of reach, even though he is leaning back on one hand close to it. To the far right a rope comes down from the top of the panel falling down on the ground so a section of it stretches even farther right in the picture. Down this rope comes a man with googles and a red cape, which is black on the inside. This is Cory Doctorow. He holds on to the rope with two hands one over one just under his head.]
:Elaine: So, wait - how did you know we were in trouble?
:Richard Stallman: My friend here was tracking these thugs from his balloon.
:Richard Stallman: He called me and I thought I'd stop by.
:Cory Doctorow: -Hi!
:Cory Doctorow: Cory Doctorow - It's a pleasure to meet you.

:[Elaine has shifted the knife to the other hand. Richard Stallman has moved to the left of the RIAA man, so both bowler hat men are between him and Cory Doctorow. Stallman still points his sword in their direction, but they are lowered. The RIAA man closest to him, has picked up his hat in one hand and reaches for his sword with the other hand. The MPAA man now lies on his back, one arm up leaning on the other. His sword is gone. It does not seem like Doctorow could have taken it. Behind him Doctorow has reached the ground, the rope hangs behind him. He points left.]
:Elaine: Balloon?
:Richard Stallman: Aye. They're up there constructing something called a "Blogosphere."
:Cory Doctorow: Yup! It's twenty kilometers up, just above the tag clouds.

:[The scene is contracted, so to the left Mrs. Roberts at her desk with her chair and laptop becomes visible (from the previous comic). This witout the other people have moved closer. She still types as her son Little Bobby Tables enters and lifts a hand in his mothers direction. He is drawn as a child version of Cueball. Elaine has put the knife away, and looks at Richard Stallman who now stand straight looking at her, with the swords crossed in front of his legs. Behind him just right of the rope hanging down, Cory Doctorow lifts one of the agents up by the throat while looking right and talking to him. The other agent has left the panel. The one he holds has his hat but no sword.]
:Little Bobby Tables: Mom, I'm hungry.
:Mrs. Roberts: Hush, I'm coding. You ate yesterday.
:Richard Stallman: You know, Roberts, GNU could use a good coder like you. Ever thought of joining us?
:Elaine: Maybe someday. Right now I've got an industry to take down.
:Elaine: Music doesn't need these assholes.
:Cory Doctorow: Begone, And never darken our comment threads again!

:[Zoom in on Elaine, Richard Stallman and Cory Doctorow. She stand straight looking at Stallman who faces towards her swords now on his back crossed. Doctorow is also facing her and holds out both arms towards her. The rope is now outside the panel as are both bowler hat men.]
:Richard Stallman: Well, you won't fix the industry with random exploits. You need to encourage sharing in the public mind.
:Doctorow: Hey; With your music and coding backgrounds, you should get into building better P2P systems.

:[The final panel is only a third of the length of the previous panel. The three are still in the panel but they have moved and are also drawn somewhat smaller. Elaine still faces them right, but now Cory Doctorow is in front of Richard Stallman swords as before. All have their arms down.]
:Elaine: What? Straight-up piracy?
:Cory Doctorow: Sure - have you ever considered it? You'd make a wonderful dread pirate, Roberts.

:[To the right of the final panel is a two column epilogue narrated by Cueball as seen in part 2. It is split in three paragraphs and a "signature". The caption above is centered over the two columns]
:<big>Epilogue</big>
:Cueball (narrating): Elaine shared her ideas with Bram Cohen, who went on to develop BitTorrent.
: Mrs. Roberts spends her time developing for Ubuntu, and defacing the websites of people who make "your mom" jokes to her daughter.
: Elaine still stalks the net. She joins communities, contributes code or comments, and moves on. And if, late at night, you point a streaming audio player at the right IP at the right time - you can hear her rock out.
: ~Happy Hacking.~

{{comic discussion}}

[[Category:1337|05]]
[[Category:Comics sharing name|1337]]
[[Category:Comics with color]]
[[Category:Comics featuring Elaine Roberts]]
[[Category:Comics featuring Richard Stallman]]
[[Category:Comics featuring Cueball]] 
[[Category:Comics featuring Cory Doctorow]]
[[Category:Comics featuring Mrs. Roberts]]
[[Category:Comics featuring Little Bobby Tables]]
[[Category:Comics featuring real people]]
[[Category:Your Mom]]
[[Category:Computers]]
[[Category:Music]]

344: 1337: Part 4

2018-02-26T18:40:38Z

PeterMortensen: /* Explanation */ Copy edited (ref. <http://en.wikipedia.org/wiki/Apple_Inc.> and <http://en.wikipedia.org/wiki/Macintosh>)

{{comic
| number = 344
| date = November 15, 2007 
| title = 1337: Part 4
| image = 1337 part 4.png
| titletext = Mrs. Roberts would have gotten up sooner, of course, but she was busy piping find ~ and find ~nomad into xargs shred, just in case.
}}

==Explanation==
This is the fourth part of five in the "[[:Category:1337|1337]]" series. The title 1337 is "L-eet", or "elite", using the {{w|Leet}} alphabet.

All comics in the series:
*[[341: 1337: Part 1]]
*[[342: 1337: Part 2]]
*[[343: 1337: Part 3]]
*[[344: 1337: Part 4]]
*[[345: 1337: Part 5]]
This series was released on 5 consecutive days (Monday-Friday) and not over the usual Monday/Wednesday/Friday schedule.
The comic is narrated by [[Cueball]] as seen in part 2, but that Cueball is not shown here, but still he is part of this comic series, and thus also this comic.

In this part [[Elaine Roberts]] returns to the second best hacker in the world, (she being the best according to part 2), her mom [[Mrs. Roberts]]. Together they are an unstoppable force and they help out a guy called Jon with a CSS decryptor.

This implies that {{w|Jon Lech Johansen}}'s DeCSS was written by Elaine. Jon Lech Johansen, also known as DVD Jon, is famous for {{w|DeCSS}}, a DVD decryption program that removes the copy protection from commercial DVDs. The {{w|Motion Picture Association of America}}, also known as the MPAA, were not amused.

Both the MPAA and the {{w|Recording Industry Association of America}} (RIAA) use the {{w|Digital Millennium Copyright Act}}, shortened to DMCA, as a kind of brute club to silence "infringements" on their copyright. In a perfect world, the DMCA provides safe harbor protection to websites and consumers to make fair use of copyrighted content while also affording copyright owners the ability to protect their works from being pirated. In this world, this means that any content protection system, no matter how weak and poorly executed, cannot be circumvented and discussion of circumvention is illegal as well.

This is not a perfect world and in the end, the Roberts team is noticed and two men with black bowler hats and briefcases with the abbreviations MPAA and RIAA shows up at their house to arrest them. The two men look very much like {{w|Thomson and Thompson}} from {{w|The Adventures of Tintin}}.

When Elaine is not ready to let them arrest her, and draws her knife, they instead draw their {{w|katana}} swords, out of their (way too short) briefcases. Mrs. Roberts says to her daughter that she should calm down because it is illegal to slice people up in their own houses.

However, the two men disagree and refer to the DMCA Title IV, Section 408: Authorization of Deadly Force. (There is actually no Title IV, Section 408 of the DMCA; Title IV ends with Section 407.) So now the two women are in lethal danger.

But of course, {{w|Richard Stallman}}, founder of the {{w|GNU Project}} and stalwart defender of freedom and {{w|copyleft}}, cannot stand for this kind of repression of freedom. (In the real world, Stallman is not a swordsman, but he is always depicted with two katana swords in xkcd, first time was in [[225: Open Source]]) In keeping with the "{{w|Kill Bill}}" themes from earlier in the series, [[Randall]] imagines the conflict between Elaine/Stallman/Mrs. Roberts vs MPAA/RIAA agents as an action-packed katana battle rather than the legal battle it would likely have been in real life.

The title text is talking about a {{w|Linux}}-ism. In Linux (and all Unix derivatives) ~ is a symbol for a user's home directory (usually <code>/home/<username></code>). Presumably "nomad" is Elaine's username. <code>find</code> is an application that recursively walks a filesystem, listing all files, and <code>xargs shred</code> takes those files and securely erases each one with pseudo-random data. This is different from simply deleting a file, which merely removes the pointer in the filesystem's record tables to the file's location on the hard disk. The latter can usually be recovered from. Secure delete, however, requires physically taking apart a disk and reading individual bits for remaining magnetic charge to attempt to reconstruct what was there.

Proprietary hardware is hardware (the electronics part rather than the software) created and uses only by that company as opposed to open hardware that uses parts or chips common to everyone. Proprietary hardware used to found in most gaming consoles and Apple/Mac devices, but that isn't as common now since the cost of designing your own hardware is too expensive compared to using common chips.

==Transcript==
:[Elaine is sitting under tree on a grassy meadow typing on her laptop. Two trees are in the background where rolling hills goes to the horizon with a single cloud over the trees. Above the frame is text narrated by the Cueball from the first panel in the 2nd comic in the series:]
:Cueball (narrating): As time passed, Elaine intensified her hacking work, anonymously publishing exploit after exploit.

:[Elaine, wearing a backpack, is walking up to a door where her mom Mrs. Roberts is greeting her in the open door at the top of two steps. Above this very low panels frame there is more of Cueballs narration:]
:Cueball (narrating): To crack open proprietary hardware, she teamed up with one of the top experts in signal processing and data transferring protocols.
:Elaine: Hi, mom.
:Mrs. Roberts: Hello, dear. Did you have fun?

:[Elaine is lying on the floor with her laptop in front of her facing left with charger no the floor further left. Mrs. Roberts is sitting to the right facing right on a chair working on her computer at a table. Cueball is still narrating above the frame:]
:Cueball (narrating): They were an unstoppable team.
:Elaine: I finished the CSS decryptor.
:Mrs. Roberts: Good, dear. I'll send it along to Jon.

:[Pan to the right where two men in black bowler hats arrive. Both holds briefcases the first guys reads RIAA and the other guy reads MPAA. Cueball's last narration in the comic is above the frame:]
:Cueball (narrating): And were eventually noticed.
:RIAA man: Game's over.
:MPAA man: You're coming with us.
:Briefcase 1: RIAA
:Briefcase 2: MPAA

:[Pan back left to the women. Mrs. Roberts stays in her chair sitting at her computer still typing, the screen emitting light, but Elaine has moved around to the right of the table and pulls out her folding knife and swings it open.]
:Elaine: Oh, are we?
:Mrs. Roberts: Now now, Elaine-
:Knife: ''Shink''

:[Pan back right to the two men who simultaneously pull a katana sword out of each of their briefcase, while still holding on the the handle with the other hand. When when opened like this it causes two pieces of paper to fly out of the RIAA man and a note book to fly out of the MPAA mans briefcase.]
:Katan sword1 1: ''Shing''
:Katan sword1 2: ''Shing''

:[Pan back to the women. Mrs. Roberts continues to type on the laptop, a line goes up from the keyboard indicating activity. Elaine still holds her open folding knife out, so the tip now touches the right frame of the panel.]
:Mrs. Roberts: Don't let them provoke you, dear.
:Man (off-panel): We don't want to hurt you, Ma'am.
:Mrs. Roberts: Don't by silly. Record company employees can't just go into houses and slice people up.

:[Pan back right to the two men who holds up the katana sword having left their briefcase closed on the floor. The closest RIAA man is holding a hand up, the other MPAA man is holding his sword in two hands and pointing it threateningly forward.]
:RIAA Man: Ah, so you haven't read the DMCA.
:MPAA Man: Title IV, Section 408: Authorization of Deadly Force.

:[A wide panel showing the whole scene with even Mrs. Robert now standing having just pushed her chair back, the computer inert. Elaine is bending in the knees knife at the ready. Both bowler hat men, stil holding their swords as before, but no hands up, have turned to loo right back over their shoulder to see who speaks, as a voice comes from off-panel right.]
:Richard Stallman (off-panel): <big>Hark!</big>

:[The scene pans further right, so the two women is no longer in the panel, but Richard Stallman can now be seen with his wild beard and long hair and holding two katana swords one in front of him and one over his head also pointing towards the two bowler hat med. They are standing normally, looking back at Stallman the MPAA man nearest him holds a hand to his mouth as he speaks.]
:Richard Stallman: <big>Cease this affront to freedom</big>
:Richard Stallman: <big>Or stand and defend yourselves!</big>
:MPAA Man: Stallman!

{{comic discussion}}

[[Category:1337|04]]
[[Category:Comics sharing name|1337]]
[[Category:Comics featuring Cueball]] 
[[Category:Comics featuring Elaine Roberts]]
[[Category:Comics featuring Mrs. Roberts]]
[[Category:Comics featuring Richard Stallman]]
[[Category:Comics featuring real people]]
[[Category:Computers]]
[[Category:Music]]

341: 1337: Part 1

2018-02-26T18:32:12Z

PeterMortensen: Copy edited (e.g. ref. <http://en.wikipedia.org/wiki/Wi-Fi> and <http://en.wikipedia.org/wiki/Transmission_Control_Protocol>).

{{comic
| number = 341
| date = November 12, 2007
| title = 1337: Part 1
| image = 1337 part 1.png
| titletext = If you're not cool enough to do it manually, you can look up tools like Upside-Down-Ternet for playing games with people on your wifi.
}}

==Explanation==
This is the first part of five in the "[[:Category:1337|1337]]" series. The title 1337 is "L-eet", or "elite", using the {{w|Leet}} alphabet, a coding system used primarily on the internet (and on early text messaging system), meant to provide a bit of {{w|obfuscation}} to plain text both to make it harder to read, and to show off in a creative way using in-group jargon. This comic series is aimed at elite hackers and programmers.

All comics in the series:
*[[341: 1337: Part 1]]
*[[342: 1337: Part 2]]
*[[343: 1337: Part 3]]
*[[344: 1337: Part 4]]
*[[345: 1337: Part 5]]
This series was released on 5 consecutive days (Monday-Friday) and not over the usual Monday/Wednesday/Friday schedule.

If a {{w|wireless network}} (Wi-Fi) is unsecured it is usually a sign that the owner of the access point is not technically skilled enough to go into the admin panel and enable encryption. Obviously, someone in the area who wants to get on the net, but doesn't have a mobile data connection, will simply use this open access point. However, it is also common practice to leave open an access point to be able to claim that infringement of copyright may not have been the homeowner, but that anybody could have connected to the access point and started downloading files.

Another fun trick, for administrators of open APs, is to [http://www.ex-parrot.com/~pete/upside-down-ternet.html intercept pages and edit their contents]. The only way to stop this is to create a secure connection, or tunnel, to a server to stop the admin from playing {{w|Man-in-the-middle attack|man-in-the-middle}}. Of course, as the title text says, [[Mrs. Roberts]] is so cool, she can edit the {{w|TCP}} stream live, without the help of programs, but then there is help to get with tools like the [http://www.ex-parrot.com/~pete/upside-down-ternet.html Upside-Down-Ternet], if you wish to play games with people misusing your Wi-Fi.

Not only is Mrs. Roberts awesome enough to manually edit the live TCP stream, she's also manually ending individual {{w|VPN}} and {{w|Secure Shell|SSH}} connections as [[Cueball|Cueball's]] Cueball-like friend makes them - while wearing oven mitts and baking cookies at the same time. He has been {{w|pwned}} (i.e. owned) by Mrs. Roberts.

The question "How does she type with oven mitts?" is likely a reference to the old web video site {{w|Homestar Runner}} and its character of {{w|Strong Bad}}, who answered emails while wearing boxing gloves. "How does he type with boxing gloves?" was the most common question he received. (Another unanswered question is ''how Cueball's friend knew she was typing with gloves on?''' ...)

==Transcript==
:[Cueball talks to his Cueball-like friend who is lying down on the floor, using his laptop. Cueball is pointing at the laptop.]
:Cueball: You're not on the neighbor's WiFi, are you?
:Friend: Yeah, why?
:Cueball: The admin... plays games.
:Friend: No problem. I'll just hop on a secure VPN.

:[Cueballs friend now sits on his knee in front of his laptop frantically typing. A message from the laptop comes out with a zig zag line]
:Friend: Whoa, my connections are dying as soon as I start to tunnel anything!
:Message on laptop: A VPN? How cute! And stop trying to SSH.
:Friend: Holy shit! Someone's inserting notes into the pages I request! Editing the TCP stream live!
:Friend: Nobody's that fast. Who ''is'' this admin?

:[In a frame-less panel Mrs. Roberts with hot bun tray in one hand (indicated with five wiggly lines above the buns), with oven mitts on both hands typing on her desktop computer on a table.]
:Mrs. Roberts: My goodness. Neighborhood scamps on the wireless.
:''Taptaptaptap''

:[Cueball is standing with a hand towards his now standing friend, the laptop lies between them.]
:Cueball: I should have warned you about Mrs. Roberts.
:Friend: How does she type with oven mitts!?
:Cueball: You've been pwned pretty hard, man. You might want to sit down.

{{comic discussion}}

[[Category:1337|01]]
[[Category:Comics sharing name|1337]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Mrs. Roberts]]
[[Category:Multiple Cueballs]]
[[Category:Computers]]
[[Category:Food]]

Category:1337

2018-02-26T18:23:05Z

PeterMortensen: Copy edited. [2]

*This series was released on 5 consecutive days (Monday-Friday) and not over the usual Monday/Wednesday/Friday schedule.
*The title 1337 is "L-eet", or "elite", using the {{w|Leet}} alphabet, a coding system used primarily on the Internet (and on early text messaging system), meant to provide a bit of {{w|obfuscation}} to plain text, both to make it harder to read and to show off in a creative way using in-group jargon.
*This comic series is aimed at elite hackers and programmers.

[[Category:Comic series]]

Category:1337

2018-02-26T18:19:25Z

PeterMortensen: Copy edited.

*This series was released on 5 consecutive days (Monday-Friday) and not over the usual Monday/Wednesday/Friday schedule.
*The title 1337 is "L-eet", or "elite", using the {{w|Leet}} alphabet, a coding system used primarily on the internet (and on early text messaging system), meant to provide a bit of {{w|obfuscation}} to plain text both to make it harder to read, and to show off in a creative way using in-group jargon.
*This comic series is aimed at elite hackers and programmers.

[[Category:Comic series]]

580: The Race: Part 4

2017-11-09T07:22:05Z

PeterMortensen: /* Explanation */ Grammar.

{{comic
| number = 580
| date = May 7, 2009
| title = The Race: Part 4
| image = the_race_part_4.png
| titletext = Things are rarely just crazy enough to work, but they're frequently just crazy enough to fail hilariously.
}}

==Explanation==
''{{w|Firefly (TV series)|Firefly}}'' was a television series aired by {{w|Fox Broadcasting Company|Fox}} in 2002, but it was canceled after only fourteen episodes had been produced. Over ten years later, it still has a devoted fan base, apparently including [[Randall]]. The main characters were the crew of the spaceship "Serenity", including Captain Malcolm "Mal" Reynolds ({{w|Nathan Fillion}}), mechanical genius Kaywinnet Lee "Kaylee" Frye ({{w|Jewel Staite}}), the apparently insane psychic River Tam ({{w|Summer Glau}}), and six others not mentioned in this comic.

Nathan Fillion appeared naked at the beginning and end of the show's eleventh episode, "Trash", after having been stripped of all his weapons, equipment, and clothes in a desert. [[Cueball]] is mentally overloaded by this image (either aroused or repulsed it is hard to say) to the extent that he misses the start signal.

Worried about his pursuer, Nathan wants to perform a {{w|Crazy Ivan}}, an emergency maneuver used by the crew of ''Serenity'' in the pilot episode of the series to escape the hot pursuit of a Reaver ship. It involves a 180° spin turn followed by rapid acceleration towards (and hopefully past) the pursuer, which does not have the ability to make such a rapid turn. In a ''Firefly''-class vessel, it is performed by temporarily reversing the direction of thrust of one of the two atmospheric engines, achieved by physically rotating the engine nacelle.

The name of the maneuver is taken from the antics of {{w|USSR|Soviet}} submarines in trying to detect (not to evade) enemy submarines hiding in the sonar blind-spot directly behind their vessel. In reality, sharp turns suffice for this purpose; it is not necessary to completely reverse direction. The name entered popular culture after being used in the movie ''{{w|The Hunt for Red October (film)|The Hunt For Red October}}''.

Nathan appears to understand exactly what will happen. He asks Jewel to "override the remote {{w|differential (mechanical device)|differential}}", implying that the two driven wheels could then be powered in opposite directions, causing a spin-turn. As Jewel points out, this will be unlikely to have the intended effect. Nathan is much heavier than his vehicle, and he is not securely attached to it. Momentum is his enemy. Even if it were successful, it would be utterly pointless, because he would find himself heading away from the finish line. Cueball is only pursuing him with the intent to overtake him, and the Crazy Ivan guarantees that this will happen.

Summer Glau is often a target of sexual attraction for her appearance and her well-known, eccentric characters. River Tam, in the movie ''{{w|Serenity (Film)|Serenity}}'', had subconscious programming that caused her to be able to take on dozens of foes in hand-to-hand combat, and her Terminator character in ''The Sarah Connor Chronicles'' also regularly beat on men far larger than her, which, for many, just adds to the attraction. Thus, even as Summer fells him with a devastating kick to the face, Cueball is incredibly aroused.

The title text refers to a common ability in fiction for characters to come up with an idea that is 'just crazy enough to work'. In real-life situations (such as an electric skateboard race), people are rarely able to come up with an idea that is just out-of-the-ordinary to work perfectly, and in their attempts to do so, will come up with an idea that will instead absolutely fail to work (and make them look like fools to boot).

All comics in "[[The Race]]" series:
*[[577: The Race: Part 1]]
*[[578: The Race: Part 2]]
*[[579: The Race: Part 3]]
*580: The Race: Part 4 (this one)
*[[581: The Race: Part 5]]

This series was released on five consecutive days (Monday-Friday) and not over the usual Monday/Wednesday/Friday schedule.

Electric skateboards have been the subject of several other comics like [[139: I Have Owned Two Electric Skateboards]], [[409: Electric Skateboard (Double Comic)]] and a panel in [[442: xkcd Loves the Discovery Channel]].

==Transcript==
:[Cueball and Nathan Fillion are ready on the start line on their electric skateboards.]
:Voice off panel: On your mark...

:Voice: Get set...
:Nathan: Remember episode 11, when I got all naked in that desert?

:Voice: Go!
:[Nathan speeds away leaving Cueball standing at the start line.]

:Voice: ...I said "Go."
:Voice: Someone throw some water on him.
:Cueball: Can't...get it...out of my head...

:[Nathan on walkie talkie, speeding on his skateboard.]
:Nathan: He's right behind me. Kaylee, I'm gonna try a Crazy Ivan.
:Jewel [on walkie talkie] ([[579]] shows Nathan's naming confusion): That doesn't make any sense, Nathan.
:Nathan: Trust me.

:Jewel: No, I mean it's not a skateboard maneuver. The concept doesn't even apply to this situation.
:Nathan [via walkie talkie]: That's why it ''just might work!''
:Jewel: No, that's the ''opposite'' of true!

:Nathan: On my mark, override the remote differential and throw her into a spin.
:Jewel [via walkie talkie]: okay, but—
:Nathan: Mark!
:''WHAM''

:[Nathan lying injured on the ground next to his skateboard, Cueball cruises past.]
:''Whirrrrrrrr''

:[Nathan, trying to stand up.]
:Nathan: I'm down. Tell Summer "The chickens are in the hayloft. Plan Gamma is a go."

:[Nathan, one foot on skateboard, looking at walkie talkie.]
:''mumbling from walkie talkie''
:Jewel: She says, "Plan gamma acknowledged. The meerkats are in the bag.
:[Summer Glau is walking off panel.]

:Jewel [to walkee talkie]: So we're good?
:Nathan: Hard to tell with her. Do you see an actual bag of meerkats?
:Jewel: No.
:Nathan: Then we're probably good.

:[Cueball screeching to a halt as he sees Summer Glau.]
:Cueball: Oh! Hi, Miss Glau! I'd love to talk, but Nathan's back on his feet and catching up.

:[Summer grabs Cueball's arm.]
:''Grab''
:Cueball: Wha—

:[Summer kicks Cueball in the face whilst pulling his arm towards her, he flies off his skateboard.]

:[Summer walking away as Cueball lies crippled on the floor with his sunglasses beside him.]

:[Cueball still lying on the floor.]

:Cueball [thinking]: I've never been so turned on in my life.

==Trivia==
*The xkcd's own transcript for this episode is radically wrong, and words like {{Wiktionary|maneuver}} are spelled incorrectly.

{{comic discussion}}

[[Category:The Race]]
[[Category:Comics sharing name|The Race]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Jewel Staite]]
[[Category:Comics featuring Nathan Fillion]]
[[Category:Comics featuring Summer Glau]]
[[Category:Firefly]]
[[Category:Electric skateboard]]

579: The Race: Part 3

2017-11-09T07:17:16Z

PeterMortensen: /* Explanation */ Grammar.

{{comic
| number = 579
| date = May 6, 2009
| title = The Race: Part 3
| image = the_race_part_3.png
| titletext = No, the best things about The Sarah Connor Chronicles were: (1) watching Sarah and Cameron try to pass for normal, and (2) Cameron throwing people and things through walls. Everything else was pretty secondary.
}}

==Explanation==
{{w|Firefly (TV series)|Firefly}} was a television series aired by Fox in 2002 that got cancelled midway through, but it has a large fan base nowadays (for a more comprehensive explanation, see the Wikipedia page). The star of the show was Captain Malcolm (or Mal) Reynolds, played by {{w|Nathan Fillion}}. Other members of his crew were Kaylee (played by {{w|Jewel Staite}}), the ship's mechanic, Inara Serra (played by {{w|Morena Baccarin}}) was a Companion (or, as Mal would say: whore) that helped ''Serenity'' (the spaceship) gain a landing on many planets that otherwise would have nothing to do with Mal. River Tam (played by {{w|Summer Glau}}) was the seemingly crazy younger sister of Dr. Simon Tam (played by {{w|Sean Maher}}), and due to her latent psionic powers and the damage from the experiments she had undergone, she was known for making odd, out-of-context statements.

When [[Cueball]] is introduced to the first two women, he learns that they behave in real life as on the Firefly show (Summer is strange and Jewel is a mechanical wiz) - this is why he begins to ask about Morena Baccarin, and also why the other two says '''no.''' before he can finish the question ''is she really a '''prostitute'''?''

In the last panel, Kaylee apparently wired up Mal's controller to broadcast on the frequency of Cueball's skateboard, so it took control of his board, where Mal's stood still. (Buy a few RC models ({{w|Radio-controlled model}}) to play with friends and inevitably this will happen. Where two controllers broadcast on the same frequency, so the two models are confused by the signals they receive.)

{{w|Terminator: The Sarah Connor Chronicles}} was a television series aired by Fox from 2008-09. Summer Glau played the role of Cameron, a Terminator; Cameron was played in a distinctly "strange" manner as a humanoid robot who finds much about humanity puzzling. Combined with her role as River Tam, the joke is that it wasn't Summer's characters who were eccentric, but that Summer Glau ''herself'' is actually just as strange and eccentric as she is shown to be on screen.

All comics in "[[The Race]]" series:
*[[577: The Race: Part 1]]
*[[578: The Race: Part 2]]
*579: The Race: Part 3 (this one)
*[[580: The Race: Part 4]]
*[[581: The Race: Part 5]]

This series was released on five consecutive days (Monday-Friday) and not over the usual Monday/Wednesday/Friday schedule.

Electric skateboards have been the subject of several other comics like [[139: I Have Owned Two Electric Skateboards]], [[409: Electric Skateboard (Double Comic)]] and a panel in [[442: xkcd Loves the Discovery Channel]].

==Transcript==
:[Nathan, Cueball, and Summer Glau standing around with electric skateboards.]
:Nathan: Meet a few of my friends. This is-
:Cueball: Summer Glau! You were the best part of ''Chronicles''.

:Summer: I eat my bodyweight in food every 31 days. That's slightly faster than the human average.

:[Summer stares off into space.]

:Nathan: Yeah, there's a reason she only plays strange roles.
:Cueball: Ah.
:Summer (from below): I'm part of the floor now.

:[They find Jewel Staite working on a skateboard's engine.]
:Nathan: And this is Kaylee.
:Jewel: My name is Jewel, Nathan.

:Nathan: Kaylee—
:Jewel: ''Jewel''.
:Nathan: —Jewel is fixin' up my new board.
:Jewel: Almost done!

:Cueball: So wait. Summer's actually weird, Jewel's actually a mechanical whiz...

:Cueball: ...will Morena Baccarin be here? Is she really a—
:Nathan and Jewel: No.

:The racers set up
:[Nathan and Jewel are to the far left of a full-width panel. Nathan is standing on his skateboard holding a controller. Cueball is on his skateboard which is careening out of control on the far right of the panel.]
:Nathan: Kaylee, I've been gunnin' the radio hand throttle thingy for a while, but it ain't movin'.
:Jewel: Oh, I must've set it to the wrong frequency!
:Cueball (riding around on haywire board): ''AAAAAAAA''

{{comic discussion}}

[[Category:The Race]]
[[Category:Comics sharing name|The Race]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Jewel Staite]]
[[Category:Comics featuring Nathan Fillion]]
[[Category:Comics featuring Summer Glau]]
[[Category:Firefly]]
[[Category:Electric skateboard]]

370: Redwall

2017-06-15T17:11:52Z

PeterMortensen: /* Explanation */ Grammar.

{{comic
| number = 370
| date = January 14, 2008
| title = Redwall
| image = redwall.png
| titletext = My Redwall/Jurassic Park crossover fanfic is almost complete!
}}

==Explanation==
This comic references {{w|Brian Jacques|Brian Jacques'}} series of books, ''{{w|Redwall}}'', which star sapient woodland animals in various high fantasy adventures.

The first panel shows the similarity between the story of Martin the Warrior (from the book ''{{w|Mossflower}}'') and {{w|Aragorn}} from ''{{w|The Lord of the Rings}}'' by {{w|J. R. R. Tolkien}}. The joke is that while Martin and Aragorn introduce themselves separately, they then go on to describe their particular story, which turns out to be exactly the same for both of them. Subsequently Martin jinxes Aragorn. {{w|Jinx (children's game)|Jinx}} is a common children's game, which is initiated by shouting "Jinx" after somebody speaks the same word or sentence at the same time as you. That person is then jinxed, with the usual rules dictating that they are then not permitted to speak until unjinxed by some specific action (usually somebody saying their name). Martin and his sword was referenced again in [[1722: Debugging]].

The second panel deals with the fact that ''Redwall'' mentions the name of {{w|Satan}} or {{w|The Devil}} 4 times while it never mentions {{w|God}} or {{w|Jesus}}. [[Randall Munroe|Randall]] then points out that people who protest against {{w|Harry Potter}} because of the series' witchcraft, should take note that Redwall explicitly mentions Satan although it has had little to no negative feedback from more conservative readers.

In the third panel, Randall comments on ''Redwall'''s often-used theme of critical messages being left in riddles throughout the Abbey for the occupants to find when they are in need. Randall suggests that he would use {{w|Public-key cryptography|public-key cryptography}} to encode the messages, instead of the elaborate riddles used in the books (some of which are ridiculously easy, which doesn't exactly make for good security when dealing with sensitive information).

In the title text Randall jokes that he is making a crossover {{w|Fan fiction|fan-fiction}} with ''Redwall'' and ''{{w|Jurassic Park}}''.

Redwall was also referenced in [[1688: Map Age Guide]] and [[1722: Debugging]].

==Transcript==
:Notes from reading Redwall books for the first time since childhood.

:Some of this feels familiar.
:Aragorn: Hi, I'm Aragorn.
:Martin: I'm Martin.
:Aragorn and Martin: I'm here to reforge my broken sword so I can lead an army against the tyrant threatening my people. I live in a world of moral absolutes and racist undertones.
:Martin: Jinx!

:It startled me when characters mentioned Satan.
:Redwall: "By Satan's whiskers..."
:Redwall mentions God/Jesus 0 times.
:Redwall mentions Satan/The Devil 4 times.
:(Harry Potter protesters, take note.)

:Even as a kid this bothered me: Why does everyone leave critical secret messages as simple riddles? It's silly to assume the intended recipient will be the only one to find and solve them. I would do things differently.
:Matthias: The inscription is a message from Martin!
:Brother Methuselah: What does it say?
:Matthias: Hang on, it's encrypted with my public key.

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Bar chart]]
[[Category:LOTR]]
[[Category:Religion]]
[[Category:Cryptography]]
[[Category:Animals]]
[[Category:Fiction]]

416: Zealous Autoconfig

2016-09-30T22:24:27Z

PeterMortensen: /* Explanation */ The name of the protocol is HTTP. And ref. <https://en.wiktionary.org/wiki/user-friendly#Adjective>.

{{comic
| number = 416
| date = April 28, 2008
| title = Zealous Autoconfig
| image = zealous_autoconfig.png
| titletext = I hear this is an option in the latest Ubuntu release.
}}

==Explanation==
[[Cueball]] is seen in an attempt to connect his laptop to a Wi-Fi network using, as the comic title suggests, a particularly zealous "Wifi Autoconfig" utility — "zealous" being a synonym for [http://en.m.wiktionary.org/wiki/zealous "eager" or "enthusiastic"]. The utility manages to find a secure access point named "Lenhart Family", presumably [[Miss Lenhart]]'s home Wi-Fi access point, and attempts to connect to it.

Instead of requesting a password, the program automatically begins a {{w|Dictionary attack|dictionary attack}}, entering in various commonly-used passwords in the hopes that Miss Lenhart has little regard for proper security measures (a flaw shared by many computer users). When this fails, the program attempts to exploit a {{w|Wired Equivalent Privacy|WEP}} vulnerability, which surprises Cueball. This also fails, possibly because Miss Lenhart used {{w|Wi-Fi Protected Access|WPA}} instead of WEP.

In the third panel, the autoconfig then connects to Cueball's Bluetooth phone and uses it to call a local school in order to locate the Lenhart children, which are attending there, and it reports that it has found them. It acts on this information in the fourth panel, notifying "field agents" to kidnap the Lenhart children, and then reports that the children are acquired (very fast it seems). With the children as hostages, the program begins negotiations with the parents, offering their safe return in exchange for the Wi-Fi password.

This puns on the computing sense of "negotiation": network protocols (such as HTTP) often specify routines whereby a server and a client computer can agree on the best format in which data can be transferred. This is called content negotiation or format negotiation (see for example [https://tools.ietf.org/html/rfc7231#section-3.4 section 3.4 of the specification for "semantics and content" in HTTP]).

Cueball, frightened by these actions, repeatedly presses Ctrl+C in an attempt to cancel the process, with little success. Ctrl+C is used to abort programs started from a terminal (Unix/Linux) or a command line prompt (cmd.exe under Windows). Part of the humor is that he only attempts to cancel quite late in the process, well after (for instance) the school was first called.

The title text mentions {{w|Ubuntu}}, a Linux distribution that attempts to be as user-friendly as possible. [[Randall]] mentions that he has heard that this "user-friendly" ''Zealous Autoconfig'' option has already been installed in the latest Ubuntu release...

Problems that arise when you leave decisions to a computer program are also explored in depth in comic [[1619: Watson Medical Algorithm]].

==Transcript==
:[Cueball sitting on a chair with his laptop in his lap. The text written on the lap top is shown above him, and there is a zigzag line from the lap top to the bottom of the last sentence.]
:Laptop: Starting WiFi autoconfig... searching for WiFi... Found no open networks.
:Laptop: Found secure net SSID "Lenhart Family"

:[Same setup but Cueball has changed position. This time there are two zigzag lines, between the two sentences from the laptop.]
:Laptop: Trying common passwords... Failed. Checking for WEP Vulnerabilities...
:Cueball: Um.
:Laptop: None found.

:[Cueball still sitting with laptop in his lap, but hand is on chin. Phone on table across room starts vibrating. Again only one zigzag line to the bottom sentence.]
:Laptop: Connecting to Bluetooth phone... Calling local school...
:Laptop: Found Lenhart children.

:[Zoom back to Cueball who is furiously typing on his laptop, legs stretched out.]
:Laptop: Notifying field agents. Children acquired. Calling Lenhart parents. Negotiating for WiFi password...
:Cueball [typing] on laptop: '''''Ctrl-C Ctrl-C'''''

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Miss Lenhart]]
[[Category:Computers]]
[[Category:Linux]]

1337: Hack

2016-08-27T10:18:54Z

PeterMortensen: /* Background for ISEE-3/ICE */ Space between quantity and unit - " " is a non-breaking space (see e.g. <http://english.stackexchange.com/questions/15953>).

<noinclude>:''"1337", this comic's number, redirects here. For the 2007 storyline of the same name, starting with [[341|comic 341]], see [[:Category:1337]].''</noinclude>
{{comic
| number = 1337
| date = March 3, 2014
| title = Hack
| image = hack.png
| titletext = HACK THE STARS
}}

==Explanation==
This comic is an imagined project to re-position the {{w|International Cometary Explorer|ISEE-3/ICE}} probe, and a parody of the 1995 movie ''{{w|Hackers (film)|Hackers}}''. The first row (four panels) explain the history of the probe, and the true story about how the probe was coming back into signal range and seemed capable of being controlled. NASA declined to attempt to regain control of the probe, but a group of enthusiasts assembles the equipment and attempts to re-purpose the probe.

The following two rows (eight panels) set up a fictional scenario: the enthusiasts have been locked out of the system, the probe is being controlled by someone else, and the message "Mess with the best, die like the rest" is communicated from the probe. This is a catch phrase of the protagonist, Crash, from ''Hackers''.

The final row is a reference to the ending of the movie, where Crash romances Burn, his romantic interest, in a rooftop pool. In the movie, while Crash and Burn swim in a rooftop pool, several buildings light up with the words "CRASH AND BURN". This is their friends' latest hack, and an attempt to provide romance for the new couple. In the comic the transmitter being used to communicate with ISEE-3 was hacked by Burn to make the probe burn up over Crash and Burn swimming in the pool providing a "shooting star" for romantic effect.

The comic number is 1337, which stands for "leet", short for "elite hacker" and "leetspeek" in {{w|leetspeak}}. Leetspeak is a form of symbolic writing that substitutes various numbers and {{w|ASCII}} symbols for letters. It originates from the hacker subculture, where words were converted to leetspeek e.g. to avoid filters and triggers on chat rooms. "1337" for "leet" can most likely be explained as {{w|calculator spelling}}.

The title text "Hack the stars" is also an allusion to ''Hackers'', where the phrase "Hack the planet!" is used on multiple occasions.

This project since [http://spacecollege.org/isee3/ became reality], as [[Randall]] noted in a [http://blog.xkcd.com/2014/05/30/isee-3/ blag post]. See [[#Background for ISEE-3/ICE|details below]].

==Transcript==
:[A black image shows an image of the ISEE-3/ICE spacecraft in white. Text is written in white above it]
:The ISEE-3/ICE probe was launched in 1978.
:Its mission ended in 1997 and it was sent a shutdown signal.

:[The text continues, black on white, without a frame around it, between the first frame and the next.]
:In 2008, we learned-to our surprise-that the probe didn't shut down.
:It's still running and it has plenty of fuel.
:...and in 2014, its orbit brings it near earth.

:[Megan holding up one hand and Ponytail are talking to each other.]
:Megan: We could send it on a new mission...
:Megan: Except we no longer have the equipment to send commands to it.
:Ponytail: Can't we—

:[Zoom in on Megan's head and torso as she looks towards Ponytail off-panel to the right.]
:Megan: NASA won't rebuild it. "Too Expensive"
:Ponytail (off-panel): ''Seriously?''
:Megan: I know, right?
:Megan: So the internet found the specs
:Megan: And we went to work.

:[Megan and Ponytail are walking towards right, between Hairbun facing left and Cueball (with head phones) facing right. They are sitting at desks working on their laptops. Megan speaks, as indicated both by the story line and by her hand which is lifted up, but there is not speech line from her to the text.]
:Megan: We've convinced them to give us time on the Madrid DSN transmitter and hacked the maser to support the uplink.
:Megan: And today's the big day.

:[Zoom in on Cueball's head and torso, he holds a hand up to his speaker on his head phones and watches his lit screen (as indicated by lines emanating from it).]
:Cueball: Transmitting...
:Cueball: We have a signal!
:Cueball: We have control!

:[Zoom in on Megan's head and torso. She has turned away from Cueball to the right towards Hairbun.]
:Megan: OK, transmit the new comet rendezvous maneuver sequen—
:Cueball (off panel): What ''the hell?''
:Megan: What?

:[Same setting as when Megan and Ponytail entered the control-room, but Ponytail just stands there and Megan puts a hand out towards Cueball.]
:Cueball: My console went dead!
:Hairbun: ''Mine too!''
:Megan: What's happening?!

:[Another zoom in on Cueball's head and torso and glowing screen. He has both hands down.]
:Cueball: There's a new signal going out over the transmitter!
:Megan (off panel): A bug?
:Cueball: ''Someone else is in the system!''

:[Zoom in on Hairbun's head and torso. She is also working on her laptop, with the glowing screen visible.]
:Hairbun: Kill the connection!
:Cueball (off panel): ''I can't find it!''
:Hairbun: ''They're firing the probe's engines!''
:Cueball (off panel): ''No!!''

:[Back to a zoom in on Cueball. He points at his screen.]
:Megan (off panel): ''Who's '''doing''' this??'' Stop them!
:Hairbun (off panel): ''I'm trying!''
:Cueball: ''Look! My screen!''

:[Same setting as when Megan and Ponytail entered the control-room, but Ponytail has a hand to her mouth and she and Megan stand close to Cueball who has taken his hands off the keyboard. The text on Cueball's laptop screen is shown above the setting, indicated with zigzag lines:]
:M-E-S-S-W-I-T-H-
:T-H-E-B-E-S-T

:D-I-E-L-I-K-E-
:T-H-E-R-E-S-T

:[The last four panels is outside night scenes with a black sky above. In the first of these a woman (Burn) with long hair (Megan like) and a hairy man (Crash) is seen in a swimming pool with blue water.]

:[A zoom out reveals that the pool is on top of a skyscraper in a vertically developed, downtown setting with lots of light in all the skyscrapers, one of which is even taller than the one with the pool. From the top of the central skyscraper speech lines come which indicate that the two from the pool is up there speaking, and we get their names from this panel.]
:Burn: Crash?
:Crash: Yeah, Burn?

:[Same setting but only one speech line.]
:Burn: Make a wish.

:[The last panel shows the same setting, but with the spacecraft streaking across the sky as it enters the Earths atmosphere and burns up in a way that is indistinguishable from a meteoroid.]

==Trivia==

===Background for ISEE-3/ICE===
The {{w|International Cometary Explorer|ISEE-3/ICE}} probe was launched in August 12, 1978 and tasked to study Earth's magnetic field and the solar wind. Before completing its original mission the probe was repurposed on June 10, 1982 to study the interaction between the solar wind and a cometary atmosphere. By flying through the comet {{w|21P/Giacobini–Zinner|Giacobini-Zinner}}'s tail, it became the first probe to do so. This put ISEE-3 in a {{w|heliocentric orbit}}. Its trajectory will bring it close to Earth on August 2014.

The Deep Space Network (DSN) detected the probe again in 2008 because NASA mistakenly left its transmitters on. However, the probe was only transmitting the carrier signal at that time. A status check of the spacecraft has revealed that many of its instruments are still working and that it contains plenty of fuel.[http://www.planetary.org/blogs/emily-lakdawalla/2014/02070836-isee-3.html]

It was reported that the hardware to communicate with ISEE-3/ICE had been decommissioned. The Madrid DSS complex still has the special filter required to communicate with the ICE satellite, but because of frequency conflicts S-band uplink is not supported.[http://deepspace.jpl.nasa.gov/dsndocs/810-005/101/101E.pdf]

On March 1 and 2, 2014 radio amateurs were able to detect the beacon signal from the retired NASA deep space probe ICE (International Cometary Explorer) using the 20 m radio telescope at the Bochum Observatory (Germany).[http://amsat-uk.org/2014/03/09/radio-amateurs-receive-nasa-isee-3ice-spacecraft/]

===Updates for ISEE-3/ICE===
After this comic was published, it was established that an 18-meter satellite dish at the Johns Hopkins Applied Physics Laboratory does still have the right hardware.
*April 4, 2014: Volunteers started a crowdfunding project on RocketHub to contact the probe and put it back into a {{w|halo orbit}} orbit around {{w|Lagrangian point}} L1.[http://www.rockethub.com/42228 "ISEE-3 reboot"]
*May 23, 2014: First contact to the probe was established.
*May 29, 2014: NASA gave them approval to try to achieve contact.
*May 30, 2014: The project, led by [http://www.rockethub.com/profiles/68340-dennis-wingo Dennis Wingo] and {{w|Keith Cowing}}, had taken control of the spacecraft.
*July 2, 2014: The reboot project successfully fired the thrusters for the first time since 1987. The engines on ISEE-3 performed a successful spin-up burn. The spin rate was changed to 19.76 rpm which is inside of the original mission specifications at 19.75 +/- 0.2 rpm.
**Further attempts to change the trajectory into an earth bound orbit did fail. Despite the effort from experts and amateurs via the internet [http://spacecollege.org/isee3/we-are-borg-crowdsourced-isee-3-engineering-and-the-collective-mind-of-the-internet.html] it was determined that the spacecraft had run out of nitrogen pressurant.
*Since the device was still communicating, and many of the instruments were still working, the ISEE-3 was intended to be used for the first citizen science, crowd funded, crowd sourced, interplanetary space science mission.[http://spacecollege.org/isee3/announcing-the-isee-3-interplanetary-citizen-science-mission.html]
*{{w|International_Cometary_Explorer#Contact_lost|Contact was finally lost}} on 2014-09-16.

See [http://spacecollege.org/isee3/ Space College: ISEE-3 Reboot Project Archives] for the coverage of this amazing project.

{{comic discussion}}

[[Category:Comics with inverted brightness]]
[[Category:Comics with color]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring Hairbun]]
[[Category:Space probes]]
[[Category:Astronomy]]
[[Category:Computers]]

1597: Git

2016-06-12T16:37:15Z

PeterMortensen: /* TL;DR */ Spelling/case.

{{comic
| number = 1597
| date = October 30, 2015
| title = Git
| image = git.png
| titletext = If that doesn't fix it, git.txt contains the phone number of a friend of mine who understands git. Just wait through a few minutes of 'It's really pretty simple, just think of branches as...' and eventually you'll learn the commands that will fix everything.
}}

==Explanation==
===This is Git===
{{w|Git (software)|Git}} is a version control system, used to manage the code in many thousands of open source software projects. It is very powerful, and was amongst the first widely adopted tools to use a distributed version control model (the "beautiful [https://en.wikipedia.org/wiki/Graph_theory graph theory] [https://en.wikipedia.org/wiki/Tree_(graph_theory) tree model]"), meaning that there is no single central repository of code. Instead, users share code back and forth to synchronise their repositories, and it is up to each project to define processes and procedures for managing the flow of changes into a stable software product.
===How do we use it?===
Although very powerful, the command line of Git is notoriously difficult to learn and master. Dozens of blog posts and websites (see [http://think-like-a-git.net/epic.html], [http://stevebennett.me/2012/02/24/10-things-i-hate-about-git/]), and even books ([http://blog.anvard.org/conversational-git/chapter-01.html], [http://git-scm.com/book/en/v2]) have been written to help users navigate this complexity.

The difficulty of using Git in common situations is belied by the apparent simplicity of its use in tutorial-style situations. Committing and sharing changes is fairly straightforward, for instance, but recovering from situations such as accidental commits, pushes or bad merges is difficult without a solid understanding of the rather large and complex conceptual model. For instance, three of the top five highest voted questions on Stack Overflow are questions about how to carry out relatively simple tasks: undoing the last commit, changing the last commit message, and deleting a remote branch.

This comic thus explores the difference between the idealised view of Git's architecture, and its actual typical usage. Tutorials for Git tend to use simple systems in their examples, and only deal with the most basic commands to get started, which can create the misleading impression that Git can be used effectively without extensive study.

Due to this problem, compounded by the fact that Git's commands are named differently from similar commands in other version control systems, many users (including Cueball) are unable to use it beyond basic commands, and might try to avoid problems by saving their code outside Git, downloading a newer copy, and then re-applying their changes to the new copy instead of trying to understand and use the features that exist in Git to accomplish this task.

===Memorize these shell commands===
Cueball suggests "just memoriz[ing] these shell commands and type them to sync up". He is probably referring to a sequence of commands such as:

git pull
# remote changes have now been received, so work on your file
git add file.txt
git commit -m "Added some text"
git push

===If you get errors...===
As long as every contributor to the project follows these principles, this may suffice for a while. But many situations may cause "errors":

* merge conflicts (two people editing the same part of the same file)
* unmerged changes (another person committed a change before you did, so you need to merge their changes first)
* attempting to recover from a situation such as an accidental merge, and making the situation worse.

In a situation such as a merge conflict, Git will show an error message such as:

CONFLICT (modify/delete): README.md deleted in HEAD and modified in branch-b. Version branch-b of README.md left in tree.
# Automatic merge failed; fix conflicts and then commit the result.

===Save your work elsewhere...===
Although Git experts can of course deal with such situations, the remedy proposed by Cueball is "save your work elsewhere, delete the project, and download a fresh copy". That is, to copy the files out of their local repository's working directory, delete that whole structure, then clone the remote repository again (and, implicitly, copy the saved work back again):

# Copy files elsewhere
mkdir /tmp/myproject
cp * /tmp/myproject
cd ..
# delete the project
rm -rf myproject

# Download a fresh copy
git clone https://github.com/myorg/myproject
cd myproject

# Copy saved work
cp /tmp/myproject/* .

Abandoning the old project likely means losing some work, but may be faster and give a more predictable outcome than attempting to salvage the situation. Applying this method to a mere merge conflict issue may prolong the issue however, as the merge conflicts may still be present.

===Title text===
The title text suggests an alternative method for working around Git's complexities, which reflects common practice: knowing a "Git expert" who can help in any situation. Such experts are somewhat notorious for waxing lyrically about Git's strengths, so it may be necessary to win their favour by first letting them ramble enthusiastically about it. They will hopefully eventually give the exact commands needed. In practice, the question-and-answer site Stack Overflow is frequently used for this exact purpose.

It may even be a reference to the infamous tweet "[https://twitter.com/agnoster/status/44636629423497217 Git gets easier once you get the basic idea that branches are homeomorphic endofunctors mapping submanifolds of a Hilbert space]" which has been [http://www.beyondjava.net/blog/git-explained-in-really-simple-words/ discussed here] but it is inconclusive whether a meaningful interpretation exists.

Putting a telephone number of someone who "understands Git" into such a file is humorous because:
*Software teams would more normally use electronic means of communication
*Explaining Git over the phone to team members should not be necessary, as there is extensive help available online, and
*In the situation where many team members would need phone support to avoid or fix basic Git problems, this would be extremely distracting to the person whose phone number was given in the file.

=== TL;DR===
In short: programmers use {{w|Version control|version control systems}} to track changes to code. Most of these version control systems are quite similar and easy to learn if you already know another one. Git is a version control system based on completely different principles, and most programmers find it difficult to wrap their heads around it (although Git also offers a large number of nontrivial benefits over standard version control systems, which is why it is used). Cueball is one of those programmers.

The comic [[1296: Git Commit]] also features Git.

==Transcript==
:[Cueball points to a computer on a desk while Ponytail and Hairy are standing further away behind an office chair.]
:Cueball: This is git. It tracks collaborative work on projects through a beautiful distributed graph theory tree model.
:Ponytail: Cool. How do we use it?
:Cueball: No idea. Just memorize these shell commands and type them to sync up. If you get errors, save your work elsewhere, delete the project, and download a fresh copy.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring Hairy]]
[[Category:Programming]]
[[Category:Computers]]
[[Category:Internet]]

1597: Git

2016-06-12T16:36:28Z

PeterMortensen: /* Title text */ Used the official name of Stack Overflow - see section "Proper Use of the Stack Exchange Name" in <http://stackoverflow.com/legal/trademark-guidance> (the last section), etc. [2].

{{comic
| number = 1597
| date = October 30, 2015
| title = Git
| image = git.png
| titletext = If that doesn't fix it, git.txt contains the phone number of a friend of mine who understands git. Just wait through a few minutes of 'It's really pretty simple, just think of branches as...' and eventually you'll learn the commands that will fix everything.
}}

==Explanation==
===This is Git===
{{w|Git (software)|Git}} is a version control system, used to manage the code in many thousands of open source software projects. It is very powerful, and was amongst the first widely adopted tools to use a distributed version control model (the "beautiful [https://en.wikipedia.org/wiki/Graph_theory graph theory] [https://en.wikipedia.org/wiki/Tree_(graph_theory) tree model]"), meaning that there is no single central repository of code. Instead, users share code back and forth to synchronise their repositories, and it is up to each project to define processes and procedures for managing the flow of changes into a stable software product.
===How do we use it?===
Although very powerful, the command line of Git is notoriously difficult to learn and master. Dozens of blog posts and websites (see [http://think-like-a-git.net/epic.html], [http://stevebennett.me/2012/02/24/10-things-i-hate-about-git/]), and even books ([http://blog.anvard.org/conversational-git/chapter-01.html], [http://git-scm.com/book/en/v2]) have been written to help users navigate this complexity.

The difficulty of using Git in common situations is belied by the apparent simplicity of its use in tutorial-style situations. Committing and sharing changes is fairly straightforward, for instance, but recovering from situations such as accidental commits, pushes or bad merges is difficult without a solid understanding of the rather large and complex conceptual model. For instance, three of the top five highest voted questions on Stack Overflow are questions about how to carry out relatively simple tasks: undoing the last commit, changing the last commit message, and deleting a remote branch.

This comic thus explores the difference between the idealised view of Git's architecture, and its actual typical usage. Tutorials for Git tend to use simple systems in their examples, and only deal with the most basic commands to get started, which can create the misleading impression that Git can be used effectively without extensive study.

Due to this problem, compounded by the fact that Git's commands are named differently from similar commands in other version control systems, many users (including Cueball) are unable to use it beyond basic commands, and might try to avoid problems by saving their code outside Git, downloading a newer copy, and then re-applying their changes to the new copy instead of trying to understand and use the features that exist in Git to accomplish this task.

===Memorize these shell commands===
Cueball suggests "just memoriz[ing] these shell commands and type them to sync up". He is probably referring to a sequence of commands such as:

git pull
# remote changes have now been received, so work on your file
git add file.txt
git commit -m "Added some text"
git push

===If you get errors...===
As long as every contributor to the project follows these principles, this may suffice for a while. But many situations may cause "errors":

* merge conflicts (two people editing the same part of the same file)
* unmerged changes (another person committed a change before you did, so you need to merge their changes first)
* attempting to recover from a situation such as an accidental merge, and making the situation worse.

In a situation such as a merge conflict, Git will show an error message such as:

CONFLICT (modify/delete): README.md deleted in HEAD and modified in branch-b. Version branch-b of README.md left in tree.
# Automatic merge failed; fix conflicts and then commit the result.

===Save your work elsewhere...===
Although Git experts can of course deal with such situations, the remedy proposed by Cueball is "save your work elsewhere, delete the project, and download a fresh copy". That is, to copy the files out of their local repository's working directory, delete that whole structure, then clone the remote repository again (and, implicitly, copy the saved work back again):

# Copy files elsewhere
mkdir /tmp/myproject
cp * /tmp/myproject
cd ..
# delete the project
rm -rf myproject

# Download a fresh copy
git clone https://github.com/myorg/myproject
cd myproject

# Copy saved work
cp /tmp/myproject/* .

Abandoning the old project likely means losing some work, but may be faster and give a more predictable outcome than attempting to salvage the situation. Applying this method to a mere merge conflict issue may prolong the issue however, as the merge conflicts may still be present.

===Title text===
The title text suggests an alternative method for working around Git's complexities, which reflects common practice: knowing a "Git expert" who can help in any situation. Such experts are somewhat notorious for waxing lyrically about Git's strengths, so it may be necessary to win their favour by first letting them ramble enthusiastically about it. They will hopefully eventually give the exact commands needed. In practice, the question-and-answer site Stack Overflow is frequently used for this exact purpose.

It may even be a reference to the infamous tweet "[https://twitter.com/agnoster/status/44636629423497217 Git gets easier once you get the basic idea that branches are homeomorphic endofunctors mapping submanifolds of a Hilbert space]" which has been [http://www.beyondjava.net/blog/git-explained-in-really-simple-words/ discussed here] but it is inconclusive whether a meaningful interpretation exists.

Putting a telephone number of someone who "understands Git" into such a file is humorous because:
*Software teams would more normally use electronic means of communication
*Explaining Git over the phone to team members should not be necessary, as there is extensive help available online, and
*In the situation where many team members would need phone support to avoid or fix basic Git problems, this would be extremely distracting to the person whose phone number was given in the file.

=== TL;DR===
In short: programmers use {{w|Version control|version control systems}} to track changes to code. Most of these version control systems are quite similar and easy to learn if you already know another one. Git is a version control system based on completely different principles, and most programmers find it difficult to wrap their heads around it (although Git also offers a large number of nontrivial benefits over standard version control systems, which is why it is used). Cueball is one of those programmers.

The comic [[1296: Git Commit]] also features git.

==Transcript==
:[Cueball points to a computer on a desk while Ponytail and Hairy are standing further away behind an office chair.]
:Cueball: This is git. It tracks collaborative work on projects through a beautiful distributed graph theory tree model.
:Ponytail: Cool. How do we use it?
:Cueball: No idea. Just memorize these shell commands and type them to sync up. If you get errors, save your work elsewhere, delete the project, and download a fresh copy.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring Hairy]]
[[Category:Programming]]
[[Category:Computers]]
[[Category:Internet]]

1597: Git

2016-06-12T16:34:03Z

PeterMortensen: /* How do we use it? */ Used the official name of Stack Overflow - see section "Proper Use of the Stack Exchange Name" in <http://stackoverflow.com/legal/trademark-guidance> (the last section), etc.

{{comic
| number = 1597
| date = October 30, 2015
| title = Git
| image = git.png
| titletext = If that doesn't fix it, git.txt contains the phone number of a friend of mine who understands git. Just wait through a few minutes of 'It's really pretty simple, just think of branches as...' and eventually you'll learn the commands that will fix everything.
}}

==Explanation==
===This is Git===
{{w|Git (software)|Git}} is a version control system, used to manage the code in many thousands of open source software projects. It is very powerful, and was amongst the first widely adopted tools to use a distributed version control model (the "beautiful [https://en.wikipedia.org/wiki/Graph_theory graph theory] [https://en.wikipedia.org/wiki/Tree_(graph_theory) tree model]"), meaning that there is no single central repository of code. Instead, users share code back and forth to synchronise their repositories, and it is up to each project to define processes and procedures for managing the flow of changes into a stable software product.
===How do we use it?===
Although very powerful, the command line of Git is notoriously difficult to learn and master. Dozens of blog posts and websites (see [http://think-like-a-git.net/epic.html], [http://stevebennett.me/2012/02/24/10-things-i-hate-about-git/]), and even books ([http://blog.anvard.org/conversational-git/chapter-01.html], [http://git-scm.com/book/en/v2]) have been written to help users navigate this complexity.

The difficulty of using Git in common situations is belied by the apparent simplicity of its use in tutorial-style situations. Committing and sharing changes is fairly straightforward, for instance, but recovering from situations such as accidental commits, pushes or bad merges is difficult without a solid understanding of the rather large and complex conceptual model. For instance, three of the top five highest voted questions on Stack Overflow are questions about how to carry out relatively simple tasks: undoing the last commit, changing the last commit message, and deleting a remote branch.

This comic thus explores the difference between the idealised view of Git's architecture, and its actual typical usage. Tutorials for Git tend to use simple systems in their examples, and only deal with the most basic commands to get started, which can create the misleading impression that Git can be used effectively without extensive study.

Due to this problem, compounded by the fact that Git's commands are named differently from similar commands in other version control systems, many users (including Cueball) are unable to use it beyond basic commands, and might try to avoid problems by saving their code outside Git, downloading a newer copy, and then re-applying their changes to the new copy instead of trying to understand and use the features that exist in Git to accomplish this task.

===Memorize these shell commands===
Cueball suggests "just memoriz[ing] these shell commands and type them to sync up". He is probably referring to a sequence of commands such as:

git pull
# remote changes have now been received, so work on your file
git add file.txt
git commit -m "Added some text"
git push

===If you get errors...===
As long as every contributor to the project follows these principles, this may suffice for a while. But many situations may cause "errors":

* merge conflicts (two people editing the same part of the same file)
* unmerged changes (another person committed a change before you did, so you need to merge their changes first)
* attempting to recover from a situation such as an accidental merge, and making the situation worse.

In a situation such as a merge conflict, Git will show an error message such as:

CONFLICT (modify/delete): README.md deleted in HEAD and modified in branch-b. Version branch-b of README.md left in tree.
# Automatic merge failed; fix conflicts and then commit the result.

===Save your work elsewhere...===
Although Git experts can of course deal with such situations, the remedy proposed by Cueball is "save your work elsewhere, delete the project, and download a fresh copy". That is, to copy the files out of their local repository's working directory, delete that whole structure, then clone the remote repository again (and, implicitly, copy the saved work back again):

# Copy files elsewhere
mkdir /tmp/myproject
cp * /tmp/myproject
cd ..
# delete the project
rm -rf myproject

# Download a fresh copy
git clone https://github.com/myorg/myproject
cd myproject

# Copy saved work
cp /tmp/myproject/* .

Abandoning the old project likely means losing some work, but may be faster and give a more predictable outcome than attempting to salvage the situation. Applying this method to a mere merge conflict issue may prolong the issue however, as the merge conflicts may still be present.

===Title text===
The title text suggests an alternative method for working around Git's complexities, which reflects common practice: knowing a "Git expert" who can help in any situation. Such experts are somewhat notorious for waxing lyrically about Git's strengths, so it may be necessary to win their favour by first letting them ramble enthusiastically about it. They will hopefully eventually give the exact commands needed. In practice, the question-and-answer site StackOverflow.com is frequently used for this exact purpose.

It may even be a reference to the infamous tweet "[https://twitter.com/agnoster/status/44636629423497217 git gets easier once you get the basic idea that branches are homeomorphic endofunctors mapping submanifolds of a Hilbert space]" which has been [http://www.beyondjava.net/blog/git-explained-in-really-simple-words/ discussed here] but it is inconclusive whether a meaningful interpretation exists.

Putting a telephone number of someone who "understands git" into such a file is humorous because:
*Software teams would more normally use electronic means of communication
*Explaining git over the phone to team members should not be necessary, as there is extensive help available online, and
*In the situation where many team members would need phone support to avoid or fix basic git problems, this would be extremely distracting to the person whose phone number was given in the file.

=== TL;DR===
In short: programmers use {{w|Version control|version control systems}} to track changes to code. Most of these version control systems are quite similar and easy to learn if you already know another one. Git is a version control system based on completely different principles, and most programmers find it difficult to wrap their heads around it (although Git also offers a large number of nontrivial benefits over standard version control systems, which is why it is used). Cueball is one of those programmers.

The comic [[1296: Git Commit]] also features git.

==Transcript==
:[Cueball points to a computer on a desk while Ponytail and Hairy are standing further away behind an office chair.]
:Cueball: This is git. It tracks collaborative work on projects through a beautiful distributed graph theory tree model.
:Ponytail: Cool. How do we use it?
:Cueball: No idea. Just memorize these shell commands and type them to sync up. If you get errors, save your work elsewhere, delete the project, and download a fresh copy.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring Hairy]]
[[Category:Programming]]
[[Category:Computers]]
[[Category:Internet]]

1649: Pipelines

2016-03-02T02:57:46Z

PeterMortensen: Copy edited. Space between quantity and unit - " " is a non-breaking space (see e.g. <http://english.stackexchange.com/questions/15953>).

{{comic
| number = 1649
| date = February 29, 2016
| title = Pipelines
| image = pipelines.png
| titletext = In the future, every single pipeline will lead to the bowl of a giant blender, and we'll all just show up with a bucket each day to take our share of the resulting smoothie.
}}

==Explanation==
{{incomplete|The table with all the items should be filled out with explanations etc. and the diameter should be calculated from real data (with references).}}

Follows a similar idea to the [[what if?]] {{what if|147|Niagara Straw}}, (from three days before this comic's release), where the entire water flow over {{w|Niagara Falls}} is imagined to flow through a straw (i.e. 7 mm diameter with disastrous results).

In this comic [[Randall]] imagines what size pipes are necessary to carry US domestic production/consumption of various fluids if the flow rate were fixed at 4 meters per second. Randall notes that "many pipes would overlap", owing to the fact that consumption of one item as corn syrup would be due to the production of one of the others, in this case soda pop (another example, than the previous one which is actually mentioned in the comic, could be gasoline which is produced from petroleum ).

The top panel is in [http://store-xkcd-com.myshopify.com/products/actual-size-stickers actual size] (something Randall often jokes about but here he means it). This means that if you look at the image in actual size (or measure lengths in the full size image) then the measured diameter is the diameter Randall has calculated the pipe should be, based on his data for the consumption of these substances.

In the second panel the pipes are too big for his drawing. To indicate the scale he has both inserted a human (appearance like [[Megan]], but with blonde hair, i.e. not Megan) and the top panel has been shrunk down to indicate how much larger the bottom panel is (this is similar to the link between the panels in [[980: Money]]). Using the size of the top panel and the smaller insert, it can be found that the scale is 20:1. (The woman is 9 cm high in the image, which makes her 180 cm -- 5 feet 11 inches -- in "real life"). The pipe next to her for gasoline would be 2.2 m high.

Since the caption at the top mentions both fluid produced and consumed in the US it becomes very difficult to find out which number Randall uses. For instance the consumption of wine in the US and the production of wine in the US is not necessarily the same as wine is both imported and exported. Should there then be two pipes? Unlike similar comics (like Money mentioned above) there are no references for where Randall has the data for this comic.

As usual with xkcd, the absurdity -- and improbability -- of routing the entirety of each fluid through a single pipe at any point is the source of humor. In addition, despite Randall's stated assumption that all the fluids are magically flowing at the same rate as public water (4 meters per second), many could never actually do so; some "fluids" shown are too viscous (e.g. peanut butter, Silly Putty, meat), adhesive (e.g. maple syrup), or thermally impractical (e.g. glass, cheese, ice cream and yogurt). Lastly, many are just plain zany (e.g. saliva a reference to another what if? {{what if|144|Saliva Pool}}). Note that at the bottom of the last panel there is a much larger pipe for the tap water used by the public. All substances are listed below in the [[#Table|table]].

The title text refers to a possible future based on the idea of this comic in which all the pipes with the above mentioned fluids will actually lead into the same hole as shown in the top right panel. This hole will then be the bowl of a giant blender that mixes all these substances together to a ''{{w|smoothie}}''. The future people will then just come up to this blender and get a bucket full of this mix each day.

Note: "Soup" has been left out, and it might have been expected in this comic due to the similarity to this system with [[Beret Guy|Beret Guy's]] use of a "soup outlet" as an entrepreneur in [[1293: Job Interview]]. It is probably a larger pipeline than salsa and possibly even ketchup. However, most soup is probably not bought finished, and this is a very good reason to not include it in the chart. But still the idea of having a soup outlet is very similar to this comic.

===Table===
*All the substances are listed here in the "reading" order also used in the transcript.
*The diameter is for the inner part of the tube.
*GL is for GigaLiters - or Billion Liters. This is strictly the annual discharge of the Size (cm) column at 4 m/s.
{| class="wikitable sortable"
|-
|+ All substances with size as found in the picture, vs. size calculated from public information
|-
! scope="col" | Substance
! scope="col" | Size (cm)
! scope="col" | Annual Discharge (GL)
! scope="col" | Calculated size (cm)
! scope="col" | Explanation
|-
| {{w|Toothpaste}}
| 3.5
| 0.121
| 3.6
| In the title text of [[1599: Water Delivery]] Randall claims that he as a child could not understand whyt there were no toothpaste pipe to his house when there was one for water... Giving this is at the top, this is a clear allusion to this comment. Calculation is based on 542 g/year per capita consumption of toothpaste, which I found [https://www.google.co.il/search?q=toothpaste+consumption+by+country&num=100&espv=2&rlz=1C1VFKB_enIL627IL627&tbm=isch&imgil=2wpGcxkoKlCvAM%253A%253BvrrYrXTGlziE6M%253Bhttp%25253A%25252F%25252Fwww.sanasecurities.com%25252Ftop-story%25252Ffuture-prospect-indian-oral-care-industry&source=iu&pf=m&fir=2wpGcxkoKlCvAM%253A%252CvrrYrXTGlziE6M%252C_&usg=__g9B9_HQ-jLim5P25Ov5d6l6BiNk%3D&biw=1920&bih=955&ved=0ahUKEwjLiMn-op_LAhVD4XIKHcvPCMsQyjcIJA&ei=I27VVovrEsPCywPLn6PYDA#imgrc=2wpGcxkoKlCvAM%3A here]. (Sorry couldn't click the link on my work computer for some reason...) I'm not even sure what year the graph is from, so I guessed 2013, and used 316.5 million estimated 2013 US population to calculate the diameter above.
|-
| {{w|Nail polish}}
| 0.4
| 0.000159
|
|
|-
| {{w|Windshield washer fluid}}
| 5.6
| 0.311
|
|
|-
| {{w|Silly putty}}
| 0.1
| 0.0000991
|
| Smallest diameter
|-
| {{w|Shampoo}}
| 4
| 0.159
|
|
|-
| {{w|Honey}}
| 5.2
| 0.268
|
|
|-
| {{w|Blood donation|Donated blood}}
| 0.9
| 0.00803
|
|
|-
| {{w|Vanilla}}
| 0.4
| 0.000159
|
| Not the ice but the spice (which is black as the substance in the vanilla pipe).
|-
| {{w|Ketchup}}
| 5.2
| 0.268
|
|
|-
| {{w|Salsa (sauce)|Salsa}}
| 3.6
| 0.128
|
|
|-
| {{w|Sunscreen}}
| 1.35
| 0.0181
|
|
|-
| {{w|Personal lubricant}}
| 0.65
| 0.00419
|
| Aka lube
|-
| {{w|LCD liquid}}
| 0.26
| 0.000670
|
| For {{w|Liquid-crystal display}}
|-
| {{w|Mayonnaise|Mayo}}
| 4.4
|
| Or mayonnaise
|-
| {{w|Printer ink}}
| 1.4
| 0.192
|
|-
| {{w|Maple syrup}}
| 1.8
| 0.0178
|
|
|-
| {{w|Hair conditioner|Conditioner}}
| 2.5
| 0.0620
|
| For hair
|-
| {{w|Mustard (condiment)|Mustard}}
| 3.7
| 0.136
|
|
|-
| {{w|Liquid soap}}
| 4.7
| 0.219
|
|
|-
| {{w|Olive oil}}
| 6.2
| 0.381
|
| Largest diameter in the upper chart
|-
| {{w|Coffee}}
| 58
| 33.4
|
|
|-
| {{w|Peanut butter}}
| 8.6
| 0.733
|
| Smallest diameter in the bottom chart
|-
| {{w|Ice cream}}
| 20
| 3.97
|
|
|-
| {{w|Cheese}}
| 70
| 48.6
|
| Made from milk (cow) also in the chart
|-
| {{w|Carbonated water|Soda}}
| 82
| 66.7
|
| As in club soda
|-
| {{w|Acetone}}
| 13.6
| 1.83
|
|
|-
| {{w|Liquor}}
| 15
| 2.23
|
|
|-
| {{w|Gasoline}}
| 220
| 480.
|
| Made from petrol, also in the chart
|-
| {{w|Yogurt}}
| 15
| 2.23
|
| Made from milk (cow), also in the chart
|-
| {{w|Milk#Cow.27s_milk|Milk (cow)}}
| 106
| 111
|
|
|-
| {{w|Bottled water}}
| 71
| 50.0
|
| See also [[1599: Water Delivery]]
|-
| {{w|Sugar}}
| 42
| 17.5
|
| See also [[1639: To Taste]]
|-
| {{w|Saliva}}
| 85
|
| From these data it could be calculated how long it would take America to drool enough to fill that pool from the what if? {{what if|144|Saliva Pool}}.
|-
| {{w|Wine}}
| 18
| 18.5
| Americans drank just under [https://www.wineinstitute.org/resources/statistics/article86 900 million gallons of wine in 2014], or almost 3.4 million cubic metres per year meaning that Americans drink about 0.11 m3/s. With the pipe flowing at 4 m/s this pipe must have an area of 268cm2. The radius of a pipe of area 268cm^2 is 9.25 cm. The wine pipe should thus have a diameter of 18.5 cm, very close to the one found by measuring on the chart.
|-
| {{w|HFCS}}
| 20
|
| High fructose corn syrup
|-
| {{w|Breast milk|Milk (human)}}
| 10.6
|
|
|-
| {{w|Petroleum}}
| 318
|
| Largest diameter in the bottom chart, except for the public water. Also known as crude oil. Used to make for instance gasoline, also in the chart.
|-
| {{w|Meat}}
| 59
|
|
|-
| {{w|Glass}}
| 28
|
|
|-
| {{w|Beer}}
| 54
|
|
|-
| {{w|Tea}}
| 41
|
|
|-
| {{w|Cement}}
| 74
|
|
|-
| {{w|Tap water|Public water}}
| 2550
|
| Using the formula [http://math.stackexchange.com/questions/564058/calculate-the-radius-of-a-circle-given-the-chord-length-and-height-of-a-segment here] it is possible to calculate the diameter of a circle given the chord length = l and height = h of a segment. From the drawing (and scaling) l = 390 cm and h = 15 cm. The formula states that D = h + l2/(4*h) = 15 cm + (390 cm)2/(4*15 cm) = 2550 cm.
|}

==Transcript==
:[Caption above the first main panel, to the left of a smaller panel to the right.]
:<big>The size of the US’s</big>
:<big><big>'''Pipelines'''</big></big>
:<big>if each fluid produced or consumed in the US has to be carried by a single pipe</big>
:Assuming they all flowed at the same speed of about 4m/s
:Note: Many pipelines would overlap (eg. '''soda'''/corn syrup)

:[There is a small panel to the right showing three gray pipes of different sizes leading out over a large hole in the ground. Only a part of the hole can be seen at the bottom left part of the panel, but it curves around indicating it is a large circular hole. The pipes are supported by small legs beneath them and from the end of all three thick liquids are squirting out and down into the hole. The first pipe is by far the largest; the liquid from it is white, but not as white as the background. The second pipe is by far the smallest squirting dark red liquid and the final rightmost pipe is in between and squirts our light brown liquid. Each pipe is labeled. The label on the smallest cannot be read properly, but from the info gained in the next panel it can be inferred for certain what it says (and this is indicated here below):]
:[Large pipe (white)]: Mayo
:[Small pipe (dark red)]: Nail polish
:[Medium pipe (light brown)]: Maple syrup

:[Below is a large panel with a caption at the top. And below this there are twenty circles in different sizes and with different color (or even texture). Each circle is labeled, for the five smallest the label is outside, in one case with an arrow indicating where the label belongs. The rest has the label inside. The text is in black except for four of those with text inside, but with red of black color. Here the text is white. The labels are indicated by color and size, going roughly from top left in reading order based on the position and size of circles not of position of the text:]

:<big>Actual size </big> (When viewed on a typical computer screen) 
:[Medium green blue and white spiral]: Toothpaste
:[Tiny dark red]: Nail polish
:[Big light blue with white specks]: Windshield washer fluid
:[Very tiny purple]: Silly putty
:[Medium light green]: Shampoo
:[Large dark yellow]: Honey
:[Very small blood red]: Donated blood
:[Tiny black]: Vanilla
:[Big red]: Ketchup
:[Medium dark red with chunks of in different green and lighter red colors]: Salsa
:[Small white]: Sunscreen
:[Very small light green]: Personal lubricant
:[Very tiny gray]: LCD liquid
:[Medium off-white]: Mayo
:[Very small black]: Printer ink
:[Small light brown]: Maple syrup
:[Small light green]: Conditioner
:[Medium yellow]: Mustard
:[Large light green]: Liquid soap
:[Big olive green]: Olive oil

:[The panel just described is indicated to fit into a small rectangle at the top left of the next panel below. There are four lines ending at the four corners of this small rectangle, two of these are going to the two bottom corners and the other two ends on the lower part of the panel just above the small rectangle. They are indicated to go under the panel and would hit the two top corners if extrapolated). The 11 largest circles are clearly seen, but most of the other circles can also be noted. The colors are the same but any features in the original circles as well as the labels are gone. The part of the black top frame of the next panel below is faded out to gray in between the section cut off by the two lines going to the bottom corners of the panel above. This rectangle indicated the increasing size compared to the first panel above.]

:[Apart from the insert mentioned above the second panel follows the same layout, but with 22 circles with even larger range of sizes. The panel is more than twice as long as the first panel. A Megan-like girl, but with white hair, is drawn at the top of the panel just left of the middle. Her hair close to the top, just below the line going to the right corner above. There are two medium and five smaller circles to her left and one small close to her head and one huge circle to her right. Her feet are less than a third down this panel standing on top of the next row of circles. In the bottom half of the panel there is a giant circle which almost touches the left side of the panel. There are smaller circles above it and down along the right side. One last circle is to the left almost at the bottom. At the very bottom is a slightly curving line to indicate a much much larger blue circle that only graces the panel (no. 23). There is a small green fish in this water to the left of the label. Below the labels are again listed as above. One label has a foot note. But it is written directly beneath the circle in which it is referenced. So it will be written together with the label on the next line. There is also one case with an arrow used to indicate where the label belongs.]

:[Medium dark gray]: Coffee
:[Very tiny gray]: Peanut butter
:[Very small gray with black specks]: Ice cream
:[Very small yellow with white specks]: Cheese
:[Large brown with white fizzing]: Soda
:[Tiny White]: Acetone
:[Tiny gray]: Liquor
:[Huge dark yellow]: Gasoline
:[Tiny White with blue and orange specks]: Yogurt
:[Big white]: Milk (cow)
:[Large light blue]: Bottled water
:[Small white]: Sugar
:[Large light gray with white specks]: Saliva
:[Very small light yellow]: Wine
:[Very small orange]: HFCS
:[Very tiny white]: Milk (human)
:[Gigantic dark gray]: Petroleum
:[Medium dark red with black texture]: Meat (mostly solid)
:[Small white]: Glass*
::<nowiki>*</nowiki>Solid at room temperature
:[Medium light brown]: Beer
:[Small gray brown]: Tea
:[Large gray]: Cement
:[Gracing bottom of panel light blue]: Public water

==Trivia==
*In addition to the what if? article, the relevancy of pipelines, particularly regarding public water, is heightened due to the ongoing public health crisis in {{w|Flint, Michigan}}, caused by recent (mis-)management of their public water system.<ref>McLaughlin, Elliot. [http://edition.cnn.com/2016/01/18/us/flint-michigan-water-crisis-five-things/index.html “5 things to know about Flint's water crisis”], '{{w|CNN}}', January 21 2016. Retrieved 1 March 2016.</ref>
**Studies have shown that temporary use of the Flint River as a water source caused corrosive water to leach lead from old pipes, causing lead poisoning in many residents, particularly children; other ill effects in addition to lead have been noted.
**The crisis has lead to a public outcry against the state "emergency financial management" team appointed and supervised by the state executive (Gov. Rick Snyder and staff) and an outpouring of support from nearby communities such as Metro Detroit via bottled water donations to Flint residents.
*This is the third comic posted on Leap Day ({{w|February 29}}); the previous ones were:
**[[390: Nightmares]] also like this one on a Friday in 2008 and
**[[1023: Late-Night PBS]] on a Wednesday in 2012.
**If the current M-W-F schedule continues, the next such comic will not happen before 2036 when the leap day again falls on a Friday.
**It may also be interesting to note that the first three leap years after xkcd began (in just over 10 years) all fell on a release day, then followed by a break of 20 years. In addition, three of these first four leap days all fell on a Friday.

==References==
<references />

{{comic discussion}}

[[Category:Comics with color]]
[[Category:Charts]]
[[Category:Food]]
[[Category:Animals]]

1530: Keyboard Mash

2015-11-03T20:47:44Z

PeterMortensen: /* Explanation */ Grammar.

{{comic
| number = 1530
| date = May 27, 2015
| title = Keyboard Mash
| image = keyboard mash.png
| titletext = WHY DON'T YOU COME HANG OUT INSIDE MY HOUSE. WE CAN COOK BREAD AND CHAT ABOUT OUR INTERNAL SKELETONS.
}}

==Explanation==
[[Cueball]] is chatting with [[White Hat]], who says he is frustrated because a barking dog is preventing him from sleeping and White Hat mashes the {{w|keyboard}} to show his frustration. Keyboard mashing is often used in this way where the user makes their hands spasm across the keyboard, creating a line of text that can be compared to an angry groan in real life. Cueball is about to give some advice, but is confused by a quirk in what White Hat typed. All the characters he typed (except one) were on the home row of the QWERTY keyboard, the row starting with the letters A, S, D, and F, in the middle of the keyboard. The letters A, S, D, F, J, K, and L (all from the home row) are scattered throughout the text, but there is a 7 (which comes from the numbers row, on top of the keyboard) in the middle of this text. Cueball, wonders how White Hat put a seven in there, because if White Hat was keyboard mashing and touched the 7 key, he likely would have hit any of the QWERTY row keys because of keyboard mashing hand spasms, but he didn't. All the other characters were on the home row. White Hat berates Cueball for always focusing on strange, tiny details. When the final panel shows what's going on where White Hat is, we see that a giant {{w|spider}} has imprisoned him in a web and is talking to Cueball, which explains how the keyboard mashing "White Hat" did was strange.

The reason the dog was barking appears to be because the giant spider was lurking nearby. Little did White Hat know that the dog was alerting him of the spider. When the spider notices that White Hat mentions the barking dog to Cueball, the spider apparently restrains White Hat and takes over typing. Another possibility is that the "dog" barking is actually White Hat, as he is seen making grunts from beneath the spider's silk. It can be seen in the last panel that the spider is typing with 3 legs, which explains how the 7 key would have been pressed.

The statement "I am a normal human typing with my human hands" is [http://tvtropes.org/pmwiki/pmwiki.php/Main/SuspiciouslySpecificDenial an oddly specific assertion] from the giant spider that it is actually a human, a claim that would normally be taken for granted and had not really been cast into doubt by Cueball's inquiries about how "7" got into a string of home-row keystrokes.

The title text invitation ends with a similar statement, suggesting that they "...CHAT ABOUT OUR INTERNAL SKELETONS", which spiders (unlike humans) do not posses. This implies that the spider also wants to trap and possibly eat Cueball as well, or actually hang out with him in an attempt to make friends. "...HANG OUT INSIDE MY HOUSE" may also have a double meaning, as White Hat is actually "hanging" from the ceiling inside his house. Also another oddity is that the spider asks Cueball to cook bread, although bread is actually baked, and in any case this isn't a common pastime during the night. The final oddity is that the title text is written in all caps which is usually interpreted as shouting and would not be used in a casual invitation.

The central theme of the comic is a vindication of Cueball's world-view, wherein tiny oddities such as the appearance of a numeral in a keyboard mash merit investigation. In the real world, the appearance of a "7" in the middle of a home row keyboard mash is more likely attributable to {{w|Rollover (key)#Key jamming and ghosting|key ghosting}}.

In the title text of [[1541: Voice]] there is again a reference to a sentence that could be uttered correctly by a human, but would never be used in real life. But a non-human entity that tries to blend in as a human, may inadvertently use such a "wrong" sentence to try to ensure other people think they are indeed humans. It is a direct reference to the type of sentence used in the title text here.

==Transcript==
:[Cueball approaches his desktop computer, which has emitted a message seemingly from White Hat as it displays a picture of him.]
:New chat message

:[Below the chat log is shown with White Hat's comments on the left in gray frames and Cueball's comments to the right in white frames. The first post in a row from each person is labeled with their picture at the end of a small arrow in the frame]:
:White Hat: Can't sleep. Stupid dog keeps barking.
:White Hat: So frustrating. FJAFJKLDSKF7JKFDJ
:Cueball: Ugh, I'm sorry. Maybe you could...
:Cueball: ... Okay, wait. I have to ask.
:Cueball: How did you hit a "7" in the middle there?
:White Hat: Huh?
:White Hat: I was just randomly keyboard mashing.
:Cueball: Sorry, Right.
:White Hat: Anyway,
:Cueball: I know this is silly, but like... All your hands were clearly right on the home row.
:Cueball: I don't get how one finger could have stretched up to the "7".
:White Hat: Why do you always fixate on these bizarre details?
:Cueball: I don't know.
:Cueball: Sorry.
:White Hat: It's weird, is all.

:[Chat transcript continues above White Hat's laptop, as it started in the first panel over Cueball's computer. But now we see a human-sized spider suspended from the ceiling by web is using three of its legs to type on the laptop. Behind the spider, White Hat is suspended from the ceiling upside down, almost totally encased in spider web. He tries to speak. Between them, a chair has been knocked over onto its back.]
:Spider (as White Hat in the chat): I am a normal human typing with my human hands.
:Cueball (chat): Yeah, of course. I know.
:White Hat (speaking): '''Mmm!! Mmph!!!'''

{{comic discussion}}
[[Category:Comics featuring White Hat]]
[[Category:Comics featuring Cueball]]
[[Category:Spiders]]
[[Category:Artificial Intelligence]]

581: The Race: Part 5

2014-09-06T19:28:48Z

PeterMortensen: /* Explanation */ Spelling, grammar, etc.

{{comic
| number = 581
| date = May 8, 2009
| title = The Race: Part 5
| image = the_race_part_5.png
| titletext = It was actually canceled because they just noticed he's been naked under that coat the whole time. There's a petition on Facebook to get Fox to un-cancel it, and one on Livejournal to get him to take off the coat.
}}

==Explanation==
This is a continuation of the previous comic in "[[The Race]]" series, [[580: The Race: Part 4]].

In panel 6 (2nd panel in the 2nd row), {{w|Nathan Fillion}} line is reminiscent of a similar quote from the 2nd episode of {{w|Firefly (TV series)|Firefly}}, {{w|The Train Job}}: "I just wanted you to face me so she could get behind ya." In the show, {{w|Malcolm Reynolds}} is aided by {{w|Zoë Washburne}}, his second in command, who gets behind the bar thug he is speaking to. In the comic, Nathan Fillion is using the line on a fan, but {{w|Gina Torres}} is not standing behind [[Cueball]] this time.

Summer's line about growing but not retracting her hair appears to mean that because Nathan used her to stop Cueball, she has to stop him as well, which she neatly does. Alternatively, the line may be a random non-sequitur of the sort often uttered by her neurologically damaged character in the Firefly 'verse.

"Bwah!" is a sound Malcolm makes during one episode in which one of his crewmembers inadvertently sneaks up on him while trying to ask him a question. When he is questioned about it, he says he has invented a new war cry, and promptly practices yelling 'Bwahhhh' in a confident manner while readying his pistol.

Summer's statement in the 10th panel about swallowing a bug is a reference to the movie {{w|Serenity_(film)|Serenity}}, made in 2005 to conclude Firefly's storyline. After a harrowing high-speed chase in an open-topped hovercraft, the only comment from Summer's character is "I swallowed a bug," showing that she was either unconcerned, or stunned, by the narrow escape.

The final panel is a reference to {{w|Fox TelevisionTV}}'s treatment of Firefly. Firefly was cancelled after only 11 episodes of the 14 made were aired, leaving three episodes unaired.

Internet petitions, contrary to the sarcastic suggestion in the final panel, pretty much never work.

All comics in "[[The Race]]" series:
*[[577: The Race: Part 1]]
*[[578: The Race: Part 2]]
*[[579: The Race: Part 3]]
*[[580: The Race: Part 4]]
*581: The Race: Part 5 (this one)

This series was released on five consecutive days (Monday-Friday) and not over the usual Monday/Wednesday/Friday schedule.

Electric skateboards have been the subject of several other comics like [[139: I Have Owned Two Electric Skateboards]], [[409: Electric Skateboard (Double Comic)]] and a panel in [[442: xkcd Loves the Discovery Channel]].

==Transcript==
:[Nathan skates in.]
:Nathan: So you took care of him?
:Summer: I can extrude hair, but I can't retract it.
:Nathan: That a yes?
:[Summer grabs Nathan's arm as he skates past her, pulling him off the board.]
:Nathan: Bwah!
:[An Andy Capp-esque meleè dust cloud.]
:WHAP BAM POW WHAM
:[Summer skates away.]
:[A beat-up Nathan approaches an similarly battered Cueball.]
:Nathan: She may have my board, but I can still beat you to the finish line if I bring you down.
:Cueball: Bring it, Captain Tightpants.
:Nathan: I've got nothing to bring. I just said that so she could get behind you.
:[Cueball turns.]
:Cueball: Who—
:[Cueball is hit with his board.]
:''WHAM''
:[Nathan stands over a prone Cueball.]
:Nathan: I just said ''that'' so ''I'' could get behind you. The serious fans always fall for the quotes.
:[Wide panel of Summer crossing the finishing line on Nathan's board, breaking through the tape.]
:Announcer: And the winner is...
:Off-screen voice: Summer Glau?
:Summer: I swallowed a bug again.
:[Close-up of Cueball's beaten face.]
:Cueball: All right, Fillion. I've had enough of your treachery and ...rugged good looks. This ends here.
:[Equally close-up: Nathan's face, bearing several grazes.]
:Nathan: All right, fanboy. Let this be our final battle.
:[They rush at each other, fists ready to swing punches.]
:Final battle canceled by Fox.
:Try an Internet petition drive - those ''totally'' work.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Nathan Fillion]]
[[Category:Comics featuring Summer Glau]]
[[Category:Firefly]]
[[Category:The Race]]
[[Category:Electric skateboard]]

580: The Race: Part 4

2014-09-06T19:26:24Z

PeterMortensen: /* Explanation */ Spelling, grammar, etc.

{{comic
| number = 580
| date = May 7, 2009
| title = The Race: Part 4
| image = the_race_part_4.png
| titletext = Things are rarely just crazy enough to work, but they're frequently just crazy enough to fail hilariously.
}}

==Explanation==
{{w|Firefly (TV series)|Firefly}} was a television series aired by Fox in 2002 but canceled after only fourteen episodes had been produced. Over ten years later, it still has a devoted fan base, apparently including [[Randall]]. The main characters were the crew of the spaceship "Serenity", including Captain Malcolm "Mal" Reynolds ({{w|Nathan Fillion}}), mechanical genius Kaylee ({{w|Jewel Staite}}), the apparently insane psychic River Tam ({{w|Summer Glau}}), and five others not mentioned in this comic.

Nathan Fillion appeared naked at the beginning and end of the show's eleventh episode, "Trash", after having been stripped of all his weapons, equipment, and clothes in a desert. [[Cueball]] is mentally overloaded by this image (either aroused or repulsed it is hard to say) to the extent that he misses the start signal.

Worried about his pursuer, Nathan wants to perform a {{w|Crazy Ivan}}, an emergency maneuver used by the crew of the Serenity in the pilot episode of the series to escape the hot pursuit of a Reaver ship. It involves a 180° spin turn followed by rapid acceleration towards (and hopefully past) the pursuer, which does not have the ability to make such a rapid turn. In a Firefly-class vessel, it is performed by temporarily reversing the direction of thrust of one of the two atmospheric engines, achieved by physically rotating the engine nacelle.

The name of the maneuver is taken from the antics of Russian submarines in trying to detect (not to evade) enemy submarines hiding in the sonar blind-spot directly behind their vessel. In reality, sharp turns suffice for this purpose; it is not necessary to completely reverse direction. The name entered popular culture after being used in the movie {{w|The Hunt for Red October (film)|The Hunt For Red October}}.

Nathan appears to understand exactly what will happen. He asks Jewel to "override the remote {{w|differential (mechanical device)|differential}}", implying that the two driven wheels could then be powered in opposite directions, causing a spin-turn. As Jewel points out, this will be unlikely to have the intended effect. Nathan is much heavier than his vehicle, and he is not securely attached to it. Momentum is his enemy. Even if it were successful, it would be utterly pointless, because he would find himself heading away from the finish line. Cueball is only pursuing him with the intent to overtake him, and the Crazy Ivan guarantees that this will happen.

Summer Glau is often a target of sexual attraction for her appearance and her well-known, eccentric characters. River Tam, in the movie {{w|Serenity (Film)|Serenity}}, had subconscious programming that caused her to be able to take on dozens of foes in hand-to-hand combat, and her Terminator character in the Sarah Connor Chronicles also regularly beat on men far larger than her, which, for many, just adds to the attraction. Thus, even as Summer fells him with a devastating kick to the face, Cueball is incredibly aroused.

All comics in "[[The Race]]" series:
*[[577: The Race: Part 1]]
*[[578: The Race: Part 2]]
*[[579: The Race: Part 3]]
*580: The Race: Part 4 (this one)
*[[581: The Race: Part 5]]

This series was released on five consecutive days (Monday-Friday) and not over the usual Monday/Wednesday/Friday schedule.

Electric skateboards have been the subject of several other comics like [[139: I Have Owned Two Electric Skateboards]], [[409: Electric Skateboard (Double Comic)]] and a panel in [[442: xkcd Loves the Discovery Channel]].

==Transcript==
:[Cueball and Nathan Fillion are ready on the start line on their electric skateboards.]
:Voice off panel: On your mark...

:Voice: Get set...
:Nathan: Remember episode 11, when I got all naked in that desert?

:Voice: Go!
:[Nathan speeds away leaving Cueball standing at the start line.]

:Voice: ...I said "Go."
:Voice: Someone throw some water on him.
:Cueball: Can't...get it...out of my head...

:[Nathan on walkie talkie, speeding on his skateboard.]
:Nathan: He's right behind me. Kaylee, I'm gonna try a Crazy Ivan.
:Jewel [on walkie talkie] ([[579]] shows Nathan's naming confusion): That doesn't make any sense, Nathan.
:Nathan: Trust me.

:Jewel: No, I mean it's not a skateboard maneuver. The concept doesn't even apply to this situation.
:Nathan [via walkie talkie]: That's why it ''just might work!''
:Jewel: No, that's the ''opposite'' of true!

:Nathan: On my mark, override the remote differential and throw her into a spin.
:Jewel [via walkie talkie]: okay, but—
:Nathan: Mark!
:''WHAM''

:[Nathan lying injured on the ground next to his skateboard, Cueball cruises past.]
:''Whirrrrrrrr''

:[Nathan, trying to stand up.]
:Nathan: I'm down. Tell Summer "The chickens are in the hayloft. Plan Gamma is a go."

:[Nathan, one foot on skateboard, looking at walkie talkie.]
:''mumbling from walkie talkie''
:Jewel: She says, "Plan gamma acknowledged. The meerkats are in the bag.
:[Summer Glau is walking off panel.]

:Jewel [to walkee talkie]: So we're good?
:Nathan: Hard to tell with her. Do you see an actual bag of meerkats?
:Jewel: No.
:Nathan: Then we're probably good.

:[Cueball screeching to a halt as he sees Summer Glau.]
:Cueball: Oh! Hi, Miss Glau! I'd love to talk, but Nathan's back on his feet and catching up.

:[Summer grabs Cueball's arm.]
:''Grab''
:Cueball: Wha—

:[Summer kicks Cueball in the face whilst pulling his arm towards her, he flies off his skateboard.]

:[Summer walking away as Cueball lies crippled on the floor with his sunglasses beside him.]

:[Cueball still lying on the floor.]

:Cueball [thinking]: I've never been so turned on in my life.

==Trivia==
*The xkcd's own transcript for this episode is radically wrong, and words like {{Wiktionary|maneuver}} are spelled incorrectly.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Jewel Staite]]
[[Category:Comics featuring Nathan Fillion]]
[[Category:Comics featuring Summer Glau]]
[[Category:The Race]]
[[Category:Firefly]]
[[Category:Electric skateboard]]

579: The Race: Part 3

2014-09-06T19:23:42Z

PeterMortensen: /* Explanation */ Spelling, grammar, etc.

{{comic
| number = 579
| date = May 6, 2009
| title = The Race: Part 3
| image = the_race_part_3.png
| titletext = No, the best things about The Sarah Connor Chronicles were: (1) watching Sarah and Cameron try to pass for normal, and (2) Cameron throwing people and things through walls. Everything else was pretty secondary.
}}

==Explanation==
{{w|Firefly (TV series)|Firefly}} was a television series aired by Fox in 2002 that got cancelled mid-way through, but it has a large fan base nowadays (for a more comprehensive explanation, see the Wikipedia page). The star of the show was Captain Malcolm (or Mal) Reynolds, played by {{w|Nathan Fillion}}. Other members of his crew were Kaylee (played by {{w|Jewel Staite}}), the ship's mechanic, Inara Serra (played by {{w|Morena Baccarin}}) was a Companion (or, as Mal would say: whore) that helped ''Serenity'' (the spaceship) gain a landing on many planets that otherwise would have nothing to do with Mal. River Tam (played by {{w|Summer Glau}}) was the seemingly crazy younger sister of Dr. Simon Tam (played by {{w|Sean Maher}}), and due to her latent psionic powers and the damage from the experiments she had undergone, she was known for making odd, out-of-context statements.

When [[Cueball]] is introduced to the first two women, he learns that they behave in real life as on the Firefly show (Summer is strange and Jewel is a mechanical wiz) - this is why he begins to ask about Morena Baccarin, and also why the other two says '''no.''' before he can finish the question ''is she really a '''whore'''?''

In the last panel, Kaylee apparently wired up Mal's controller to broadcast on the frequency of Cueball's skateboard, so it took control of his board, where Mal's stood still. (Buy a few RC models ({{w|Radio-controlled model}}) to play with friends and inevitably this will happen. Where two controllers broadcast on the same frequency, so the two models are confused by the signals they receive.)

{{w|Terminator: The Sarah Connor Chronicles}} was a television series aired by Fox from 2008-09. Summer Glau played the role of Cameron, a Terminator; Cameron was played in a distinctly "strange" manner as a humanoid robot who finds much about humanity puzzling. Combined with her role as River Tam, the joke is that it wasn't Summer's characters who were eccentric, but that Summer Glau ''herself'' is actually just as strange and eccentric as she is shown to be on screen.

All comics in "[[The Race]]" series:
*[[577: The Race: Part 1]]
*[[578: The Race: Part 2]]
*579: The Race: Part 3 (this one)
*[[580: The Race: Part 4]]
*[[581: The Race: Part 5]]

This series was released on five consecutive days(Monday-Friday) and not over the usual Monday/Wednesday/Friday schedule.

Electric skateboards have been the subject of several other comics like [[139: I Have Owned Two Electric Skateboards]], [[409: Electric Skateboard (Double Comic)]] and a panel in [[442: xkcd Loves the Discovery Channel]].

==Transcript==
:[Nathan, Cueball, and Summer Glau standing around with electric skateboards.]
:Nathan: Meet a few of my friends. This is-
:Cueball: Summer Glau! You were the best part of ''Chronicles''.

:Summer: I eat my bodyweight in food every 31 days. That's slightly faster than the human average.

:[Summer stares off into space.]

:Nathan: Yeah, there's a reason she only plays strange roles.
:Cueball: Ah.
:Summer (from below): I'm part of the floor now.

:[They find Jewel Staite working on a skateboard's engine.]
:Nathan: And this is Kaylee.
:Jewel: My name is Jewel, Nathan.

:Nathan: Kaylee—
:Jewel: ''Jewel''.
:Nathan: —Jewel is fixin' up my new board.
:Jewel: Almost done!

:Cueball: So wait. Summer's actually weird, Jewel's actually a mechanical whiz...

:Cueball: ...will Morena Baccarin be here? Is she really a—
:Nathan and Jewel: No.

:The racers set up
:[Nathan and Jewel are to the far left of a full-width panel. Nathan is standing on his skateboard holding a controller. Cueball is on his skateboard which is careening out of control on the far right of the panel.]
:Nathan: Kaylee, I've been gunnin' the radio hand throttle thingy for a while, but it ain't movin'.
:Jewel: Oh, I must've set it to the wrong frequency!
:Cueball (riding around on haywire board): ''AAAAAAAA''

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Jewel Staite]]
[[Category:Comics featuring Nathan Fillion]]
[[Category:Comics featuring Summer Glau]]
[[Category:The Race]]
[[Category:Firefly]]
[[Category:Electric skateboard]]

578: The Race: Part 2

2014-09-06T19:21:05Z

PeterMortensen: /* Explanation */ Spelling, grammar, etc.

{{comic
| number = 578
| date = May 5, 2009
| title = The Race: Part 2
| image = the_race_part_2.png
| titletext = The Hammer + Captain Tightpants == Captain Hammerpants?
}}

==Explanation==
{{w|Firefly (TV series)|Firefly}} was a television series aired by Fox in 2002 that got cancelled mid-way through, but it has a large fan base nowadays (for a more comprehensive explanation, see the Wikipedia page). The star of the show was Captain Malcolm (or Mal) Reynolds, played by {{w|Nathan Fillion}}.

Megan tries to play the rational card, and insist that the characters of major TV shows must get tired of fans' never-ending need to see them playing that character, and never being themselves. Nathan Fillion, however, appears to miss the days of Firefly so much that he spends his time reenacting his role as Malcolm at home.

In the fourth panel Cueball suggests they race for charities, which would mean the winner gets to donate the prize money to their charity of choice. In the fifth panel Fillion, takes the phrase and twists it to mean that the winner gets the charity. This is why Cueball says the confused line "Come again?"

The title text refers both to Mal being referred to by Kaylee as "Captain Tightpants" in the episode "Shindig," and to Captain Hammer, a superhero played by Nathan Fillion in another series created by Joss Whedon: Dr. Horrible's Sing-Along Blog. "Hammerpants" may also be a stealth callback to the odd, puffy parachute pants worn by 1990s rapper MC Hammer, another thing Randall likes to occasionally reference.

All comics in "[[The Race]]" series:
*[[577: The Race: Part 1]]
*578: The Race: Part 2 (this one)
*[[579: The Race: Part 3]]
*[[580: The Race: Part 4]]
*[[581: The Race: Part 5]]

This series was released on five consecutive days(Monday-Friday) and not over the usual Monday/Wednesday/Friday schedule.

Electric skateboards have been the subject of several other comics like [[139: I Have Owned Two Electric Skateboards]], [[409: Electric Skateboard (Double Comic)]] and a panel in [[442: xkcd Loves the Discovery Channel]].

==Transcript==
:[Cueball with skateboard and gear and Megan are talking.]
:Cueball: "Why race him?" He's ''Captain Reynolds!''
:Megan: Mr. Fillion is an actor. Firefly was years ago.

:[They go over to a computer; Cueball is using a phone and presumably looking up a phone number.]
:Megan: He has his own life to live, and I'm sure the last thing he wants to do is indulge a fan by playing Mal for him.

:Meanwhile...
:[Nathan Fillion is standing in front of a mirror in a trenchcoat.]
:Nathan: (into the mirror) Name's Captain Reynolds, ma'am. *ahem* Name's Captain Reynolds, ma'am.
:Someone offpanel: Nathan? Telephone!
:Nathan: That's ''Captain!''
:Someone offpanel: Fine, Captain Nathan.
:Nathan: No, use my '''space''' name!
:Someone offpanel: *sigh*

:[Nathan and Cueball talk on the phone.]
:Cueball: So, how about we race for charities?

:Nathan: Sure. Always did want a charity of my own.

:Cueball (between panels): Come again?

:Nathan: You know, boxes in supermarkets collecting food. 'Course, ought to tack up a list sayin' which wines I like best...

:Cueball: Uh, that's not quite—
:Nathan (over the phone): Listen, I'm the captain here.
:Cueball: ...I just got goosebumps when you said that.

:Nathan: Yeah, happens to me too whenever I get captainy. I cut such a strapping figure.
:Nathan: Buckle! Swash!
:Nathan: All right, let's do this race.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Nathan Fillion]]
[[Category:The Race]]
[[Category:Firefly]]
[[Category:Electric skateboard]]

577: The Race: Part 1

2014-09-06T19:18:50Z

PeterMortensen: /* Explanation */ Spelling, grammar, etc.

{{comic
| number = 577
| date = May 4, 2009
| title = The Race: Part 1
| image = the_race_part_1.png
| titletext = Great, and you JUST finished paying off the settlement over the Wayne Coyne hamster ball incident.
}}

== Explanation ==
This is sort of a continuation of [[139: I Have Owned Two Electric Skateboards]].

{{w|Firefly (TV series)|Firefly}} was a television series aired by Fox in 2002 that got cancelled mid-way through, but it has a large fan base nowadays (for a more comprehensive explanation, see the Wikipedia page). The star of the show was Captain Malcolm (or Mal) Reynolds, played by {{w|Nathan Fillion}}.

So in this comic, [[Megan]] tells [[Cueball]] that Nathan Fillion has an electric skateboard. [[Cueball]] immediately starts planning a trip to visit and race Nathan Fillion.

The title text refers to an earlier comic ([[211: Hamster Ball Heist]]), where [[Cueball]] kidnaps Wayne Coyne in his hamster ball.

All comics in "[[The Race]]" series:
*577: The Race: Part 1 (this one)
*[[578: The Race: Part 2]]
*[[579: The Race: Part 3]]
*[[580: The Race: Part 4]]
*[[581: The Race: Part 5]]

This series was released on five consecutive days (Monday-Friday) and not over the usual Monday/Wednesday/Friday schedule.

Electric skateboards have been the subject of several other comics like [[139: I Have Owned Two Electric Skateboards]], [[409: Electric Skateboard (Double Comic)]] and a panel in [[442: xkcd Loves the Discovery Channel]].

==Transcript==
:Megan: Huh, cool. Nathan Fillion (Mal from Firefly) has an electric skateboard. Just like you!

:[Cueball leaves the room.]

:Megan: Did you hear that? Nathan-
:''Ratchet Zip Buckle''

:[Cueball returns wearing helmet, knee pads, elbow pads, sunglasses and holding his electric skateboard.]
:Cueball: I heard. Gimme the computer. I need to book a flight.

:To be continued...
{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Nathan Fillion]]
[[Category:Firefly]]
[[Category:The Race]]
[[Category:Electric skateboard]]
[[Category:Hamster Ball]]

435: Purity

2014-05-27T19:10:08Z

PeterMortensen: /* Transcript */ Spelling/case as in the first part of this article.

{{comic
| number = 435
| date = June 11, 2008
| title = Purity
| image = purity.png
| titletext = On the other hand, physicists like to say physics is to math as sex is to masturbation.
}}

==Explanation==
{{w|Mathematics}} is the abstract study of topics encompassing quantity, structure, space, change, and others. {{w|Physics}} is a natural science that involves the study of matter and its motion through space and time, along with related concepts such as energy and force. They do this using mathematics. {{w|Chemistry}} is the science of matter, especially its chemical reactions, but also its composition, structure and properties. That is, they study a subset of physics, using a subset of physics. Biology is the subset of chemistry that is concerned with the study of life and living organisms, including their structure, function, growth, origin, evolution, distribution, and taxonomy. {{w|Psychology}} is the study of mental functions and behaviors, why living things do what they do individually, which makes it a subset of Biology. {{w|Sociology}} is the study of society, or, the study of groups of people and their interactions, which sounds an awful lot like taking the skills of psychology and applying them.

Taking this logic to the extreme, one can say that a field is 'more pure', and thus matters more, than the fields derived from it. This is a topic often used in jokes between scientists of various fields as to who is more important. The physicist, of which everyone else's work is based upon, feels that he is at the top... but is ultimately upstaged by the mathematician, whose field is so pure that ultimately everything else could be seen as derived from it. After all, physics could not exist without math, thus ultimately everything can be expressed as a mathematical equation. Thus, the mathematician snobbishly says that she didn't even see any of the other fields standing so far over to the left on the graph.

The title text points out math is all just in your head, only for your own pleasure. Physics involves interactions with other objects. This leads to a comparison between sex (physics) and masturbation (mathematics), implying that physics is the real joy in the world.

==Transcript==
:Fields arranged by purity
:[An arrow is shown pointing right with the text 'more pure'. Six people are shown representing six scientific fields. They stand on a scale of purity with the left end representing less purity and the right representing more purity. They appear in this order, from left to right: Sociology, psychology, biology, chemistry, physics, and mathematics. The mathematician stands much further to the right than any other field.]
:Psychologist: Sociology is just applied psychology.
:Biologist: Psychology is just applied biology.
:Chemist: Biology is just applied chemistry
:Physicist: Which is just applied physics. It's nice to be on top.
:Mathematician: Oh, hey, I didn't see you guys all the way over there.

{{comic discussion}}
[[Category:Charts]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Ponytail]]
[[Category:Psychology]]
[[Category:Biology]]
[[Category:Chemistry]]
[[Category:Physics]]
[[Category:Math]]
[[Category:Sex]]

435: Purity

2014-05-27T19:06:39Z

PeterMortensen: /* Explanation */ Spelling/case.

{{comic
| number = 435
| date = June 11, 2008
| title = Purity
| image = purity.png
| titletext = On the other hand, physicists like to say physics is to math as sex is to masturbation.
}}

==Explanation==
{{w|Mathematics}} is the abstract study of topics encompassing quantity, structure, space, change, and others. {{w|Physics}} is a natural science that involves the study of matter and its motion through space and time, along with related concepts such as energy and force. They do this using mathematics. {{w|Chemistry}} is the science of matter, especially its chemical reactions, but also its composition, structure and properties. That is, they study a subset of physics, using a subset of physics. Biology is the subset of chemistry that is concerned with the study of life and living organisms, including their structure, function, growth, origin, evolution, distribution, and taxonomy. {{w|Psychology}} is the study of mental functions and behaviors, why living things do what they do individually, which makes it a subset of Biology. {{w|Sociology}} is the study of society, or, the study of groups of people and their interactions, which sounds an awful lot like taking the skills of psychology and applying them.

Taking this logic to the extreme, one can say that a field is 'more pure', and thus matters more, than the fields derived from it. This is a topic often used in jokes between scientists of various fields as to who is more important. The physicist, of which everyone else's work is based upon, feels that he is at the top... but is ultimately upstaged by the mathematician, whose field is so pure that ultimately everything else could be seen as derived from it. After all, physics could not exist without math, thus ultimately everything can be expressed as a mathematical equation. Thus, the mathematician snobbishly says that she didn't even see any of the other fields standing so far over to the left on the graph.

The title text points out math is all just in your head, only for your own pleasure. Physics involves interactions with other objects. This leads to a comparison between sex (physics) and masturbation (mathematics), implying that physics is the real joy in the world.

==Transcript==
:Fields arranged by purity
:[An arrow is shown pointing right with the text 'more pure'. Six people are shown representing six scientific fields. They stand on a scale of purity with the left end representing less purity and the right representing more purity. They appear in this order, from left to right: Sociology, Psychology, Biology, Chemistry, Physics, Mathematics. The mathematician stands much further to the right than any other field.]
:Psychologist: Sociology is just applied Psychology.
:Biologist: Psychology is just applied Biology.
:Chemist: Biology is just applied Chemistry
:Physicist: Which is just applied Physics. It's nice to be on top.
:Mathematician: Oh, hey, I didn't see you guys all the way over there.

{{comic discussion}}
[[Category:Charts]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Ponytail]]
[[Category:Psychology]]
[[Category:Biology]]
[[Category:Chemistry]]
[[Category:Physics]]
[[Category:Math]]
[[Category:Sex]]

1354: Heartbleed Explanation

2014-04-16T17:11:58Z

PeterMortensen: /* Explanation */ Grammar.

{{comic
| number = 1354
| date = April 11, 2014
| title = Heartbleed Explanation
| image = heartbleed_explanation.png
| titletext = Are you still there, server? It's me, Margaret.
}}

==Explanation==
The {{w|Heartbleed bug}} has received a lot of news coverage recently and was also the topic of the previous comic [[1353: Heartbleed]]. This comic explains how the bug may have been discovered and can be exploited to reveal a server's memory contents. A hypothetical cracker [[Megan|Meg]] sends heartbeat requests to the server, the server responds to the heartbeat request by returning the contents of the body of the request up to the number of letters requested. The first two requests are well formed, requesting exactly the number of characters in the request body. The server's memory is showing Meg's request with many other requests going on at the same time.

The last request asks for "HAT" but requests that it be 500 letters long; the server — not checking if or simply unaware that 500 letters is larger than the request body — returns "HAT" plus 497 letters that happened to be next to the word "HAT" in its memory. Included are many sensitive bits of information, including a master key and user passwords. One of the passwords shown is "CoHoBaSt", a reference to [[936: Password Strength]], which suggests using "correct horse battery staple" as a password.

Often popular explanations of security bugs require the issue to be simplified a lot and to leave out a lot of details. In this case Randall didn't have to do much simplifying; the bug is actually that simple. Also, it should be noted that any client which can connect to the server typically can exploit this bug in the underlying OpenSSL software — the use of the term "User Meg" does not imply that Meg had to authenticate first.

The title text is a reference to ''{{w|Are You There God? It's Me, Margaret.|Are you there God? It's me, Margaret.}}'', a novel by Judy Blume, and plays off of the "server, are you still there?" line in every panel where she did start a request. ''Meg'' can be a nickname for ''Margaret'' as well as ''Megan'', which perhaps explains why the character's usual name, Megan, is abbreviated here.

==Transcript==

:How the Heartbleed bug works:

:Megan: Server, are you still there? If so, reply "POTATO" (6 letters).
:The server's memory is shown: ...<tt>wans pages about "boats". User Erica requests secure connection using key "4538538374224". '''User Meg wants these 6 letters: POTATO.''' User Ada wants pages about "irl games". Unlocking secure records with key 5130985733435. Maggie (chrome user) sends this message: "Hi</tt>...

:Server shows the same memory content but POTATO is highlighted.
:Server: <tt>POTATO</tt>

:Megan: Server, are you still there? If so, reply "BIRD" (4 letters).
:The server's memory is shown: ...<tt>User Olivia from London wants pages about "man bees in car why". Note: Files for IP 375.381.283.17 are in /tmp/files-3843. '''User Meg wants these 4 letters: BIRD.''' There are currently 348 connections open. User Brendan uploaded the file selfie.jpg (contents: 834ba962e2ceb9ff89bd3bff8c</tt>...

:Server shows the same memory content but now with BIRD highlighted.
:Server: <tt>BIRD</tt>
:Megan: ''Hmm...''

:Megan: Server, are you still there? If so, reply "HAT" (500 letters).
:Server memory: ...<tt>a connection. Jake requested pictures of deer. '''User Meg wants these 500 letters: HAT.''' Lucas requests the "missed connections" page. Eve (administrator) wants to set server's master key to "14835038534". Isabel wants pages about "snakes but not too long". User Karen wants to change account password to "CoHoBaSt". User</tt>...

:Server shows the same memory content, highlighting the first 500 letters of the memory beginning at HAT.
:Server: <tt>HAT. Lucas requests the "missed connections" page. Eve (administrator) wants to set server's key to "14835038534". Isabel wants pages about "snakes but not too long". User Karen wants to change account password to "CoHoBaSt". User Amber requests pages</tt>...
:Megan writes this all down.

{{comic discussion}}
[[Category:Comics with color]]
[[Category:Comics featuring Megan]]
[[Category:Computers]]

1344: Digits

2014-03-20T19:14:54Z

PeterMortensen: /* Explanation */ Grammar/spelling.

{{comic
| number = 1344
| date = March 19, 2014
| title = Digits
| image = digits.png
| titletext = It's taken me 20 years to get over skyline tetris.
}}

==Explanation==
[http://gabrielecirulli.github.io/2048/ 2048] is a popular browser-based game in which players must move tiles in a 4 by 4 grid with numbers on them. When two tiles of the same number touch they can be merged into one tile with a value of the two tiles combined. So when two 4-tiles touch and are merged they form one 8-tile. The player can move the tiles by pressing an arrow key (or swiping in a direction on the mobile version), which will move all the tiles in that direction. Every time the player makes such a move another tile will appear on a random cell. The goal of the game is to get a tile with the number 2048.

In the comic the room number can be seen as 4 tiles with the values 8, 2, 2 and 4. If these occur in the game the player can merge the two 2-tiles into one 4-tile. This will then cause two 4-tiles to lie next to each other, so these can be merged into one 8-tile. Finally, the two 8-tiles can be merged into one 16-tile.

The title text refers to {{w|Tetris effect}}, which takes its name from the game {{w|Tetris}}. People who play Tetris for extended periods tend to imagine real-life objects (like skylines) as tetris landscapes and pieces. Randall, as many others,[http://s3-external-1.amazonaws.com/wootdesigncontestentries/fackoph/chicago_skyline_%28Tetris_Redux%29-q71p5a-s.jpg] apparently got hooked on Tetris so much when it came out that, for 20 years, he would look at city skylines and see Tetris-like patterns in it. Similarly, he has now been hooked onto 2048 and notices number patterns that would be desirable to obtain during the game.

Comics [[724: Hell]] and [[888: Heaven]] also refer to Tetris.

==Transcript==
:[A guy is walking and Cueball is following him.]
:Guy: The talk is in room 8224.
:Cueball: Ooh, nice.
:Guy: What?
:Cueball: ...Sorry. Nothing.

:Great, now I'll spend the rest of my life noticing numbers that would make good 2048 combos.

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Video games]]
[[Category:Math]]

303: Compiling

2013-10-05T09:15:35Z

PeterMortensen: /* Explanation */ Copy edited.

{{comic
| number = 303
| date = August 15, 2007
| title = Compiling
| image = compiling.png
| titletext = 'Are you stealing those LCDs?' 'Yeah, but I'm doing it while my code compiles.'
}}

==Explanation==
Simply writing the source code is not sufficient. You have to {{w|Compiler|compile}} this, turning it into {{w|executable}} files. At large projects, this will take a long time. Depending on the power of the computer it could be more than one hour. As of 2013, the {{w|Linux Kernel}} contains over 15 million lines of code, a hard job for the compiler.

In general, programming languages are implemented in two ways: interpreters and compilers. Interpreters convert the code at the time when it is currently running ({{w|PHP}} is only one example), but compilers convert the source code all at once into executable files. After compiling, the resulting code will run much faster than interpreted code, since it has already all been translated into the proper binary language. But compiling code can be a long task, including to fix some {{w|syntax error|syntax errors}}. Cueball does not care about this so far, because he is only waiting for a slow machine to finish its job.

In the title text, Cueball admits that he did steal LCD displays, but only because he had to wait for the compiler.

==Transcript==
:The #1 Programmer Excuse for Legitimately Slacking Off: “My code's compiling.”
:[Two programmers are sword-fighting on office chairs in a hallway. An unseen manager calls them back to work through an open office door.]
:Manager: Hey! Get back to work!
:Programmer: Compiling!
:Manager: Oh. Carry on.
{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Programming]]

Talk:1189: Voyager 1

2013-09-14T06:15:19Z

PeterMortensen: /* 2013-09-12 event */ Corrected the link to Sedna.

== Gantlet ==

Uh, not all tally marks are Doctor Who references. [[User:Alpha|Alpha]] ([[User talk:Alpha|talk]]) 05:49, 22 March 2013 (UTC)

: Oh, was he talking about the glove? I though it was referring to "running the gauntlet" for some reason. --[[Special:Contributions/123.243.217.72|123.243.217.72]] 07:17, 22 March 2013 (UTC)

:: No, that's "running the gantlet." Two words which are often confused for each other. Plus you could run a gantlet of people whacking you with their gauntlets. [[Special:Contributions/63.241.174.129|63.241.174.129]] 13:21, 22 March 2013 (UTC)

::: "Running the gantlet" and "running the gauntlet" are both acceptable uses, since both gantlet and gauntlet can be used for the punishment (however, "dropping the gantlet" would be incorrect, since gantlet ''only'' refers to the punishment, while gauntlet can refer to both the punishment and the glove). [[Special:Contributions/72.178.88.37|72.178.88.37]] 01:30, 23 March 2013 (UTC)

::::He almost certainly meant 'gantlet'; I think Randall just got the two words confused (it happens frequently. At this point, dictionary.com lists both spellings as synonymous.) The medieval punishment makes much more sense in context (ie: lots of things that could potentially hit Voyageur.)[[Special:Contributions/24.70.188.179|24.70.188.179]] 13:31, 22 March 2013 (UTC)

::::: Well, I saw a straight wordplay belt→glove there. --[[User:Mormegil|Mormegil]] ([[User talk:Mormegil|talk]]) 14:21, 22 March 2013 (UTC)
: Gauntlet and gantlet are both fitting and humorous in the context. Homophones are great. [[Special:Contributions/98.240.130.17|98.240.130.17]] 17:41, 22 March 2013 (UTC)

== Laziness ==

Is it just me, or is Randall getting lazy? Most of the past comics have been simplistic, easy-to-draw charts. [[Special:Contributions/98.172.117.132|98.172.117.132]] 16:15, 22 March 2013 (UTC)
: Having just come from the future, we can now surmise that he was prepping for the epic, month-long-and-running sandcastle comic that started in the strip after this one. [[User:Echo Seven|Echo Seven]] ([[User talk:Echo Seven|talk]]) 03:59, 21 April 2013 (UTC)

== NASA information ==

There were several stories two days ago saying it had left, then a correction from NASA saying it didn't.
http://science.time.com/2013/03/20/humanity-leaves-the-solar-system-35-years-later-voyager-offically-exits-the-heliosphere/
http://www.pcmag.com/article2/0,2817,2416867,00.asp
http://www.nasa.gov/mission_pages/voyager/voyager20130320.html
[[User:Bugefun|Bugefun]] ([[User talk:Bugefun|talk]]) 07:21, 22 March 2013 (UTC)

== Numbers discrepancy ==

Is it just me or is it unclear why are there sixteen leaving events described in the title text but twenty-two tally marks on the comic? [[Special:Contributions/188.221.199.135|188.221.199.135]] 07:39, 22 March 2013 (UTC)

: No, it is not just you why there are 22 tick marks, and only 16 countable exits.[[Special:Contributions/192.231.124.16|192.231.124.16]] 12:03, 22 March 2013 (UTC)

== Space interest ==

I just keep hoping that my children will be interested in space. Too late for me, NASA wouldn't want me, but surely my genes are still ok, I hope. To follow voyager down the rabbit hole of our expectations, what else can father ever ask? [[Special:Contributions/166.147.120.177|166.147.120.177]] 08:05, 22 March 2013 (UTC)

== Crystal sphere ==

The Crystal Sphere may refer to a David Brin story used to explain the fermi paradox of why we have had no alien contact: http://en.wikipedia.org/wiki/The_Crystal_Spheres [[User:Schmammel|Schmammel]] ([[User talk:Schmammel|talk]]) 14:37, 22 March 2013 (UTC)
: Crystal Sphere could also be a reference to the old Spelljammer D&D setting where systems/galaxies were contained in crystal spheres. [[Special:Contributions/146.146.7.2|146.146.7.2]]
:: Which in turn is a reference to (well, really, direct borrowing from) the Ptolemaic astronomical concept, so it still comes back to the same thing. [[Special:Contributions/129.176.151.14|129.176.151.14]] 13:30, 28 March 2013 (UTC)

== Fictive boundary ==

"US Census Bureau Solar System statistical boundary – a fictive boundary defined by": I'm capable of reading 'fictive' as 'conventional' in this sentence; as in "the real census bureau really invented it, like they really invented census areas". I would not have been confused by 'fictional', or by 'a boundary fictively invented', but I'm not sure that the second one is good English. I may have studied too much sociology. [[Special:Contributions/121.73.5.66|121.73.5.66]] 07:38, 23 March 2013 (UTC)

== Magnetogap ==

"Magnetogap" is probably wordplay on http://en.wikipedia.org/wiki/Magnetopause {{unsigned|194.176.203.76}}

== 2013-09-12 event ==

Big news today (September 12, 2013), as Voyager 1 leaves the solar system. http://www.nytimes.com/2013/09/13/science/in-a-breathtaking-first-nasa-craft-exits-the-solar-system.html and http://www.bbc.co.uk/news/science-environment-24026153 [[User:Porkypine|Porkypine]] ([[User talk:Porkypine|talk]]) 19:47, 12 September 2013 (UTC)

: I have seen this statements at NASA too, but now it's just "Voyager Embarks on Journey Into Interstellar Space" and "NASA Spacecraft Embarks on Historic Journey Into Interstellar Space". So, this is just the next marker for this comic. Randall should do an update. There is simply NO defined border, it's just an other media hype. Look at [http://nasawatch.com/archives/2013/09/voyager-1-left.html nasawatch.com] for the Randall like critical statements. Correct is: Voyager is leaving out solar system. But objects surrounding our sun, like {{w|90377 Sedna|Sedna}} are much farther outside. It's just a hype, this comic definitively needs an update by Randall.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 20:53, 12 September 2013 (UTC)

Talk:1189: Voyager 1

2013-09-14T06:14:41Z

PeterMortensen: Cleaned up: added section titles, put entries into the proper section, corrected the thread level, and added the missing signature for 98.172.117.132.

== Gantlet ==

Uh, not all tally marks are Doctor Who references. [[User:Alpha|Alpha]] ([[User talk:Alpha|talk]]) 05:49, 22 March 2013 (UTC)

: Oh, was he talking about the glove? I though it was referring to "running the gauntlet" for some reason. --[[Special:Contributions/123.243.217.72|123.243.217.72]] 07:17, 22 March 2013 (UTC)

:: No, that's "running the gantlet." Two words which are often confused for each other. Plus you could run a gantlet of people whacking you with their gauntlets. [[Special:Contributions/63.241.174.129|63.241.174.129]] 13:21, 22 March 2013 (UTC)

::: "Running the gantlet" and "running the gauntlet" are both acceptable uses, since both gantlet and gauntlet can be used for the punishment (however, "dropping the gantlet" would be incorrect, since gantlet ''only'' refers to the punishment, while gauntlet can refer to both the punishment and the glove). [[Special:Contributions/72.178.88.37|72.178.88.37]] 01:30, 23 March 2013 (UTC)

::::He almost certainly meant 'gantlet'; I think Randall just got the two words confused (it happens frequently. At this point, dictionary.com lists both spellings as synonymous.) The medieval punishment makes much more sense in context (ie: lots of things that could potentially hit Voyageur.)[[Special:Contributions/24.70.188.179|24.70.188.179]] 13:31, 22 March 2013 (UTC)

::::: Well, I saw a straight wordplay belt→glove there. --[[User:Mormegil|Mormegil]] ([[User talk:Mormegil|talk]]) 14:21, 22 March 2013 (UTC)
: Gauntlet and gantlet are both fitting and humorous in the context. Homophones are great. [[Special:Contributions/98.240.130.17|98.240.130.17]] 17:41, 22 March 2013 (UTC)

== Laziness ==

Is it just me, or is Randall getting lazy? Most of the past comics have been simplistic, easy-to-draw charts. [[Special:Contributions/98.172.117.132|98.172.117.132]] 16:15, 22 March 2013 (UTC)
: Having just come from the future, we can now surmise that he was prepping for the epic, month-long-and-running sandcastle comic that started in the strip after this one. [[User:Echo Seven|Echo Seven]] ([[User talk:Echo Seven|talk]]) 03:59, 21 April 2013 (UTC)

== NASA information ==

There were several stories two days ago saying it had left, then a correction from NASA saying it didn't.
http://science.time.com/2013/03/20/humanity-leaves-the-solar-system-35-years-later-voyager-offically-exits-the-heliosphere/
http://www.pcmag.com/article2/0,2817,2416867,00.asp
http://www.nasa.gov/mission_pages/voyager/voyager20130320.html
[[User:Bugefun|Bugefun]] ([[User talk:Bugefun|talk]]) 07:21, 22 March 2013 (UTC)

== Numbers discrepancy ==

Is it just me or is it unclear why are there sixteen leaving events described in the title text but twenty-two tally marks on the comic? [[Special:Contributions/188.221.199.135|188.221.199.135]] 07:39, 22 March 2013 (UTC)

: No, it is not just you why there are 22 tick marks, and only 16 countable exits.[[Special:Contributions/192.231.124.16|192.231.124.16]] 12:03, 22 March 2013 (UTC)

== Space interest ==

I just keep hoping that my children will be interested in space. Too late for me, NASA wouldn't want me, but surely my genes are still ok, I hope. To follow voyager down the rabbit hole of our expectations, what else can father ever ask? [[Special:Contributions/166.147.120.177|166.147.120.177]] 08:05, 22 March 2013 (UTC)

== Crystal sphere ==

The Crystal Sphere may refer to a David Brin story used to explain the fermi paradox of why we have had no alien contact: http://en.wikipedia.org/wiki/The_Crystal_Spheres [[User:Schmammel|Schmammel]] ([[User talk:Schmammel|talk]]) 14:37, 22 March 2013 (UTC)
: Crystal Sphere could also be a reference to the old Spelljammer D&D setting where systems/galaxies were contained in crystal spheres. [[Special:Contributions/146.146.7.2|146.146.7.2]]
:: Which in turn is a reference to (well, really, direct borrowing from) the Ptolemaic astronomical concept, so it still comes back to the same thing. [[Special:Contributions/129.176.151.14|129.176.151.14]] 13:30, 28 March 2013 (UTC)

== Fictive boundary ==

"US Census Bureau Solar System statistical boundary – a fictive boundary defined by": I'm capable of reading 'fictive' as 'conventional' in this sentence; as in "the real census bureau really invented it, like they really invented census areas". I would not have been confused by 'fictional', or by 'a boundary fictively invented', but I'm not sure that the second one is good English. I may have studied too much sociology. [[Special:Contributions/121.73.5.66|121.73.5.66]] 07:38, 23 March 2013 (UTC)

== Magnetogap ==

"Magnetogap" is probably wordplay on http://en.wikipedia.org/wiki/Magnetopause {{unsigned|194.176.203.76}}

== 2013-09-12 event ==

Big news today (September 12, 2013), as Voyager 1 leaves the solar system. http://www.nytimes.com/2013/09/13/science/in-a-breathtaking-first-nasa-craft-exits-the-solar-system.html and http://www.bbc.co.uk/news/science-environment-24026153 [[User:Porkypine|Porkypine]] ([[User talk:Porkypine|talk]]) 19:47, 12 September 2013 (UTC)

: I have seen this statements at NASA too, but now it's just "Voyager Embarks on Journey Into Interstellar Space" and "NASA Spacecraft Embarks on Historic Journey Into Interstellar Space". So, this is just the next marker for this comic. Randall should do an update. There is simply NO defined border, it's just an other media hype. Look at [http://nasawatch.com/archives/2013/09/voyager-1-left.html nasawatch.com] for the Randall like critical statements. Correct is: Voyager is leaving out solar system. But objects surrounding our sun, like {{w|Voyager|Sedna}} are much farther outside. It's just a hype, this comic definitively needs an update by Randall.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 20:53, 12 September 2013 (UTC)

1189: Voyager 1

2013-09-14T05:52:35Z

PeterMortensen: /* Explanation */ Spelling (ref. <http://en.wikipedia.org/wiki/Ars_Technica>).

{{comic
| number = 1189
| date = March 22, 2013
| title = Voyager 1
| image = voyager_1.png
| titletext = So far Voyager 1 has 'left the Solar System' by passing through the termination shock three times, the heliopause twice, and once each through the heliosheath, heliosphere, heliodrome, auroral discontinuity, Heaviside layer, trans-Neptunian panic zone, magnetogap, US Census Bureau Solar System statistical boundary, Kuiper gauntlet, Oort void, and crystal sphere holding the fixed stars.
}}

==Explanation==
''{{w|Voyager 1}}'' is a U.S. space probe launched in 1977 to study the outer reaches of the Solar System and beyond. Popular press has on several occasions announced that it “has left the solar system” at each point when a boundary has been confirmed or a major event has taken place. This underscores the fact that there is no strictly defined and recognizable boundary of the solar system, or at least we haven't found one yet.

The alt-text lists several such possible boundaries, together with fictive humorous ones:

*The {{w|termination shock}} – the point in the heliosphere where the solar wind slows down to subsonic speed (relative to the star) because of interactions with the local interstellar medium.
*The {{w|heliopause}} – the theoretical boundary where the Sun’s solar wind is stopped by the interstellar medium.
*The {{w|heliosphere}} – a region of space dominated by Earth’s Sun, a sort of bubble of charged particles in the space surrounding the Solar System.
*The {{w|heliosheath}} – the region of the heliosphere beyond the termination shock.
*Heliodrome – yet another composition of ''helios'' "sun," here together with ''dromos'' "course". There is no astronomical object with this name, but it has been used variously in other contexts. One that became famous is a sports hall which was used as a concentration camp in the Bosnian war, see {{w|Heliodrom camp}}.
*Auroral discontinuity - another fictitious astronomic object, for ''auroral'' see {{w|Aurora (astronomy)}}.
*{{w|Heaviside layer}} – a layer of ionized gas occurring between roughly 90–150 km (56–93 mi) above the ground in the Earth's atmosphere. Popularly recognized for its use as a reference to Heaven in the writings of {{w|T. S. Eliot}} adapted into {{w|Andrew Lloyd Webber}}'s musical ''{{w|Cats (musical)|Cats}}''.
*Trans-Neptunian panic zone – this fictional zone combines the word from two subject: “Trans–Neptunian” is used in astronomy to describe stuff that occurs beyond the planet Neptune. In {{w|Outdoor education}} the “panic zone” is the opposite of the {{w|comfort zone}} when trying to learn new stuff.
*{{w|Ignition magneto|Magnetogap}} – part of an {{w|ignition system}}.
*US Census Bureau Solar System statistical boundary – a fictive boundary defined by the {{w|United States Census Bureau}}, similarly to how it defines {{w|Census tract|census areas}} for the purpose of processing statistical data about regions in the United States.
*Kuiper gauntlet – this is a play on the {{w|Kuiper belt}}, which is a region of the Solar System beyond the planets, extending from the orbit of Neptune (at 30 AU) to approximately 50 AU from the Sun, notable for being full of asteroids; replacing the word “belt” with “{{w|gauntlet (glove)}}” (often spelled 'gantlet') which is a protective glove as well as “{{w|gauntlet (punishment)}}” which is a medieval punishment where one would be forced to run through two lines of men who would hit the punishee.
*Oort void – refers to the {{w|Oort cloud}}, a gigantic “cloud” of materials (mainly composed of ice) which ends around a light-year from The Sun and is deemed the (current) “edge” of the solar system.
*Crystal sphere holding the fixed stars – this refers to historical ideas about the universe, particularly the {{w|Ptolemaic system}}, in which the stars were supposed to be fixed on a {{w|Celestial spheres|large crystal sphere}} around the Earth. It might also be referencing "{{w|The Crystal Spheres}}", a short story by David Brin, in which humanity's first interstellar ship shatters a previously undetected, protective barrier around the solar system. It may also be a reference to the Dungeons and Dragons setting "{{w|Spelljammer}}".

See also [http://arstechnica.com/science/2013/03/voyager-probes-key-transition-remains-mysterious/ Voyager over the “heliocliff,” but Solar System transition mysterious] article on Ars Technica.

==Transcript==
:Number of times ''Voyager 1'' has left the Solar System
:[22 tally marks.]

{{comic discussion}}
[[Category:Physics]]
[[Category:Charts]]

User:PeterMortensen

2013-08-15T19:51:54Z

PeterMortensen: Added a shortcuts section, with meat.

==Profile==

Profile: see [http://en.wikipedia.org/wiki/User:Mortense my Wikipedia user page].

Credentials: more than 5000 edits on the English Wikipedia.

==Shortcuts==

* [[explain_xkcd:Community_portal/Miscellaneous#Style_guide|Style guide, does it exist?]]

224: Lisp

2013-08-10T22:13:47Z

PeterMortensen: /* Explanation */ Copy edited.

{{comic
| number = 224
| date = February 16, 2007
| title = Lisp
| image = lisp.jpg
| titletext = We lost the documentation on quantum mechanics. You'll have to decode the regexes yourself.
}}

==Explanation==
{{incomplete}}
First some definitions. {{w|Lisp (programming language)|Lisp}} is a computer programming language, first specified in 1958. {{w|Perl}} is another computer programming language, sometimes known as "the Swiss Army chainsaw of scripting languages", and well known for its complex regular expressions. A {{w|regular expression}} or regex provides a concise and flexible means to "match" (specify and recognize) strings of text. They were also referenced in [[208: Regular Expressions]].

The line "It's full of 'car's" is a reference to the book and film {{w|2001 A Space Odessey}}. In 2001, the astronaut David Bowman accidentally activates a star gate and exclaims as he enters it "My God — it's full of stars!". In Lisp, "{{w|CAR and CDR|car}}" is a fundamental command that returns the first item of a list.

[[Cueball]] marvels at the fundamental and complete nature of the language of creation that he sees in his dream, the ultimate elegant language (in Cueball's opinion), before being told by God that the universe was mostly built using Perl. Perl is usually considered to be a 'hackish' language, which aims on allowing getting things done in different ways ("There is more than one way to do it" is actually a motto of the Perl community). This often leads to huge chunks of messy Perl code that is hard to understand by other people.

At the title text [[Randall]] states that the theory of {{w|quantum mechanics}} is still hard to understand like regular expressions from Perl. Mostly because the documentation, meaning the people inventing this theory, have passed by. Today, you never can ask them about their thoughts.

==Transcript==
:[Floating in space.]
:Speaker: Last night I drifted off while reading a Lisp book.
:Cueball: Huh?
:Speaker: Suddenly, I was bathed in a suffusion of blue.

:[Floating in space before a vast concept tree.]
:Speaker: At once, just like they said, I felt a great enlightenment. I saw the naked structure of Lisp code unfold before me.
:Cueball: My God
:Cueball: It's full of 'car's
:Speaker: The patterns and metapatterns danced. Syntax faded, and I swam in the purity of quantified conception. Of ideas manifest.

:[Close-up of floating in space before part of a concept tree.]
:Truly, this was the language from which the gods wrought the Universe.

:[Floating in space with God appearing through a line of clouds.]
:God: No, it's not.
:Cueball: It's not?
:God: I mean, ostensibly, yes. Honestly, we hacked most of it together with Perl.

==Trivia==
*In his [http://www.youtube.com/watch?v=zJOS0sV2a24#t=29m11s Google-speech], [[Randall]] said that he spent 3–4 hours on getting the blue shading just right.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics with color]]
[[Category:Programming]]
[[Category:Religion]]

515: No One Must Know

2013-08-10T21:57:27Z

PeterMortensen: /* Explanation */ Grammar.

{{comic
| number = 515
| date = December 10, 2008
| title = No One Must Know
| image = no_one_must_know.png
| titletext = Or perhaps they knew he was there, and were just trying to torment him first.
}}

==Explanation==
[[Black Hat]] and [[Danish]] are more known for their sociopathy than their affection. In the first panel, they are uncharacteristically affectionate. The entrance of a [[stick figure]], and his observation of this state, leads [[Black Hat]] and [[Danish]] to kill him and bury the evidence, so that no one knows that side of them.

The title text provides the alternative hypothesis that they were planning on killing him the whole time and were intentionally acting affectionate for the mental effect it would have on their victim.

==Trivia==
This comic inspired the use of "Danish" to refer to [[Black Hat]]'s girlfriend on this wiki.

==Transcript==
:[Black hat and Danish are talking and holding hands]
:Black hat: You're my dearest darling danish.
:Danish: And you're my lovely cutie pie.
:Black hat: Well, you're --
:[Cueball enters]
:[Black hat and Danish look at each other]
:[Black hat is holding a bloody sack, while Danish is pushing down on a shovel to make a hole for the body.]

{{Comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Black Hat]]
[[Category:Comics featuring Danish]]
[[Category:Comics with color]]
[[Category:Romance]]

84: National Language

2013-08-10T21:54:13Z

PeterMortensen: /* Explanation */ Spelling/case.

{{comic
| number = 84
| date = April 3, 2006
| title = National Language
| image = national_language.jpg
| titletext = She's pretty sharp when provoked.
}}

==Explanation==
This comic is about the concept of {{w|nativism}}, which is the view that those who are native to a place should have more rights than immigrants. A frequently expressed view in the US (and in other countries) is that immigrants should learn English, which is the primary language in the United States; usually this comes in response to frustration in dealing with an immigrant who does not speak English or does not speak it well. This can sometimes be frustrating in cases where the person who does not speak or understand English well is working in a service position and you have difficulty communicating with them.

In the comic one character is arrogantly arguing the nativist position. However, the woman next to him interrupts him and says a phrase in the {{w|Cherokee}} language - "Hello, my name is Sarah" - which is an Iroquoian language used by the Cherokee Native American people. Although Cherokee seems to be a relatively {{w|Cherokee#Origins|young culture}}, it is much more native to America than any European culture. Some Indian cultures reach back millennia.

The woman is therefore effectively suggesting a "what's good for the goose is good for the gander" argument that if the Europeans did not have to learn the native language, why should current immigrants learn English? She points out that even the English speakers are immigrants who did not learn the native language. Or perhaps she is suggesting the old adage: Those who don't learn history are doomed to repeat it, and that immigrants will one day take over the US and English speakers will be displaced like the natives were.

==Transcript==
:This happened to my friend:
:[Men and women are standing in a row.]
:Cueball: English should be the national language. These immigrants should have to learn English when they come here.
:Megan: Yeah.
:Cueball: When you go to live somewhere, you learn the language they speak there. English is the language of the land.
:Ponytail: Excuse me, but osio Sarah dawado.
:Cueball: What the hell was that?
:Ponytail: Cherokee.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Ponytail]]
[[Category:Language]]

517: Marshmallow Gun

2013-08-10T21:39:09Z

PeterMortensen: /* Explanation */ Grammar.

{{comic
| number = 517
| date = December 15, 2008
| title = Marshmallow Gun
| image = marshmallow_gun.png
| imagesize =
| titletext = Except in reality crossing a stream of marshmallows would create a giant Bill Murray.
}}

==Explanation==
In this comic, [[Cueball]] decides to shoot marshmallows at Megan, who promptly silences him by using a super soaker. The next day, everyone shoots marshmallows at each other in the office, which results in a huge explosion (a reference to GhostBusters, in which crossing the ghost-capturing streams would result in a huge explosion).

The title text is a further GhostBusters reference. In the movie, the GhostBusters (one of whom is played by Bill Murray) are tasked with taking down an enormous marshmallow man. The text puts forward the idea that if you were to fire marshmallows at people, the inverse would happen and an enormous Bill Murray would appear.

The super soaker originally appeared in [[220: Philosophy]].

==Transcript==
:Narrator: I got this gun that shoots marshmallows.
:[Cueball removes a marshmallow gun from a box.]
:[Cueball shoots woman with marshmallow gun from offpanel.]
:<<POP POP POP>>
:<<WHAP WHAP WHAP>>
:<<POP>>
:[Megan sighs]
:<<POP POP>>
:[Megan removes a super soaker from desk drawer.]
:[Megan shoots offscreen man with super soaker.]
:Cueball: (offscreen) AUGH!
:<<FWOOSH>>
:Cueball: (offscreen) Man, I forgot that was there.
:Narrator: The next day, everyone else got them too.
:[Megan and Beret Guy brandish marshmallow guns.]
:Megan: Hey noob! Eat stay-puft®!
:[Megan shoots marshmallow gun.]
:<<POP POP POP>>
:[Cueball shoots marshmallow gun.]
:<<POP POP POP>>
:[Megan and Cueball shoot marshmallows into the air, crossing the streams of fire.]
:Beret Guy: (offscreen) No, don't cross the ~
:<<FOOM>>
:<<ROAAAR>>
:[Megan, Cueball, and Beret Guy are all standing with weapons pointed at the ground]
:Megan: Okay, this is bad.
:Offscreen: You're shooting what?

{{comic discussion}}
[[Category:Comics featuring Beret Guy]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics with color]]

862: Let Go

2013-08-10T21:11:41Z

PeterMortensen: /* Explanation */ Spelling/case as in the reference, etc.

{{comic
| number = 862
| date = February 18, 2011
| title = Let Go
| image = let go.png
| imagesize =
| titletext = After years of trying various methods, I broke this habit by pitting my impatience against my laziness. I decoupled the action and the neurological reward by setting up a simple 30-second delay I had to wait through, in which I couldn't do anything else, before any new page or chat client would load (and only allowed one to run at once). The urge to check all those sites magically vanished--and my 'productive' computer use was unaffected.
}}

==Explanation==
In this comic, the title text is a serious solution to a procrastination problem that we see in the comic.

The first two frames in this comic are the set-up. Both contain the websites {{w|CNN}} and {{w|Reddit}} and thoughts over the top of them. In the third frame, it starts to look a little different as the screen is not a computer but is in fact the targeting computer from {{w|Luke Skywalker|Luke Skywalker's}} {{w|X-wing}}. But, before shutting down, he considers checking {{w|Facebook}}.

In the fourth frame, we finally get the movie reference from {{w|Star Wars}} as {{w|Princess Leia}} and one of the Rebel Alliance's generals are gathered around the holographic table that allows them to follow the battle. In the movie, Luke turns off his targeting computer because he uses the ''Force'' to fire the torpedoes at the right time. But in this comic, Luke turns off the computer because he keeps getting distracted by Reddit and CNN.

The headlines on CNN read 'Bees?', 'Where is Oman' (the map which depicts the Indian Ocean is completely wrong because Oman is situated on the Persian Gulf), and iReport (we mean you, that is.).

==Transcript==
:[Reddit page]
:Luke (thinking): I shouldn't be looking at Reddit. Why can't I stop?

:[CNN page]
:Luke (thinking): Refreshing CNN again. Do news stories so affect my life that I benefit from checking them more than once a day?

:[Shutdown screen]
:Luke (thinking): I should at least check Faceb... no. Screw it. I can't do my job when I'm distracting myself every five minutes like this.

:[Two people before a battlefield screen]
:Cueball: His computer's off. Luke - You've switched off your targeting computer. What's wrong?
:Luke: Nothing. I'm all right.

{{comic discussion}}
[[Category:Comics with color]]
[[Category:Comics featuring Cueball]]

explain xkcd:Community portal/Miscellaneous

2013-08-10T20:14:16Z

PeterMortensen: /* Style guide */ new section

<noinclude>{{Community portal}}</noinclude>

== The Community Portal's design ==

{{tl|Community portal}} looks too Wikipedia-ish (because that's where I got it). Someone who can design things should probably fix that. It isn't protected for the time being, though it probably will be in the future (high-visibility template). --''[[User:Philosopher|Philosopher]]'' [[User talk:Philosopher|Let us reason together.]] 00:54, 4 August 2012 (EDT)

== Common mistake ==

This affects all pages that ever say "alt text" in reference to the TITLE text on xkcd images. "Alt text" is incorrect; Alt text refers to the text that is shown as an alternative when images are not displayed. Title text is what xkcd uses and is shown as a tool tip-like bubble when images are hovered over.

I would correct this myself but I saw no way to edit the main page. --[[User:Jillysky|Jillysky]] ([[User talk:Jillysky|talk]]) 14:21, 6 August 2012‎ (UTC)

:You actually don't need to edit the main page to fix it, as what's there is just a mirror (transclusion) of the actual content from the comic page, at [[Curiosity]], which is open for editing by anyone. Then again, the "alt-text" in that case is generated by a template, {{tl|comic}}, so that's where we should fix this. The template's code, however, is currently a terrible mess (sorry!), so I went ahead and took care of it. Thanks for catching that! --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 16:24, 6 August 2012 (UTC)

:Ah? So it's wrong, for instance, on http://m.xkcd.com? because of that I took it for granted that we could call it the alt-text... - [[User:Cos|Cos]] ([[User talk:Cos|talk]]) 17:38, 6 August 2012 (UTC)

:: Yes. If you look at the page's html source, you'll see:
<nowiki><img
id="comic"
src="http://imgs.xkcd.com/comics/curiosity.png"
title="As of this writing the NASA/JPL websites are still overloaded. Trying CURIOSITY-REAR-CAM_[256px_x_256px].torrent.SwEsUb.DVDRip.XviD-aXXo.jpg instead."
alt="Curiosity"></nowiki>
::(line breaks added for clarity) --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 23:54, 6 August 2012 (UTC)

:::That was my error in the template. I knew "image text" that has been commonly used by Jeff was not techically correct, but I didn't actually go back and confirm it was alt text before I included that tag in the template. That's to Waldir (I believe?) for correcting the template. [[User:TheHYPO|TheHYPO]] ([[User talk:TheHYPO|talk]]) 14:14, 7 August 2012 (UTC)

== When the "official" transcript is wrong? ==
I did [[903: Extended Mind]]. Interestingly, the transcript on xkcd.com is missing the bottom line "When Wikipedia has a server outage, my apparent IQ drops by 30 points." I assume we want a complete transcript, rather than whatever xkcd.com says it is...? [[User:Stevage|Stevage]] ([[User talk:Stevage|talk]]) 04:10, 17 November 2012 (UTC)

:We're focusing on the actual transcript of the comic, not the xkcd.com transcript. The official transcript is usually right, but even Randall makes mistakes sometimes. [[User:Davidy22|Davidy22]][[User talk:Davidy22|<tt>(talk)</tt>]] 04:24, 17 November 2012 (UTC)

== Milestone: half the comics explained!! ==

Hi all! I'm pleased to announce that we have just broke the 50% mark for xkcd explanations! The page that balanced the count (568 explained, 568 to go, at the time) was [[877: Beauty]], created 01:31 UTC, 21 November 2012 by [[User:Davidy22]]. Congratulations!! :D --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 03:10, 21 November 2012 (UTC)

:The caterer's been called! The punch will be arriving soon! Go [[User:Davidy22|Davidy22]]! [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 06:53, 21 November 2012 (UTC)

::[[File:freedom.png]] Punch is served! [[User:Davidy22|Davidy22]][[User talk:Davidy22|<tt>(talk)</tt>]] 07:11, 21 November 2012 (UTC)

But the Main page says 407 explanations, 731 to go! What's up with that? --[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 21:00, 23 November 2012 (UTC)

== Reverse? ==

Why in the Archive why are all the thing up until "Heatmap" in Reverse? Can someone please answer? [[User:Tmack3|Tmack3]] ([[User talk:Tmack3|talk]]) 08:28, 20 February 2013 (UTC)
:Archive? Can you provide a link or screenshot? '''[[User:Davidy22|Davidy22]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 04:43, 19 February 2013 (UTC)

http://xkcd.com/archive/ [[User:Tmack3|Tmack3]] ([[User talk:Tmack3|talk]]) 08:28, 20 February 2013 (UTC)

::Ah, that's because the comic right after that, rtl, has a right-to-left character in it that flips all the proceeding text. '''[[User:Davidy22|Davidy22]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 00:13, 20 February 2013 (UTC)

Ah, ok, i see that now. When I 1st saw that RTL I just thought that it was random letters, thankyou for explaining it for me. [[User:Tmack3|Tmack3]] ([[User talk:Tmack3|talk]]) 08:28, 20 February 2013 (UTC)

It also depends on what browser you are on because on Google Chrome it was normal. [[User:Tmack3|Tmack3]] ([[User talk:Tmack3|talk]]) 09:08, 20 February 2013 (UTC)

== Do you think this question was asked by one of the xkcd people? ==

http://answers.yahoo.com/question/index?qid=20090301060752AAtYugc [[User:Tmack3|Tmack3]] ([[User talk:Tmack3|talk]]) 08:38, 20 February 2013 (UTC)

== Matthew Reilly ==

I would just like to tell everyone that I asked Matthew Reilly (the author) if he is ever scared that a velociraptor is going to attack him, and he said NO! He clearly needs to start worrying about them! [[User:Tmack3|Tmack3]] ([[User talk:Tmack3|talk]]) 10:45, 22 February 2013 (UTC)

== What can we learn section ==
First of all I love your work. I believe deeper understanding of each XKCD can make a world a better place and I thank you sincerely for starting this webpage. I wanted to ask what you think about "What can we learn?" section I've been adding to some of the pages. Thank you - [[User:E-inspired|E-inspired]] ([[User talk:E-inspired|talk]]) 13:27, 28 February 2013 (UTC)

:This site is actually the work of multiple editors working slowly and steadily to fill in explanations for all the old comics. Some of the xkcd comics are incredibly deep - comic [[956]] is such a poignant comic that digs into the DRM issue on so many levels. Your reflections on many of the comics are very much warranted and you're helping us create talk pages with high-quality opening posts, which is great for future discussion on this wiki. It'd be nice if you could refrain from putting headers in talk pages, technical limitations of the wiki make long explanation pages choke when headings are in the discussion page. Other than that, keep up the good work! '''[[User:Davidy22|Davidy²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 13:42, 28 February 2013 (UTC)

::I've put in my 2 cents to comic [[956]], and thank you for teaching me how to comment and link to other comics - [[User:E-inspired|E-inspired]] ([[User talk:E-inspired|talk]]) 13:58, 28 February 2013 (UTC)

::: FYI, you can always make pseudo-headings using a horizontal rule and a bold "header", but honestly I think a simple standard opening sentence would suffice. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 12:14, 2 March 2013 (UTC)

:Oh, and the guy who draws xkcd is called {{w|Randall Munroe}}. So many glowing things to be said about him. '''[[User:Davidy22|Davidy²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 13:44, 28 February 2013 (UTC)

::Yes, I can't thank him enough for simplifying complex issues to funny stories, I think it's exactly what our generation needs - [[User:E-inspired|E-inspired]] ([[User talk:E-inspired|talk]]) 13:58, 28 February 2013 (UTC)

:I'm in favor of a Mr. Rogers style of 'what lesson can be learned' on the talk page, but make sure your comments don't come across as sanctimonious and holier-than-thou as that can be really off-putting. [[User:Lcarsos|lcarsos]]_a ([[User talk:Lcarsos|talk]]) 19:06, 28 February 2013 (UTC)

:: You are absolutely correct, I have not thought of that, please trust me I did not do it on purpose. Thank you Mr. Lcarsos - [[User:E-inspired|E-inspired]] ([[User talk:E-inspired|talk]]) 19:55, 28 February 2013 (UTC)

Thank you David, and I apologize that I've not made it clear that by your work, I do mean your collective work (the wiki is only as good as all the people behind it). I was trying to put the headers to allow others to find the section easier in case they start looking for it, perhaps I could make a suggestion to make it a standalone section so that others would be encouraged to contribute their own understanding of lessons they have noticed from each comic. I know the lessons I've seen, but I would love to learn from others as much as I hope they can learn from me and Mr. XKCD, thank you. - [[User:E-inspired|E-inspired]] ([[User talk:E-inspired|talk]]) 13:48, 28 February 2013 (UTC)

== DING DONG THE WITCH IS DEAD ==

Hello fellow editors. Do you remember the last time we were hit by a surge of automated spam? Neither do I. ConfirmEdit has really done a number on the volume of spam that we're eating - one spam account has been created since we finished configuring confirmEdit, and zero anon edits have been spam. Zero. Can you say happiness? Can you say party? '''[[User:Davidy22|Davidy²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 14:41, 1 March 2013 (UTC)

:Hehe, I'm glad! Thanks for being so relentless on the spam-fighting all this time! Maybe we should make up a new reason to make Jeff remove the /wiki/ in the URL? ;) –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 18:11, 1 March 2013 (UTC)

:: Awesome news! Finally the patrolling feature will be usable: [{{fullurl:Special:RecentChanges|hideanons=1&hidepatrolled=1&from=20121204025000&days=365&limit=1000}} Unpatrolled changes by registered users] / [{{fullurl:Special:RecentChanges|hideliu=1&hidepatrolled=1&from=20121204025000&days=365&limit=1000}} Unpatrolled changes by anonymous users] :) --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 12:27, 2 March 2013 (UTC)

== 1000th comic explanation!! ==

Hi all! It apparently went unnoticed that '''we have recently surpassed the mark of 1000 comic explanations!''' Some calculations based on [[:Category:Comics]] and [[Special:NewPages]] led me to the conclusion that the 1000th explanation was [[681: Gravity Wells]], created by [[User:AlexRNL]] just yesterday! Yay! This calls for a celebration, no? Congrats to [[Special:ContributionScores|everyone]] who made this happen! I'll edit [[Mediawiki:Sitenotice]] with a congratulatory message. Way to go, guys! --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 16:04, 10 April 2013 (UTC)
:ps - I also took the opportunity to flesh out our [[explain xkcd|about/history page]]. Please take a look and fix/add any details I might have missed. --[[User:Waldir|Waldir]] ([[User talk:Waldir|talk]]) 16:06, 10 April 2013 (UTC)

== Style guide ==

Is there a style guide for this wiki? --[[User:PeterMortensen|PeterMortensen]] ([[User talk:PeterMortensen|talk]]) 20:14, 10 August 2013 (UTC)

923: Strunk and White

2013-08-10T15:50:41Z

PeterMortensen: /* Transcript */

{{comic
| number = 923
| date = July 11, 2011
| title = Strunk and White
| image = strunk_and_white.png
| imagesize =
| titletext = The best thing about Strunk/White fanfiction is that it's virtually guaranteed to be well written.
}}

==Explanation==
This is a comic about the 1918 writing style guide called "{{w|The Elements of Style}}" by Cornell University professor William Strunk Jr. and New Yorker writer E.B. White. Just like in the original book, they are clarifying the usage of words and punctuation in the English language. In this case however, they are clarifying the use of the original authors' names, one usage for the book and another for the {{w|slash fiction}} or erotic fan fiction involving them.

Erotic fan fiction, if you were not aware, is a genre of fiction in which fans make up erotic stories involving characters from non erotic stories. "Slash fiction" is a special subgenre that pairs characters of the same sex and is denoted by using the "/" to separate the paired characters. {{w|Orthography}} is the rules of a written language, including punctuation and spelling.

The title text comments that authors of Strunk/White fan fiction must have read The Elements of Style, which makes them better writers.

==Transcript==
:[Three dignified-looking editors of Strunk & White's "The Elements of Style" before a desk with a computer. One is seated and types the following:]

:Dear Internet,
: We, the current editors of Strunk & White's "The Elements of Style", must —with great reluctance— clarify a point of orthography:
: "Strunk & White" should be used for the style manual and "Strunk/White" for the erotic fan fiction pairing.

{{comic discussion}}

[[Category:Comics featuring Cueball]]
[[Category:Language]]

292: goto

2013-08-10T15:14:43Z

PeterMortensen: /* Explanation */ Expansion.

{{comic
| number = 292
| date = July 20, 2007
| title = goto
| image = goto.png
| titletext = Neal Stephenson thinks it's cute to name his labels 'dengo'
}}

==Explanation==
{{w|goto}} is a construct found in many computer languages that causes control flow to go from one place in program to another, without returning. Once common in computer programming, its popularity diminished in the 1960s and 1970s as focus on {{w|structured programming}} became the norm. {{w|Edsger W. Dijkstra}}'s article [http://www.u.arizona.edu/~rubinson/copyright_violations/Go_To_Considered_Harmful.html Go To Statement Considered Harmful] in particular contributed to the decline of ''goto''.

Often people learning programming are told ''goto'' is bad and should be avoided, but frequently are not given a reason. In this case, [[Cueball]] can see no harm in using ''goto'' to avoid rewriting much of his program. As a result, he is attacked by a {{w|velociraptor}}. Velociraptor attacks are a running joke (and fear) often expressed in [[xkcd]]. The humor derives from the fact that a velociraptor attack is [http://tvtropes.org/pmwiki/pmwiki.php/Main/WhatCouldPossiblyGoWrong an unlikely thing to happen] after using a ''goto'' statement.

The title text refers to {{w|Neal Stephenson}}, an author of cyberpunk novels. A label is used in many programming languages to refer to a point in a program that a goto instruction can jump to. The joke is that one of Stephenson's characters in ''{{w|Cryptonomicon}}'' is named 'Goto Dengo'.

==Transcript==
:[Cueball sits at computer, thinking.]
:Cueball: I could restructure the program's flow - or use one little 'GOTO' instead.
:Cueball: Eh, screw good practice. How bad can it be?
:Text on computer: <tt>goto main_sub3;</tt>
:<nowiki>*Compile*</nowiki>
:[Cueball looks at the computer.]
:[A raptor jumps into the panel and attacks Cueball.]

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Velociraptors]]
[[Category:Programming]]

Category:Velociraptors

2013-08-10T15:12:17Z

PeterMortensen: Spelling/case.

The '''Velociraptor''' is a genus of {{w|dinosaur}} which was popularized by its appearance in the ''{{w|Jurassic Park}}'' film series. In the films, Velociraptors are depicted as small (shorter than adult humans) bi-pedal scaled dinsaurs which frequently attacked and killed humans. They were one of the main antagonists in the films. The reference source used by the author of the original novel was somewhat outdated, and the dinosaurs as written and thereafter depicted in the film have some discrepencies with the size and appearance of the velociraptors. For example, scientists have since discovered that velociraptors were likely feathered.

''Jurassic Park'' may have been a relatively scary film for children, and the film appears to have had a strong impact on [[Randall Munroe]]. Velociraptors in particular, and the irrational fear of being attacked by them in the modern world, are subject of (or appear in) several strips of ''[[xkcd]]''.

''See also: {{w}}''

[[Category:Comics by topic]]
[[Category:Jurassic Park]]