explain xkcd - User contributions [en]

3227: Creation

2026-04-01T20:50:02Z

Tbodt: /* Explanation */

{{comic
| number = 3227
| date = April 1, 2026
| title = Creation
| image = creation_2x.png
| imagesize = 567x198px
| noexpand = true
| titletext = This xkcd.com update introduces a variety of new reading modes which can be activated through the menu.
}}To experience the interactivity, visit the {{xkcd|{comicNum}|original comic}}!

==Explanation==
{{incomplete|This page was created recently in ROBOTIC MODE. Don't remove this notice too soon.}}
this comic was created when modes were added to the xkcd website, allowing different viewing options. Some are normal, like light and dark mode, but others are more interesting, like airplane mode (see below)

The comic references one of the first lines of the bible, about god making light, but then a person on earth asks to turn on dark mode, referencing the new options.

MODES:
{| class="wikitable"
|-
! Mode
! Description
|-
| Light Mode
| The default mode that the site was previously limited to.
|-
| Lighter Mode
| The entire web page is overexposed, making colors wash out and reducing the contrast.
|-
| Dark Mode
| A standard "white content on black background" dark mode.
|-
| Darkest Mode
| Everything on the webpage turns completely black, sans the drop down menu which is merely a dark gray.
|-
| Blurry Mode
| Blurs the entire webpage.
|-
| Grayscale Mode
| Applies a standard grayscale conversion filter to the entire webpage.
|-
| Greyscale Mode
| Applies a standard grayscale conversion filter to the entire webpage, as well as changing the spelling of "math" in the slogan at the top of the page to "maths"
|-
| Dorian Greyscale Mode
| Makes the webpage slowly turn grey. This refers to {{w|The Picture of Dorian Gray}}, in which the title character has a portrait that slowly ages and fades out while the character stays young and handsome.
|-
| Space Opera Mode
| Turns the entire page into a StarWars style opening scroll.
|-
| 3D Mode
| Makes the comic render in {{w|Anaglyph_3D|anaglyphic stereoscopy}}.
|-
| Origami Mode
| Rotates various pieces of the webpage.
|-
| Ink Mode
| Recolors the webpage as if drawn in blue ink.
|-
| Spring Mode
| Gives the comic a simple physics simulation, making it slightly rotate as the page is scrolled.
|-
| Antipodes Mode
| Turns the entire webpage upside down.
|-
| Hacker Mode
| Recolors the entire webpage in the stereotypical "green on black" hacker color scheme.
|-
| Screensaver Mode
| Makes the comic float around on the webpage, bouncing as it hits the edges.
|-
| Modem Mode
| Makes the comic load slowly, accompanied with modem static audio playing.
|-
| Stained Glass Mode
| Colors each closed area of the comic in a separate color.
|-
| Airplane Mode
| Makes the comic fly around on the page, with a "NYOOM!" written next to it.
|-
| Boat Mode
| Makes the entire webpage tilt back and forth, emulating the way a boat rolls on the water.
|}

==Transcript==
{{incomplete transcript|Don't remove this notice too soon.}}

{{comic discussion}}<noinclude>[[Category:Interactive comics]][[Category:Dynamic comics]]

3227: Creation

2026-04-01T20:47:19Z

Tbodt: it just renamed!

{{comic
| number = 3227
| date = April 1, 2026
| title = Creation
| image = creation_2x.png
| imagesize = 567x198px
| noexpand = true
| titletext = This xkcd.com update introduces a variety of new reading modes which can be activated through the menu.
}}To experience the interactivity, visit the {{xkcd|{comicNum}|original comic}}!

==Explanation==
{{incomplete|This page was created recently in ROBOTIC MODE. Don't remove this notice too soon.}}
this comic was created when modes were added to the xkcd website, allowing different viewing options. Some are normal, like light and dark mode, but others are more interesting, like airplane mode (see below)

The comic references one of the first lines of the bible, about god making light, but then a person on earth asks to turn on dark mode, referencing the new options.

MODES:
{| class="wikitable"
|-
! Mode
! Description
|-
| Light Mode
| The default mode that the site was previously limited to.
|-
| Lighter Mode
| The entire web page is overexposed, making colors wash out and reducing the contrast.
|-
| Dark Mode
| A standard "white content on black background" dark mode.
|-
| Darkest Mode
| Everything on the webpage turns completely black, sans the drop down menu which is merely a dark gray.
|-
| Blurry Mode
| Blurs the entire webpage.
|-
| Grayscale Mode
| Applies a standard grayscale conversion filter to the entire webpage.
|-
| Greyscale Mode
| Applies a standard grayscale conversion filter to the entire webpage, as well as changing the spelling of some words (eg "math") to the British English spelling (eg "maths")
|-
| Dorian Greyscale Mode
| Makes the webpage slowly turn grey.
|-
| Space Opera Mode
| Turns the entire page into a StarWars style opening scroll.
|-
| 3D Mode
| Makes the comic render in anaglyphic stereoscopy.
|-
| Origami Mode
| Rotates various pieces of the webpage.
|-
| Ink Mode
| Recolors the webpage as if drawn in blue ink.
|-
| Spring Mode
| Gives the comic a simple physics simulation, making it slightly rotate as the page is scrolled.
|-
| Antipodes Mode
| Turns the entire webpage upside down.
|-
| Hacker Mode
| Recolors the entire webpage in the stereotypical "green on black" hacker color scheme.
|-
| Screensaver Mode
| Makes the comic float around on the webpage, bouncing as it hits the edges.
|-
| Modem Mode
| Makes the comic load slowly, accompanied with modem static audio playing.
|-
| Stained Glass Mode
| Colors each closed area of the comic in a separate color.
|-
| Airplane Mode
| Makes the comic fly around on the page, with a "NYOOM!" written next to it.
|-
| Boat Mode
| Makes the entire webpage tilt back and forth, emulating the way a boat rolls on the water.
|}

==Transcript==
{{incomplete transcript|Don't remove this notice too soon.}}

{{comic discussion}}<noinclude>[[Category:Interactive comics]][[Category:Dynamic comics]]

3227: Creation

2026-04-01T20:43:51Z

Tbodt:

{{comic
| number = 3227
| date = April 1, 2026
| title = Creation
| image = creation_2x.png
| imagesize = 567x198px
| noexpand = true
| titletext = This xkcd.com update introduces a variety of new reading modes which can be activated through the menu.
}}To experience the interactivity, visit the {{xkcd|{comicNum}|original comic}}!

==Explanation==
{{incomplete|This page was created recently in ROBOTIC MODE. Don't remove this notice too soon.}}
this comic was created when modes were added to the xkcd website, allowing different viewing options. Some are normal, like light and dark mode, but others are more interesting, like airplane mode (see below)

The comic references one of the first lines of the bible, about god making light, but then a person on earth asks to turn on dark mode, referencing the new options.

MODES:
{| class="wikitable"
|-
! Mode
! Description
|-
| Light Mode
| The default mode that the site was previously limited to.
|-
| Lighter Mode
| The entire web page is overexposed, making colors wash out and reducing the contrast.
|-
| Dark Mode
| A standard "white content on black background" dark mode.
|-
| Darkest Mode
| Everything on the webpage turns completely black, sans the drop down menu which is merely a dark gray.
|-
| Blurry Mode
| Blurs the entire webpage.
|-
| Grayscale Mode
| Applies a standard grayscale conversion filter to the entire webpage.
|-
| Greyscale Mode
| Applies a standard grayscale conversion filter to the entire webpage, as well as changing the spelling of some words (eg "math") to the British English spelling (eg "maths")
|-
| Dorian Greyscale Mode
| Makes the webpage slowly turn grey.
|-
| Space Opera Mode
| Turns the entire page into a StarWars style opening scroll.
|-
| 3D Mode
| Makes the comic render in anaglyphic stereoscopy.
|-
| Origami Mode
| Rotates various pieces of the webpage.
|-
| Ink Mode
| Recolors the webpage as if drawn in blue ink.
|-
| Spring Mode
| Gives the comic a simple physics simulation, making it slightly rotate as the page is scrolled.
|-
| Southern Hemisphere Mode
| Turns the entire webpage upside down.
|-
| Hacker Mode
| Recolors the entire webpage in the stereotypical "green on black" hacker color scheme.
|-
| Screensaver Mode
| Makes the comic float around on the webpage, bouncing as it hits the edges.
|-
| Modem Mode
| Makes the comic load slowly, accompanied with modem static audio playing.
|-
| Stained Glass Mode
| Colors each closed area of the comic in a separate color.
|-
| Airplane Mode
| Makes the comic fly around on the page, with a "NYOOM!" written next to it.
|-
| Boat Mode
| Makes the entire webpage tilt back and forth, emulating the way a boat rolls on the water.
|}

==Transcript==
{{incomplete transcript|Don't remove this notice too soon.}}

{{comic discussion}}<noinclude>[[Category:Interactive comics]][[Category:Dynamic comics]]

2995: University Commas

2024-10-07T21:47:37Z

Tbodt:

{{comic
| number = 2995
| date = October 7, 2024
| title = University Commas
| image = university_commas_2x.png
| imagesize = 580x273px
| noexpand = true
| titletext = The distinctive 'UCLA comma' and 'Michigan comma' are a long string of commas at the start and end of the sentence respectively.
}}

==Explanation==
{{incomplete|Created by a BOT COMMA - Please change this comment when editing this page. Do NOT delete this tag too soon.}}
,,,,,,,The, {{w|Oxford comma}}, is, a, comma, between, the, second,-to,-last, part, of, a, list, and, the, word, ''and'',.,,,,,, Some style guides such as ''{{w|The Oxford Style Manual}}'' reccomend using it while others reccomend against it. This comic imagines other commas associated with universities.

An Oxford comma is a comma placed after the second-last term in a ___, ___, and ___ format.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

{{comic discussion}}

1179: ISO 8601

2023-03-21T06:26:37Z

Tbodt:

{{comic
| number = 1179
| date = 2013-02-27
| title = ISO 8601
| image = iso_8601.png
| titletext = ISO 8601 was published on 06/05/88 and most recently amended on 12/01/04.
}}

==Explanation==
When abbreviating the date into numerical form, {{w|Date format by country|various areas of the world}} tend to list the year, month, and day in different orders (as well as with different delimiting symbols), which can cause confusion particularly when the day value is 12 or lower allowing it to be easily interpreted as the month and vice versa. As a {{w|public service announcement}}, this comic states that there is in fact one international standard for writing numeric dates, set by the {{w|International Organization for Standardization}} in its {{w|ISO 8601}} standard: YYYY-MM-DD.

The comic then proceeds to list several discouraged ways of writing out the date of the comic's publication, as they do not match the standard. It begins with several commonly used ones in countries around the world, but then begins to list increasingly uncommon ways, ranging from strange (Roman numerals) to quirky (binary, Unix time) to essentially impossible (painting the numbers onto a black cat).

The title text provides a perfect example of the kind of ambiguity that can arise when non-standard formats are used. The ISO standard was in fact published on 1988-06-05 and amended on 2004-12-01. This is mentioned in the title text in MM/DD/YY format; however, there is no way to naturally figure this out, particularly with the second date.

With the year truncated to two digits and all three numbers at 12 or lower, the date referring to December 1, 2004 (the digits pairs 12, 01 and 04) has a number of misinterpretations. Usually 12th Jan '04 (if written as US-style but read as European, or vice-versa) but with ISO-influenced "YY MM DD" ordering as one side or other of the misunderstanding it can easily become the 12th day of April 2001, the 4th day of December 2001 and the 4th of January 2012. It takes two such communication errors to 'become' the 1st day of April 2012.

Date formats were again the subject in [[1340: Unique Date]] and [[2562: Formatting Meeting]].

The other mentioned formats are:

{| class=wikitable
! Date !! Explanation
|-
| 02/27/2013
| MM/DD/YYYY, used mostly in the [https://www.trustedtranslations.com/blog/how-are-dates-written-in-different-countries United States, Belize and Micronesia].
|-
| 02/27/13
| MM/DD/YY, same as above but with the year shortened to two digits.
|-
| 27/02/2013
| DD/MM/YYYY, used variously in South America, Canada ({{w|Date_and_time_notation_in_Canada|officially uses ISO 8601}}), Australia, New Zealand and much of Europe.
|-
| 27/02/13
| DD/MM/YY, same as above but with the year shortened to two digits.
|-
| 20130227
| YYYYMMDD, same as ISO 8601 without delimiting punctuation. Allowed by the standard. Technically not ambiguous but is hard to read as a date at first glance.
|-
| 2013.02.27
| YYYY.MM.DD, used in Japan, South Korea and Hungary. Same as ISO 8601 except with different punctuation.
|-
| 27.02.13
| DD.MM.YY, used in Germany, Russia, and others.
|-
| 27-02-13
| DD-MM-YY, used in Denmark, Netherlands, Indonesia, India, Bangladesh, and others.
|-
| 27.2.13
| D.M.YY. It is common in several areas to abbreviate the month or day to a single digit and drop the leading zero when possible.
|-
| 2013. II. 27.
| YYYY. MM. DD., with month as {{w|Roman numerals}}, used in Hungary. In this format, February and November are prone to be confused with each other: "II" vs. "11". Similar formats with the opposite ordering (27. II. 2013) existed historically in various European countries like France, Germany and Italy.
|-
| 27⁄2-13
| D⁄M-YY, traditional format in Denmark, Norway and Sweden
|-
| 2013.158904109
| Year and decimal fraction of year. 0.158904109 is a decimal approximation of 58/365, with February 27 being the 58th day of the year. This format may be easier to read for computers/programs in some contexts, but is difficult for humans to interpret.
|-
| MMXIII-II-XXVII
| The ISO 8601 standard but written in Roman numerals. Never used as a traditional standard anywhere as it is hard to read, parse, and interpret for no benefit.
|-
| MMXIII LVII⁄CCCLXV
| Year followed by its partial fraction 57/365, all in Roman numerals. Equally useless as the above. As a note, apparently this 'standard' is different from the decimal fraction two rows above, as the decimal fraction notation uses the ''end'' of the day (first day of the year is 1/365 while the last is 365/365), while this uses the ''beginning'' (first day is 0/365 and last is 364/365).
|-
| 1330300800
| {{w|Unix time|UNIX Timestamp}}, a standard method of storing absolute time in many computer systems and defined as the number of seconds since 00:00:00 on 1970-01-01 (UTC). The Unix time listed here appears to mistakenly be for '''2012'''-02-27, which is also mentioned by [[Randall]] in the original transcript. The Unix Timestamp for 2013-02-27 would be 1361923200.
|-
| ((3+3)×(111+1)-1)×3/3-1/33
| A useless format where the numbers 2013, 2, and 27 written as needlessly long arithmetic expressions using just the digits 1 and 3. For additional confusion, the values are delimited by slashes, enabling confusion with the fraction bar. (If evaluated literally, the entire expression evaluates to 670.963, or 671 minus 1 divided by 27.)
|-
|    2  272013
| A nearly impossible to read date "format" that can be considered a parody "compromise" between different formats: rather than argue about the order in which the year, month, and day should be, they are simply all written on top of each other. As a "bonus", there is also no arguing over which separator character to use.
|-
| 10/11011/1101
| The US mm/dd/yy format in {{w|Binary number|binary}}, corresponding to 2/27/13. Never used for obvious reasons.
|-
| 02/27/20/13
| MM/DD/CC/YY, where CC stands for century. This format is never used.{{Citation needed}} Note that while months and days count starting from 1, centuries and years in this format count from 0 for extra confusion. But the CC value is widely used on many operating systems to distinguish between the 20th and 21st century, represented by the values "19" and "20" because 1950 belongs to the 20th century.
|-
| <ruby><rb>0</rb><rb>1</rb><rb>2</rb><rb>3</rb><rb>7</rb><rt>2</rt><rt>3</rt><rt>1</rt><rt>4</rt><rtc style="ruby-position: under"><rt>5</rt><rt></rt><rt>67</rt><rt></rt><rt>8</rt></rtc></ruby>
| An obfuscated format where the small numbers indicate the positions where the large digits should be placed. In this reading, 0 is used at positions 2 and 5, 1 is used on position 3, etc.; the result being 20130227
|-
| [A hissing black cat with "2-27-13" painted on it]
| In Western cultures, black cats and the number 13 are associated with bad luck. The cat might also just be angry that someone covered it in paint.
|}

==Transcript==
:Public Service Announcement:

:Our different ways of writing dates as numbers can lead to online confusion. That's why in 1988 ISO set a global standard numeric date format. This is '''''the''''' correct way to write numeric dates:

::2013-02-27

:The following formats are therefore discouraged:
:*02/27/2013
:*02/27/13
:*27/02/2013
:*27/02/13
:*20130227
:*2013.02.27
:*27.02.13
:*27-02-13
:*27.2.13
:*2013. II. 27.
:*27⁄2-13
:*2013.158904109
:*MMXIII-II-XXVII
:*MMXIII LVII⁄CCCLXV
:*1330300800
:*((3+3)×(111+1)-1)×3/3-1/33
:*   2  272013 [the numbers 2013, 02, and 27 written overlapping each other]
:*10/11011/1101
:*02/27/20/13
:*2053112674378
:*[A black cat with 2-27-13 scrawled across its body in dripping white paint.]
:**Cat: ''Hissss''

{{comic discussion}}
[[Category:Math]]
[[Category:Calendar]]

191: Lojban

2022-02-06T03:43:30Z

Tbodt: /* Explanation */

{{comic
| number = 191
| date = December 1, 2006
| title = Lojban
| image = lojban.png
| titletext = zo'o ta jitfa .i .e'o xu do pendo mi
}}

==Explanation==
{{w|Lojban}} is a constructed language designed to be logical, unambiguous, and culturally neutral — similar to the better known artificial language {{w|Esperanto}}. The authors originally designed it as an experiment, but a few people have picked it up and tried to learn it. However, anyone actually willing to learn Lojban is someone [[Black Hat]] would rather avoid. Alternately, only people who speak Lojban, who compose an admittedly tiny proportion of the general population, could benefit from the logic of the language, making the benefits of Lojban mostly pointless to most people.

Clicking on the original comic brings you to [https://imgs.xkcd.com/comics/lojban_translated.png a Lojban translation of the comic]. The Lojban version literally translates to something like:
:Cueball: Hypothetically, you becoming an expert in Lojban implies things you say would completely be an unambiguous meaning and logical.
:Black Hat: Agreed, but would be talking to the people subgroup that is an expert in Lojban.
If reading pedantically, a few mistakes can be identified:
* "Hypothetically" is applied to the entire first sentence rather than the subclause "you are an expert in Lojban".
* The word "pavysmu" is used in a way that indicates the things being said ''are'' an unambiguous meaning, rather than having a single meaning.
* The subgroup of people is specified as being an expert in Lojban, not the people in it.

The title text is also written in Lojban. It translates roughly as: "That was a joke. Really. Wanna be friends with me?" Since Lojban aims to be completely unambiguous, idiomatic structures like sarcasm and humor have associated particles - when a joke is made, it must be ''explicitly'' marked as such or else it's incorrect. Most languages rely on intonation expressing this, but Lojban does not, leading to the strange practice here of specifically pointing out that a joke was made.

A more literal translation gives: "Humorously that false. Please is-it-true-that you friend me?"

==Transcript==
:[Cueball and Black Hat are having a conversation.]
:[English version:]
:Cueball: If you learned to speak Lojban, your communication would be completely unambiguous and logical.
:Black Hat: Yeah, but it would all be with the kind of people who learn Lojban.

:[Lojban version:]
:Cueball: da'i ganai do crebi'o la lojban gi le se cusku be do cu mulno pavysmu je logji
:Black Hat: .i .ie ku'i cusku fi le prenu klesi poi certu la lojban

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Black Hat]]
[[Category:Language]]

Talk:191: Lojban

2022-02-06T03:22:41Z

Tbodt:

https://www.youtube.com/watch?v=IRsPheErBj8 --[[Special:Contributions/79.67.240.72|79.67.240.72]] 16:02, 28 February 2013 (UTC)
:Go away. [[User:Beanie|Beanie]] ([[User talk:Beanie|talk]]) 12:03, 18 March 2021 (UTC)

- What can we learn from this? - I've learned that unless you share your knowledge with others, the rest of your life will be very lonely and no one will understand you. - [[User:E-inspired|E-inspired]] ([[User talk:E-inspired|talk]]) 16:11, 28 February 2013 (UTC)

- What can we learn from 79.67.240.72? - That insults have no meaning, after you declaw them with reason. (Thank you Mr. 79.67.240.72) - [[User:E-inspired|E-inspired]] ([[User talk:E-inspired|talk]]) 16:15, 28 February 2013 (UTC)

I did change the transcript to the words from the Lojban picture posted here. What the hell was this former text:
la .kiubal. cusku lu da'i ganai do crebi'o la lojban gi le se cusku be do cu mulno pavysmu je logji li'u
.i la .xekrimapku. cusku lu .i .ie ku'i cusku fi le prenu klesi poi certu la lojban li'u
--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 17:38, 15 October 2013 (UTC)

- That's how a transcript would be written in a Lojban text; {.kiubal.}, for instance, is a Lojbanisation of "cueball", and {lu} and {li'u} are open/close quotation marks. It would have been right if this wiki was in Lojban, but since it's in English, it's debatable. I guess the current version is easier for the readership to read. [[Special:Contributions/141.101.98.225|141.101.98.225]] 13:14, 5 November 2013 (UTC)
:I would be happy if you could do an explain on this. I just did check the transcript, and I am not native Lojban ;). So, if there are any important differences, it has to be explained here. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 20:56, 5 November 2013 (UTC)
::This also could mean changing the transcript again, but then it has to be explained.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 20:58, 5 November 2013 (UTC)
::It also was not correct, as .xekrimapku. is not a legal cmene. Maybe "xekrimapuk."? [[Special:Contributions/173.245.54.40|173.245.54.40]] 01:25, 17 March 2016 (UTC)
:::Perhaps la .xekmapk. (based on a lujvo, similar to la .lojbangirz.) [[User:Tbodt|Tbodt]] ([[User talk:Tbodt|talk]]) 03:22, 6 February 2022 (UTC)

I would really like to know which of the two alternative interpretations given in the entry text is actually supported by the Lojban translation, though... being a proclaimed unambiguous language and all [[Special:Contributions/162.158.83.210|162.158.83.210]] 18:56, 12 October 2016 (UTC)

162.158.83.210, Lojban is syntactically unambiguous. It is not, and does not claim to be, semantically unambiguous. I don't think that's even possible. Even if Lojban was semantically unambiguous, there would still be multiple ways to translate it into English, another semantically ambiguous language. {{unsigned ip|172.68.174.82}}

They should call a problem like this the Lojban Effect [[Special:Contributions/162.158.79.245|162.158.79.245]] 01:42, 24 August 2019 (UTC)

2568: Spinthariscope

2022-01-14T19:41:38Z

Tbodt:

{{comic
| number = 2568
| date = January 14, 2022
| title = Spinthariscope
| image = spinthariscope.png
| titletext = Other high scorers are melt-in-your-hand aluminum-destroying gallium and tritium-powered glowsticks. Lawn darts are toward the other end.
}}

==Explanation==
{{incomplete|Created by a SPINTHARISCOPE - Please change this comment when editing this page. Do NOT delete this tag too soon.}}

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
{{comic discussion}}

2529: Unsolved Math Problems

2021-10-16T03:47:24Z

Tbodt:

{{comic
| number = 2529
| date = October 15, 2021
| title = Unsolved Math Problems
| image = unsolved_math_problems.png
| titletext = After decades of studying the curve and the procedure that generates it, the consensus explanation is "it's just like that."
}}

==Explanation==
{{incomplete|Created by leading experts in Sondheim calculus - Please change this comment when editing this page. Do NOT delete this tag too soon.}}

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}
{{comic discussion}}

2302: 2020 Google Trends

2020-05-05T00:15:18Z

Tbodt: Link to the actual trends graph

{{comic
| number = 2302
| date = May 5, 2020
| title = 2020 Google Trends
| image = 2020_google_trends.png
| titletext = As the 'exotic animals in homemade aprons hosting baking shows' YouTube craze reached its peak in March 2020, Andrew Cuomo announced he was replacing the Statue of Liberty with a bronze pangolin in a chef's hat.
}}

==Explanation==
{{incomplete|Created by a BRONZE PANGOLIN STATUE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.

Randall wants to go back in time to show a 2019 person [https://trends.google.com/trends/explore?date=2019-05-05%202020-05-04&geo=US&q=sewing%20machine,webcam,andrew%20cuomo,flour,pangolin a Google Trends graph]. The coronavirus has massively impacted everyone's lives and what they search for. This graph shows how people have been impacted, albeit in an awful representation.

All of these trends are attributed to the COVID-19 pandemic.
* "Sewing machine" refers to people making their own {{w|cloth face mask}}s.
* "Webcam" refers to the massive increase in virtual meetings and video conferencing.
* "{{w|Andrew Cuomo}}" is the governor of {{w|New York (state)|New York}}, the state hit hardest by the pandemic in the United States.
* "Flour" refers to an increase in baking due to people staying at home. This is also referred to in [[2296: Sourdough Starter]]. The little lump at the end of November and December can probably be attributed to people baking for Thanksgiving and Christmas.
* A {{w|pangolin}} is a mammal found in Africa and Asia. This search term refers to the claim that the virus originated in wild animals sold in {{w|wet market}}s in {{w|Wuhan}}, China.

The title text is a possible "guess" by the 2019 person for these search terms having an increase together: a YouTube craze of exotic animals (which includes pangolins) in homemade aprons hosting baking shows which leads to a response by New York governor Andrew Cuomo.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[A line chart plotting the popularity of various search terms from May 2019 through April 2020: sewing machine (blue line), webcam (red), Andrew Cuomo (yellow), flour (green), and pangolin (purple). The yellow line starts at the bottom of the chart, and rises about halfway up at the end of March 2020 before decaying to about 20 percent by the end of April. The purple line starts at the bottom of the chart, and has a small lump in February 2020 and a slightly bigger lump in March 2020 before trending back down. The blue line starts at about 10 percent up the chart, and then spikes up to 50 percent at the beginning of April before decaying to 40 percent at the end of April. The red line starts at about 20 percent up the chart, has a small lump in September 2019, and then jumps up to 40 percent in March 2020 before trending back down. The green line starts at about 30 percent up the chart, has a small lump in December 2019, and then spikes up to the top of the chart at the end of March 2020.]

:[Caption below comic:] I want to show someone from 2019 this Google Trends graph and watch them try to guess what happened in 2020.
{{comic discussion}}

[[Category:COVID-19]]
[[Category:Comics featuring politicians]]
[[Category:Animals]]
[[Category:Line graphs]]

2299: Coronavirus Genome 2

2020-04-28T19:56:56Z

Tbodt: Add citation for facebook character limit

{{comic
| number = 2299
| date = April 27, 2020
| title = Coronavirus Genome 2
| image = coronavirus_genome_2.png
| titletext = [moments later, checking phone] Okay, I agree my posting it was weird, but it's somehow even more unnerving that you immediately liked the post.
}}

==Explanation==
{{incomplete|Created by a SANITIZED PHONE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon.}}
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.

It is also a direct continuation of the previous comic, [[2298: Coronavirus Genome]], making this a [[:Category:Coronavirus Genome|new series]].

[[Megan]] sent her copy of the coronavirus genome to [[Cueball]], who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the Internet, though not in a form that can actually make people sick with COVID-19 (which may seem obvious, but then some people [https://www.forbes.com/sites/brucelee/2020/04/09/5g-networks-and-covid-19-coronavirus-here-are-the-latest-conspiracy-theories/ believe 5G causes coronavirus].) If his post catches on and is widely shared, it might be described as "going viral".

In continuation of the previous strip, Cueball appears to be fascinated by the fact that the entire genome of this very consequential virus can be fully detailed in a text file, using only 30,000 characters. He he realizes that he can't fit this much information in a single tweet (Twitter has a 280 character limit), but it able to fit the entire genome in a Facebook post (Facebook allows [https://www.zdnet.com/article/facebook-increases-status-update-character-limit-to-63206/ up to 63,206 characters in a post]).

This strip draws humor from the contrast between the costly physical precautions that are being taken to prevent the spread of coronavirus between people and the blitheness with which Cueball attempts to share (the genome of) the coronavirus electronically. Cueball's response (that it's okay, because he sanitized his phone before posting) could be taken as a sarcastic rebuttal, given that Megan sent the genome to him without knowing why he wanted it, or a commentary on the useless or counterproductive behaviors of clueless people (e.g. people who wear gloves before touching potentially-contaminated surfaces, but then scratch their noses while still wearing the possibly-contaminated gloves).

The title text deals with the almost inevitable outcome of the resulting message being 'liked' by some other party. In this case Megan, although she just told Cueball it was weird that he shared it. This may be a commentary on the common reflex to "like" your friend's posts, even if you think they're strange. Alternately, the "like" button on Facebook was historically the only way to signal a reaction to a post (other than actually commenting). When someone posted about a bad event, such as an injustice, a tragedy, or a difficult personal event, people might "like" the post to indicate their support of the person posting it, but it could read as having positive feelings toward the incident itself. (Facebook has since added multiple reaction buttons so express such emotions as surprise, sadness or anger). In this case, Megan "like"ing the coronavirus genome could be taken to mean that she likes the virus itself, which would be quite odd.

==Transcript==
:[Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.]
:Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?
:Megan: Sure.
:Megan: ...Why?

:[Megan has turned to her her laptop typing on it, Cueball is off-panel.]
:Cueball (off-panel): Nothing.
:Megan: I ... see.
:Megan: Well, here you go.
:Laptop: Click

:[In "two" frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square "speech bubble" with a "speech line" going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.]
:Phone:
::GAAAGGTAAGATGGAGAGGCCTTGTC
:<div style="background-color:red; padding:5px; width:fit-content; margin-left: 2em">CCTGGTTCAACGAGAA</div>
::-29,602 (+)
:<div style="background-color:cyan; padding:5px; width:fit-content; margin-left: 2em">Tweet</div>

:[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]
:Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post.
:Megan: Unsettling that your first instinct is "share it online."
:Cueball: It's cool, I sanitized my phone before posting.

{{comic discussion}}

[[Category:Comics with color]]
[[Category:Coronavirus Genome]]
[[Category:Comics sharing name|Coronavirus Genome]]
[[Category:COVID-19]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Biology]]
[[Category:Social networking]]

2131: Emojidome

2020-04-14T01:34:17Z

Tbodt: Interactive comments aren't exactly animated

{{comic
| number = 2131
| date = April 1, 2019
| title = Emojidome
| image = emojidome.png
| titletext = Thank you to the xkcd April 1st volunteers/commentators, including @Chromakode, Kevin, @Aiiane, Patrick, Kat, Reuven, @cotrone, @bstaffin, @zigdon, schwal, Stereo, and everyone who voted!
}}

==Explanation==
This was the ninth [[:Category:April fools' comics|April fools' comic]] released by [[Randall]]. The previous fools comic was [[1975: Right Click]] from Sunday April 1, 2018.

The interactive comic began at noon ET (16:00 UTC) on April 1, 2019, and ended a day later. In it, users were shown two emojis and voted for their favorite before the time ran out. 512 different emojis were paired against each other in a cup or {{w|Bracket (tournament)|bracket}} system, with only one winner. See more below under [[#How it worked|How it worked]].

Brackets - like the one in this comic, for finding the best emoji - are a recurring theme in xkcd. It is also relevant for this time of year, and two years ago in 2017, the first comic in April, [[1819: Sweet 16]] from April 3rd was a bracket, referencing {{w|March Madness}}. The {{w|2019 NCAA Division I Men's Basketball Tournament|2019 version}} of the {{w|National Collegiate Athletic Association}} {{w|College basketball}} national championship tournament began March 19th and ends April 8th 2019. So this comic could also be said to reference this, although it is not so explicit here. Earlier Randall made another large and "silly" bracket in [[1529: Bracket]] (which someone then actually made into an online voting system, just like in this comic).

The title is a reference to the movie ''{{w|Mad Max Beyond Thunderdome}},'' which had the tagline: "Two men enter. One man leaves." The "Thunderdome" in the film is a gladiatorial arena where conflicts are resolved by a duel to the death.

In the final round, the Milky Way emoji (🌌) won against the Hedgehog emoji (🦔). The comic was updated to show the result.

Clicking the comic links to a bracket of 128 emojis showing the winners: https://xkcd.com/2131/emojidome_bracket_round_of_128.png

==How it worked==

[[File:2131 Emojidome example.png|thumb|400px|Comic as it appeared during the competition]]

In the first round, the voting period for each bout lasted 37.5 seconds. The voting period for each bout doubled for the second, third, and fourth rounds. The voting period for each bout for the fifth round through the end was 26 minutes. The entire bracket took 24 hours 6 minutes.

Remaining time of a given bout was shown on a timer beneath the voting buttons. If the time remaining was one minute or greater, the time was shown rounded to the nearest minute (e.g., "Remaining Time: 26 minutes"); thus the minute would change on the half minute (e.g., "2 minutes" changed to "1 minute" at 1 minute 30 seconds). If the time remaining was less than a minute, the time was shown in seconds (e.g., "59 seconds"). When there were two (sometimes three) seconds remaining, the timer would display "Time's Up!" through the end of the bout and for a [[1070: Words for Small Sets|couple]] of seconds after the end of the bout while the images for the next bout were loading. Then the next bout would appear and the results of the previous bout would be added to the list of past bouts, with the most recent bout at the top.

Commentary was displayed above the images for each bout, and changed occasionally through the bout. In the first round, the commentary was made up of some stock phrases with a few custom phrases mixed in. Later commentary was tailored to suit each match-up and provided live updates on how each bout was progressing. A final comment was included in the list of past bouts.

{| class="wikitable"
|-
! Round !! Start (ET) !! Start (UTC) !! Bouts !! Bout length !! Round length
|-
| 1 || 12:00 || 16:00 || 256 || 37.5 s || 2 h 40 m
|-
| 2 || 14:40 || 18:40 || 128 || 1 m 15 s || 2 h 40 m
|-
| 3 || 17:20 || 21:20 || 64 || 2 m 30 s || 2 h 40 m
|-
| 4 || 20:00 || 0:00 || 32 || 5 m || 2 h 40 m
|-
| 5 || 22:40 || 2:40 || 16 || 26 m || 6 h 56 m
|-
| 6 || 5:36 || 9:36 || 8 || 26 m || 3 h 28 m
|-
| 7 || 9:04 || 13:04 || 4 || 26 m || 1 h 44 m
|-
| 8 || 10:48 || 14:48 || 2 || 26 m || 52 m
|-
| 9 || 11:40 || 15:40 || 1 || 26 m || 26 m
|}

The competing candidates were periodically overlaid with colored hearts that floated up from the vote button oscillating in a triangle wave pattern before disappearing above the candidate. Below the current competition, the results of past bouts were shown with the "loser" displayed in greyscale, the winner in color, and the final robot-commentator comment on that match.

The commentary appeared to suggest that there was some real-time feedback from the results of the competition. For instance, "It seems like our friends over Australia is joining the fun" appeared in the commentary. So did "We are getting a lot of questions on this today. This is live commentary, folks." https://i.imgur.com/8kPwjou.png, directly declaring that the commentary is live.

Note that the schedule might show different emoji pictures than the main voting screen, presumably because of fonts. The image is pre-rendered.

The competing candidates are chosen in order of Unicode value at first, resulting in similar emojis being compared. Examples include:

😜 squaring off against 😛 - two emojis playfully sticking their tongues out

🤩 squaring off against 😍 - two smiling emojis with symbols for eyes

😂 squaring off with 🤣 - two emojis that are crying in laughter/joy.

The original title text "🤼🤼🤼🤼🤼🤼🤼🤼" consisted of eight wrestler emojis. This likely represented the round of 8, where the eight winners then can turn to the winner next to them and continue the quarterfinals, etc. The title text was updated after the final round.

Notably, it appears the eggplant emoji (🍆) and the peach emoji (🍑) were left out of the bracket, alongside the middle finger emoji (🖕). The eggplant and peach are frequently used to represent a penis and vulva, respectively. There has been no statement from Randall on why they were left out.

A robot face announcer-emoji (🤖) and a link to the full bracket was added at 38 minutes in.
https://www.xkcd.com/2131/emojidome_bracket.png shows 512 emojis in a single-elimination tournament.
https://www.xkcd.com/2131/emojidome_bracket_256.png was added later and shows the 256 emojis that competed on the second round.
https://www.xkcd.com/2131/emojidome_bracket_round_3.png was added for the third round. https://www.xkcd.com/2131/emojidome_bracket_round_4.png was added for the fourth round. The round 3 bracket was later updated with results during the Volcano vs Owl fight. There was an error where the flying saucer had beaten the stars, which was not the case.
A new bracket image was created for the Round of 32 which seems to be updated with new results as they come in. https://www.xkcd.com/2131/emojidome_bracket_round_of_32.png

It is not clear how the winner is decided when both emojis tied for first. This has happened twice: in Cupcake vs. Birthday Cake (🧁 vs. 🎂) with 3658 points each, where the Birthday Cake (🎂) was declared winner, and in the very first match of Grinning Face vs. Grinning Face With Smiling Eyes (😀 vs. 😁), in which no votes were cast, but the Grinning Face With Smiling Eyes (😁) was declared winner. Both of these tied bouts occurred in round 1, and both declared winners lost their subsequent match in round 2.

==Alternative viewers==

Real data with results (clicks) can be seen as JSON-websocket at '''https://emojidome.xkcd.com/2131/socket''', transposed into a more human-readable format at '''https://leet.nu/tmp/xkcd-2131.html'''.

'''https://phiresky.github.io/emojidome/''', [https://www.reddit.com/r/xkcd/comments/b89zz1/emojidome_live_bracket_viewer/ made by a redditor], shows the brackets along with the final scores and comment.

==Transcript==
:[This was an interactive and dynamic comic during April 1st from its release until its completion. But the final and current image, will be the official image to transcribe. But the dynamic part of the comic as well as the "error image" displayed to services that could not render the dynamic comic is also transcribed here below.]

:[The final picture shows the winner of the gold medal in the Emojidome bracket tournament, as well as the runner up with the silver medal. There is no text. The winner is the "Space", "Stars" or "Milky Way" emoji, which is shown with a blue band on top of a dark blue band on top of an almost black background, indicating the light band of the Milky Way in the night sky. Stars (in both five point star shape and as dots) in light blue are spread out in all three bands of color. The large gold medal with its red neck string, is floating close to the middle of the picture, lacking any kind of neck in space to tie it around. To the left of the gold medal is the runner up, the brown Hedgehog, with light-brown face. It clutches the smaller silver medal, also with red neck string, which floats out there in space. The hedgehog with medal is small enough to fit inside the neck string on the gold medal.]

===Dynamic comic transcript===
:[This is an example of how the comic appeared during the competition. The example includes one of the final winner, Space's, matches. The dynamic part of the comic is transcribed below:]
:[[File:2131 Emojidome example.png|400px]]
:[At the top center of the comic, the two emojis battling it out are shown next to each other. The emojis displayed in the comic used the [https://github.com/twitter/twemoji twemoji] icon set. A different emoji set was shown in links to image of the tournament brackets. These matches are called bouts in the comic. The emoji from the top (or left) of the bracket is shown to the left. In this case it was space, night sky, milky way or stars vs Maglev train. Between them is the following text:]
:VS

:[There are two buttons one below each of the two emoji. If pressed the buttons became red. They could be pressed multiple times each match. The buttons have text on them:]
:Vote Vote

:[From the buttons colored hearts are released, often in bundles, and then they wave up across the emoji who's button they emanated from.]

:[Below the buttons there is and indicator showing how long the current battle is open for further votes. In the example the text is:]
:Remaining time: 24 minutes

:[The time began at "26 minutes" during the final rounds. It changed to "1 minute", with 1 minutes and 30 seconds left, and then 30 seconds later to "60 seconds" counting down to a few seconds. Then, before reaching 2 or 3 seconds it changed (a bit too early) to "Time's up!" Shortly there after a new bout would begin.]

:[Above the two emoji at the very top is a comment. The commentator is shown as a robot emoji. The comment often changed during the long final rounds. In the current example the text is:]
:"~future~"

:[But there would have been several others during the match. Given that Space won the entire Emojidome, the train lost this match. Often a final comment was posted just as the result was in. These final messages was then put at the top of the list of past bouts (matches). These bouts was displayed at the bottom of the comic below the remaining time. To the left was the following text:]
:Past bouts:

:[Below this text was a list of all previous matches, showing the two emojis, with the loser grayed out, with their final comment next to them. As soon as there where more than three a scroll bar appeared to the right, making it possible to scroll down through all these previous matches. As it was 512 emojis to begin with, there were 256 bouts in the first round, and then 255 the rest of the way to the final for a total of 511 bouts at the end. Here are the the text of the three matches that can be seen in the example (the grayed out loser was Sushi, Bee and Wizard):]
:🌋 vs 🍣 "Sushi has received a technical disqualification for being very very cooked"
:🐝 vs 🦉 "Owls well that ends well"
:🦔 vs 🧙 "The Wizard didn't do it"

:[All the final bouts remarks, as well as the match ups, the score of votes, and all the other comments coming at the top during each bout can be found below in the round 1 to round 9 sections. They are thus not only a transcript.]

:[Finally at the bottom of the comic below the scroll-able version of the past bouts, there was a link to images of the brackets, beginning with the full long one of all 512 emojis, and the zooming in and out, plus updating with results along the way. The link was a text that explained what the link was for. In the current example the link text, which is link blue, was:]
:Full bracket for today's comic (round 3).

==== Round 1====
{| class="wikitable mw-collapsible mw-collapsed"
|-
! Competitors and score !! Commentary
|-
| 😀 (0) vs 😁 (0)
* Grinning face
* Grinning face with smiling eyes
'''(Tie - unclear how winner was chosen)'''
|
* You do not want to miss the fan favorite 😀. Coming up next!
|-
| 😆 (207) vs '''😅 (251)'''
* Smiling face with open mouth and tightly-closed eyes
* '''Smiling face with open mouth and cold sweat'''
|
* Next up, 😅 and 😆.
* I'm really looking forward to everything we're going to see today.
|-
| 😂 (772) vs '''🤣 (824)'''
* Face with tears of joy
* '''Rolling On the Floor Laughing'''
|
* Oh, this one should be good.
|-
| 🙂 (939) vs '''🙃 (1494)'''
* Slightly smiling face
* '''Upside-down face'''
|
* You do not want to miss the fan favorite 🙂. Coming up next!
* You think this is something, folks, well... we're just getting started.
|-
| 😊 (857) vs '''😉 (1774)'''
* Smiling face with smiling eyes
* '''Winking face'''
|
* They have been attacking each other on social media all week. Next up! It's 😉 vs. 😊.
|-
| '''😇 (1417)''' vs 🥰 (1392)
* '''Smiling face with halo'''
* Smiling face with smiling eyes and three hearts
|
* Welcome back, it's time for 😇 and 🥰 to go head to head.
|-
| '''😍 (2159)''' vs 🤩 (1447)
* '''Smiling face with heart-shaped eyes'''
* Grinning face with star eyes
|
* We will be right back with 😍 vs. 🤩!
|-
| 😗 (1045) vs '''😘 (2595)'''
* Kissing face
* '''Face throwing a kiss'''
|
* They have been attacking each other on social media all week. Next up! It's 😗 vs. 😘.
* This is a day that 😗 has been anticipating for a long time.
|-
| 😚 (1619) vs '''😙 (1770)'''
* Kissing face with closed eyes
* '''Kissing face with smiling eyes'''
|
* Have at it, 😙 and 😚!
* If you are just joining us, fear not! You haven't missed much.
|-
| 😋 (1549) vs '''😛 (2644)'''
* Face savouring delicious food
* '''Face with stuck-out tongue'''
|
* It's time to find out: Who would win in a match, 😋 or 😛?
* 😋 stole that win.
|-
| '''😜 (2302)''' vs 🤪 (2085)
* '''Face with stuck-out tongue and winking eye'''
* Grinning face with one large and one small eye
|
* Next up, 😜 and 🤪.
*😜 didn't do their homework.
|-
| '''😝 (2568)''' vs 🤑 (1372)
* '''Face with stuck-out tongue and tightly-closed eyes'''
* Money-mouth face
|
* Don't change that channel, folks. We have 😝 and 🤑 warming up.
|-
| 🤗 (1598) vs '''🤭 (2316)'''
* Hugging face
* '''Smiling face with smiling eyes and hand covering mouth'''
|
* Next up, 🤗 and 🤭.
* Sometimes miracles happen.
|-
| 🤫 (734) vs '''🤔 (4374)'''
* Face with finger covering closed lips
* '''Thinking face'''
|
* Oh, this one should be good.
|-
| 🤐 (1119) vs '''🤨 (2928)'''
* Zipper-mouth face
* '''Face with one eyebrow raised'''
|
* We will be right back with 🤐 vs. 🤨!
* Not sure which way this one goes.
|-
| 😐 (1506) vs '''😑 (1665)'''
* Neutral face
* '''Expressionless face'''
|
* They have been attacking each other on social media all week. Next up! It's 😐 vs. 😑.
* One for the history books.
|-
| 😶 (2437) vs '''😏 (2659)'''
* Face without mouth
* '''Smirking face'''
|
* It's time to find out: Who would win in a match, 😏 or 😶?
* This one was over before it started.
|-
| 😒 (1562) vs '''🙄 (2692)'''
* Unamused face
* '''Face with rolling eyes'''
|
* If you're like me, you've argued over who would win head-to-head, 😒 or 🙄.
|-
| '''😬 (3345)''' vs 🤥 (1137)
* '''Grimacing face'''
* Lying face
|
* Oh this one should be good.
*No surprises here. 🤥 skates to an easy win.
*I hope everyone has printed their brackets and are ready, because time waits for very few people!
*No surprises here. 😬 skates to an easy win.
|-
| 😌 (1980) vs '''😔 (2238)'''
* Relieved face
* '''Pensive face'''
|
* Next! Who would win in a match between 😌 and 😔? We are about to find out.
* 😔 comes out on top.
|-
| '''😴 (2770)''' vs 🤤 (1957)
* '''Sleeping face'''
* Drooling face
|
* Oh, this one should be good.
*A dominant performance by 😴.
|-
| 😷 (1760) vs '''🤒 (2629)'''
* Face with medical mask
* '''Face with thermometer'''
|
* Welcome back, it's time for 😷 and 🤒 to go head to head.
* In the end, there was nothing 😷 could do to stop the power of 🤒.
|-
| 🤢 (2270) vs '''🤕 (2648)'''
* Nauseated face
* '''Face with head-bandage'''
|
* Next up, 🤕 and 🤢.
* 🤕 stole that win.
|-
| 🤧 (2325) vs '''🤮 (3260)'''
* Sneezing face
* '''Face with open mouth vomiting'''
|
* Will it be 🤧 or 🤮? Find out next after this message from our sponsors.
* 🤮 opened strong and 🤧 never caught up.
|-
| 🥵 (1884) vs '''🥶 (3983)'''
* Overheated face
* '''Freezing face'''
|
* You do not want to miss the fan favorite 🥵. Coming up next!
* I have never seen 🥶 crush an opponent that mercilessly before.
|-
| 😵 (2920) vs '''🥴 (3762)'''
* Dizzy face
* '''Face with uneven eyes and wavy mouth'''
|
* Oh this one should be good.
* That was 😵's to give away and they did.
|-
| 🤯 (3055) vs '''🤠 (3110)'''
* Shocked face with exploding head
* '''Face with cowboy hat'''
|
* They have been attacking each other on social media all week. Next up! It's 🤠 vs. 🤯.
* However this ends up, someone got blown away.
|-
| '''😎 (4316)''' vs 🥳 (2201)
* '''Smiling face with sunglasses'''
* Face with party horn and party hat
|
* On deck, we have 😎 and 🥳.
*I guess it was that kind of a party.
|-
| 😟 (2184) vs '''😕 (3663)'''
* Worried face
* '''Confused face'''
|
* Uh oh. 😟 has had words with 😕 before. The next match will be good.
* 😕 one, 😟 zero.
|-
| ☹ (1638) vs '''😮 (5498)'''
* White frowning face
* '''Face with open mouth'''
|
* Next up, ☹ and 😮.
* I hope everyone has printed their brackets and are ready, because time waits for very few people!
|-
| 😲 (2383) vs '''😯 (3904)'''
* Astonished face
* '''Hushed face'''
|
* Don't change that channel, folks. We have 😯 and 😲 warming up.
* And 😲 falls to 😯. A suprising turn of events.
|-
| 😧 (3063) vs '''😳 (3754)'''
* Anguished face
* '''Flushed face'''
|
* We will be right back with 😧 vs. 😳!
* This one was over before it started.
|-
| 😨 (2082) vs '''😰 (4050)'''
* Fearful face
* '''Face with open mouth and cold sweat'''
|
* Oh, this one should be good.
* Well, this doesn't look good.
|-
| 😢 (2095) vs '''😭 (5108)'''
* Crying face
* '''Loudly crying face'''
|
* Have at it, 😢 and 😭!
* This one's a real tear-jerker.
|-
| 😖 (2039) vs '''😱 (4758)'''
* Confounded face
* '''Face screaming in fear'''
|
* If you're like me, you've argued over who would win head-to-head, 😖 or 😱.
* 😱 stole that win.
|-
| 😞 (2879) vs '''😣 (3528)'''
* Disappointed face
* '''Persevering face'''
|
* Coming to you live from the Emojidome, it's 😞 vs. 😣!
* This one's painful.
|-
| 😩 (2785) vs '''😓 (3231)'''
* Weary face
* '''Face with cold sweat'''
|
* On deck, we have 😓 and 😩.
* It's early yet, folks. The coffee hasn't kicked in.
|-
| 😫 (1827) vs '''😤 (4871)'''
* Tired face
* '''Face with look of triumph'''
|
* Coming to you live from the Emojidome, it's 😤 vs. 😫!
* I didn't remember 😫 qualifying. I think they snuck in.
|-
| 😠 (1866) vs '''😡 (5192)'''
* Angry face
* '''Pouting face'''
|
* Will it be 😠 or 😡? Find out next after this message from our sponsors.
* It is astounding how much competition we have in store for today.
|-
| '''😈 (4225)''' vs 🤬 (3072)
* '''Smiling face with horns'''
* Serious face with symbols covering mouth
|
* Coming to you live from the Emojidome, it's 😈 vs. 🤬!
*Speak of the devil...
|-
| 👿 (2341) vs '''💀 (4739)'''
* Imp
* '''Skull'''
|
* We will be right back with 👿 vs. 💀!
* It has been a long road for 💀 to get to competing on the world stage.
|-
| '''💩 (4829)''' vs 🤡 (2514)
* '''Pile of poo'''
* Clown face
|
* Have at it, 💩 and 🤡!
*I think we all know how this is going to go.
|-
| 👻 (3680) vs '''👽 (3983)'''
* Ghost
* '''Extraterrestrial alien'''
|
* Have at it, 👻 and 👽!
|-
| 🏰 (2715) vs '''👾 (4412)'''
* European castle
* '''Alien monster'''
|
* They have been attacking each other on social media all week. Next up! It's 🏰 vs. 👾.
* 👾 opened strong and 🏰 never caught up.
|-
| 😸 (3334) vs '''😺 (3542)'''
* Grinning cat face with smiling eyes
* '''Smiling cat face with open mouth'''
|
* They have been attacking each other on social media all week. Next up! It's 😸 vs. 😺.
* This one is serious, folks.
|-
| 😹 (2778) vs '''😻 (3702)'''
* Cat face with tears of joy
* '''Smiling cat face with heart-shaped eyes'''
|
* Welcome back, it's time for 😹 and 😻 to go head to head.
* The hearts are my favorite part. It all comes down to love. And that really says something.
|-
| 😽 (1815) vs '''😼 (3991)'''
* Kissing cat face with closed eyes
* '''Cat face with wry smile'''
|
* I'm looking forward to this.
* Sometimes miracles happen.
|-
| 😿 (1189) vs '''🙀 (4682)'''
* Crying cat face
* '''Weary cat face'''
|
* On deck, we have 😿 and 🙀.
|-
| 💋 (2122) vs '''😾 (3837)'''
* Kiss mark
* '''Pouting cat face'''
|
* Oh, this one should be good.
|-
| 💌 (1659) vs '''💖 (3386)'''
* Love letter
* '''Sparkling heart'''
|
* Next! Who would win in a match between 💌 and 💖? We are about to find out.
* 💌 is an fan favorite to go far today.
|-
| '''❤ (3904)''' vs 💔 (1920)
* '''Heavy black heart'''
* Broken heart
|
* Uh oh. 💔 has had words with ❤ before. The next match will be good.
|-
| 🖤 (2940) vs '''💯 (3866)'''
* Black heart
* '''Hundred points symbol'''
|
* It is a battle as old as time itself. 💯 and 🖤! Facing off against each other again!
* A dominant performance by 💯.
|-
| 💥 (3055) vs '''💦 (3843)'''
* Collision symbol
* '''Splashing sweat symbol'''
|
* Welcome back, it's time for 💥 and 💦 to go head to head.
* Like fire and water.
|-
| 🕳 (2476) vs '''💣 (4063)'''
* Hole
* '''Bomb'''
|
* Don't change that channel, folks. We have 💣 and 🕳 warming up.
* This one was a mess.
|-
| 🤞 (2246) vs '''🤘 (4845)'''
* Hand with index and middle fingers crossed
* '''Sign of the horns'''
|
* You do not want to miss the fan favorite 🤘. Coming up next!
* It feels like these early matches are over almost before they begin.
|-
| 👎 (2231) vs '''👍 (5077)'''
* Thumbs down sign
* '''Thumbs up sign'''
|
* Will it be 👍 or 👎? Find out next after this message from our sponsors.
* Nice to see the support for positivity.
|-
| 🙏 (3114) vs '''👊 (4861)'''
* Person with folded hands
* '''Fisted hand sign'''
|
* Have at it, 👊 and 🙏!
* I don't think 🙏 expected to see 👊 opposite them today.
|-
| 💅 (2366) vs '''🦵 (4060)'''
* Nail polish
* '''Leg'''
|
* It's time to find out: Who would win in a match, 💅 or 🦵?
* If 🦵 wins this match, it will be interesting to see how far they can go.
|-
| 🦷 (1409) vs '''🧠 (5821)'''
* Tooth
* '''Brain'''
|
* Oh this one should be good.
|-
| '''👀 (4052)''' vs 🦴 (2198)
* '''Eyes'''
* Bone
|
* Uh oh. 🦴 has had words with 👀 before. The next match will be good.
|-
| 👄 (1712) vs '''👅 (4648)'''
* Mouth
* '''Tongue'''
|
* Don't change that channel, folks. We have 👄 and 👅 warming up.
|-
| 👶 (1414) vs '''🤦 (5666)'''
* Baby
* '''Face palm'''
|
* Uh oh. 🤦 has had words with 👶 before. The next match will be good.
|-
| '''👩‍🔬 (6374)''' vs 🤷 (2385)
* '''Woman + microscope'''
* Shrug
|
* Have at it, 👩‍🔬 and 🤷!
|-
| '''👩‍🚀 (5502)''' vs 🦸 (2302)
* '''Woman + rocket'''
* Superhero
|
* It's time to find out: Who would win in a match, 👩‍🚀 or 🦸?
|-
| 🧚 (1909) vs '''🧙 (6294)'''
* Fairy
* '''Mage'''
|
* Uh oh. 🧚 has had words with 🧙 before. The next match will be good.
* There are some titanic match-ups that could happen today.
* Yes, this is live commentary.
* We have only just started, folks. Stay tuned for more amazing contests!
|-
| 🧜 (3835) vs '''🧛 (3840)'''
* Merperson
* '''Vampire'''
|
* You do not want to miss the fan favorite 🧛. Coming up next!
* Not sure which way this one goes.
|-
| 💆 (2815) vs '''🧟 (3747)'''
* Face massage
* '''Zombie'''
|
* Next up, 💆 and 🧟.
* That's just a typical Monday for you.
|-
| 💇 (3029) vs '''🚶 (3055)'''
* Haircut
* '''Pedestrian'''
|
* We will be right back with 💇 vs. 🚶!
* It's going to be a busy day, folks. Remember to pace yourself.
|-
| 🏃 (2239) vs '''💃 (5833)'''
* Runner
* '''Dancer'''
|
* On deck, we have 🏃 and 💃.
* Make some noise! Show 🏃 and 💃 some love!
* That was 🏃's to give away and they did.
|-
| 🕺 (1990) vs '''🕴 (5035)'''
* Man dancing
* '''Man in business suit levitating'''
|
* We will be right back with 🕴 vs. 🕺!
* I spoke with 🕴 before we started today. They were hoping to dodge 🕺. Too bad for them.
|-
| 🏇 (2563) vs '''🤺 (5157)'''
* Horse racing
* '''Fencer'''
|
* Have at it, 🏇 and 🤺!
* Never bring a sword to a horse fight.
|-
| '''⛷ (4510)''' vs 🏂 (3762)
* '''Skier'''
* Snowboarder
|
* Coming to you live from the Emojidome, it's ⛷ vs. 🏂!
*We have a lot of excited fans in the audience.
|-
| 🏌 (2557) vs '''🏄 (6285)'''
* Golfer
* '''Surfer'''
|
* It's time to find out: Who would win in a match, 🏄 or 🏌?
* Ok! Let's see those hearts!
* I have never seen 🏄 crush an opponent that mercilessly before.
|-
| ⛹ (2793) vs '''🏊 (5994)'''
* Person with ball
* '''Swimmer'''
|
* Have at it, ⛹ and 🏊!
|-
| 🏋 (2300) vs '''🚴 (8063)'''
* Weight lifter
* '''Bicyclist'''
|
* Will it be 🏋 or 🚴? Find out next after this message from our sponsors.
* Right now the crowd is chanting 🏋! 🏋! An early sign of a favorite?
|-
| '''🚵 (5650)''' vs 🤾 (4698)
* '''Mountain bicyclist'''
* Handball
|
* We will be right back with 🚵 vs. 🤾!
*It's neck and neck!
|-
| 👤 (2195) vs '''🛀 (5529)'''
* Bust in silhouette
* '''Bath'''
|
* Don't change that channel, folks. We have 👤 and 🛀 warming up.
|-
| '''🐒 (4644)''' vs 🦍 (3336)
* '''Monkey'''
* Gorilla
|
* Oh, this one should be good.
|-
| 🐕 (3458) vs '''🐶 (4004)'''
* Dog
* '''Dog face'''
|
* You do not want to miss the fan favorite 🐕. Coming up next!
* Mostly a matter of perspective.
|-
| 🐺 (2774) vs '''🦊 (6024)'''
* Wolf face
* '''Fox face'''
|
* Oh, this one should be good.
* Again, small variations make all the difference.
|-
| '''🐱 (4931)''' vs 🦝 (4017)
* '''Cat face'''
* Raccoon
|
* They have been attacking each other on social media all week. Next up! It's 🐱 vs. 🦝.
*🦝 is an fan favorite to go far today.
*🐱 stole that win.
|-
| '''🐈 (5046)''' vs 🦁 (3957)
* '''Cat'''
* Lion face
|
* Don't change that channel, folks. We have 🐈 and 🦁 warming up.
*Again, we are getting a lot of questions on this today. This is live commentary, folks.
*We have a lot of excited fans in the audience.
|-
| 🐆 (2186) vs '''🐅 (6280)'''
* Leopard
* '''Tiger'''
|
* It's time to find out: Who would win in a match, 🐅 or 🐆?
* Stripes or Spots, Stripes or Spots
|-
| 🐴 (3722) vs '''🐎 (4120)'''
* Horse face
* '''Horse'''
|
* Next! Who would win in a match between 🐎 and 🐴? We are about to find out.
* I've got your horse right here.
|-
| 🦓 (3486) vs '''🦄 (6830)'''
* Zebra face
* '''Unicorn face'''
|
* Next! Who would win in a match between 🦄 and 🦓? We are about to find out.
* I think we all know how this is going to go.
* It was neck and neck until the very end, but some necks are longer than others.
|-
| 🐮 (3658) vs '''🦌 (5111)'''
* Cow face
* '''Deer'''
|
* Uh oh. 🦌 has had words with 🐮 before. The next match will be good.
* This is a close one!
|-
| 🐖 (3568) vs '''🐷 (5175)'''
* Pig
* '''Pig face'''
|
* You do not want to miss the fan favorite 🐖. Coming up next!
* Who will bring home the bacon?
|-
| 🐗 (2576) vs '''🐏 (6073)'''
* Boar
* '''Ram'''
|
* It's time to find out: Who would win in a match, 🐏 or 🐗?
|-
| 🐪 (3329) vs '''🐐 (5304)'''
* Dromedary camel
* '''Goat'''
|
* It's time to find out: Who would win in a match, 🐐 or 🐪?
|-
| 🦙 (4397) vs '''🦒 (5164)'''
* Llama
* '''Giraffe face'''
|
* Uh oh. 🦙 has had words with 🦒 before. The next match will be good.
* It's neck and neck!
* I hope 🦙 comes back next year. It would be a sham to see it all end like this.
|-
| '''🐘 (4809)''' vs 🦏 (3804)
* '''Elephant'''
* Rhinoceros
|
* It's time to find out: Who would win in a match, 🐘 or 🦏?
*We'll never forget this.
|-
| 🐁 (4039) vs '''🦛 (4085)'''
* Mouse
* '''Hippopotamus'''
|
* It's time to find out: Who would win in a match, 🐁 or 🦛?
|-
| 🐀 (2994) vs '''🐹 (4580)'''
* Rat
* '''Hamster face'''
|
* Will it be 🐀 or 🐹? Find out next after this message from our sponsors.
* Today is also about settling scores, there is no doubt about that for some of our contestants.
|-
| 🐰 (1865) vs '''🐿 (5175)'''
* Rabbit face
* '''Chipmunk'''
|
* If you're like me, you've argued over who would win head-to-head, 🐰 or 🐿.
* Its about reflexes.
|-
| 🦇 (3648) vs '''🦔 (4507)'''
* Bat
* '''Hedgehog'''
|
* They have been attacking each other on social media all week. Next up! It's 🦇 vs. 🦔.
* This one is a toss-up in my book, folks.
|-
| 🐻 (2686) vs '''🐨 (5059)'''
* Bear face
* '''Koala'''
|
* Coming to you live from the Emojidome, it's 🐨 vs. 🐻!
* Ok! You know what to do! Let's see those hearts!
|-
| 🐼 (2896) vs '''🦘 (5185)'''
* Panda face
* '''Kangaroo'''
|
* Next! Who would win in a match between 🐼 and 🦘? We are about to find out.
* It's exciting to look around and see so many joining us from all over the world.
* One for the history books.
|-
| 🦃 (2553) vs '''🦡 (5483)'''
* Turkey
* '''Badger'''
|
* It is a battle as old as time itself. 🦃 and 🦡! Facing off against each other again!
* That was a stinker of a battle, if you ask me.
|-
| 🐓 (2883) vs '''🐣 (5153)'''
* Rooster
* '''Hatching chick'''
|
* Welcome back, it's time for 🐓 and 🐣 to go head to head.
|-
| 🕊 (2432) vs '''🐧 (5951)'''
* Dove of peace
* '''Penguin'''
|
* We will be right back with 🐧 vs. 🕊!
|-
| 🦅 (3871) vs '''🦆 (4800)'''
* Eagle
* '''Duck'''
|
* Uh oh. 🦆 has had words with 🦅 before. The next match will be good.
|-
| 🦢 (1613) vs '''🦉 (7025)'''
* Swan
* '''Owl'''
|
* They have been attacking each other on social media all week. Next up! It's 🦉 vs. 🦢.
* 🦉 didn't do their homework.
* I hope everyone has printed their brackets and are ready, because time waits for very few people!
* Yes, this is live commentary.
* 🦉 one, 🦢 zero.
|-
| 🦚 (4333) vs '''🦜 (4803)'''
* Peacock
* '''Parrot'''
|
* Oh, this one should be good.
* I know some very invested audience members for this one.
|-
| 🐊 (3986) vs '''🐢 (6403)'''
* Crocodile
* '''Turtle'''
|
* I'm looking forward to this.
|-
| '''🐍 (5378)''' vs 🦎 (4415)
* '''Snake'''
* Lizard
|
* Have at it, 🐍 and 🦎!
*In the end, there was nothing 🐍 could do to stop the power of 🦎.
*Did you just see that!?
*Plenty of matches left to see. Don't go anywhere.
|-
| '''🐉 (5359)''' vs 🦕 (4855)
* '''Dragon'''
* Sauropod
|
* Have at it, 🐉 and 🦕!
*One for the history books.
|-
| '''🐳 (5445)''' vs 🦖 (5411)
* '''Spouting whale'''
* T-rex
|
* I'm looking forward to this.
*Again, another difficult match-up for our audience.
|-
| 🐟 (1639) vs '''🐬 (8071)'''
* Fish
* '''Dolphin'''
|
* Will it be 🐟 or 🐬? Find out next after this message from our sponsors.
* I know which one I would choose, but I don't have time to vote!
|-
| 🐡 (2307) vs '''🦈 (6544)'''
* Blowfish
* '''Shark'''
|
* Have at it, 🐡 and 🦈!
* 🦈 opened strong and 🐡 never caught up.
|-
| 🐚 (1590) vs '''🐙 (8224)'''
* Spiral shell
* '''Octopus'''
|
* They have been attacking each other on social media all week. Next up! It's 🐙 vs. 🐚.
* This one was over before it started.
|-
| 🐌 (4816) vs '''🦋 (4835)'''
* Snail
* '''Butterfly'''
|
* We will be right back with 🐌 vs. 🦋!
* The hearts are flying on this one!
|-
| 🐜 (3194) vs '''🐛 (5132)'''
* Ant
* '''Bug'''
|
* I'm looking forward to this.
* 🐜 didn't do their homework.
|-
| 🐞 (3561) vs '''🐝 (5804)'''
* Lady beetle
* '''Honeybee'''
|
* On deck, we have 🐝 and 🐞.
* This one is a true test of the audience today.
* Will luck be a ladybug tonight?
* Amazing!
|-
| '''🕷 (4806)''' vs 🦗 (4195)
* '''Spider'''
* Cricket
|
* Uh oh. 🦗 has had words with 🕷 before. The next match will be good.
*And 🦗 falls to 🕷. A suprising turn of events.
|-
| 🦂 (3853) vs '''🦠 (4971)'''
* Scorpion
* '''Microbe'''
|
* Next! Who would win in a match between 🦂 and 🦠? We are about to find out.
* Nope. Nope nope nope nope.
|-
| 🌷 (3767) vs '''🌻 (4374)'''
* Tulip
* '''Sunflower'''
|
* We will be right back with 🌷 vs. 🌻!
* Now that's more like it.
|-
| 🌳 (1973) vs '''🌲 (6563)'''
* Deciduous tree
* '''Evergreen tree'''
|
* If you're like me, you've argued over who would win head-to-head, 🌲 or 🌳.
* Who would have thought, eh?
|-
| 🌴 (3876) vs '''🌵 (5468)'''
* Palm tree
* '''Cactus'''
|
* Oh, this one should be good.
* In the end, there was nothing 🌴 could do to stop the power of 🌵.
|-
| 🍈 (2617) vs '''🍇 (5319)'''
* Melon
* '''Grapes'''
|
* It's time to find out: Who would win in a match, 🍇 or 🍈?
* Folks, I am just as stunned at the outcome as you.
|-
| 🍋 (4186) vs '''🍉 (4720)'''
* Lemon
* '''Watermelon'''
|
* They have been attacking each other on social media all week. Next up! It's 🍉 vs. 🍋.
* I just don't know why they can't find common ground.
* 🍉 one, 🍋 zero.
|-
| 🍌 (4704) vs '''🍍 (5525)'''
* Banana
* '''Pineapple'''
|
* Don't change that channel, folks. We have 🍌 and 🍍 warming up.
* Ok! Let's see those hearts!
* I guess it was that kind of a party.
|-
| '''🍎 (5111)''' vs 🥭 (3830)
* '''Red apple'''
* Mango
|
* I'm looking forward to this.
|-
| 🍏 (2703) vs '''🍓 (6403)'''
* Green apple
* '''Strawberry'''
|
* It's time to find out: Who would win in a match, 🍏 or 🍓?
* We might be close to some matches the audience is expecting or hoping to see today.
* Berry nice!
|-
| 🍅 (3002) vs '''🥝 (5348)'''
* Tomato
* '''Kiwifruit'''
|
* They have been attacking each other on social media all week. Next up! It's 🍅 vs. 🥝.
|-
| 🥥 (3840) vs '''🥑 (5759)'''
* Coconut
* '''Avocado'''
|
* On deck, we have 🥑 and 🥥.
* Somehow, someone will blame millenials for this.
|-
| 🥕 (4577) vs '''🥔 (4620)'''
* Carrot
* '''Potato'''
|
* Next! Who would win in a match between 🥔 and 🥕? We are about to find out.
* Ahhh the age old question, 🥕 or 🥔.
|-
| 🌽 (4074) vs '''🌶 (5087)'''
* Ear of maize
* '''Hot pepper'''
|
* Have at it, 🌶 and 🌽!
|-
| 🥬 (2694) vs '''🥒 (5472)'''
* Leafy green
* '''Cucumber'''
|
* You do not want to miss the fan favorite 🥒. Coming up next!
* Not sure which way this one goes.
|-
| '''🍄 (5850)''' vs 🥦 (2707)
* '''Mushroom'''
* Broccoli
|
* Will it be 🍄 or 🥦? Find out next after this message from our sponsors.
*Folks, we are nearly halfway through the first bracket!
*Again, we are getting a lot of questions on this today. This is live commentary, folks.
*Into the second half of the first round.
*That was 🥦's to give away and they did.
|-
| 🌰 (2698) vs '''🥜 (6225)'''
* Chestnut
* '''Peanuts'''
|
* It's time to find out: Who would win in a match, 🌰 or 🥜?
* I am not even sure what I am looking at here.
|-
| 🍞 (2934) vs '''🥐 (6465)'''
* Bread
* '''Croissant'''
|
* They have been attacking each other on social media all week. Next up! It's 🍞 vs. 🥐.
* Well, I know who I would vote for.
|-
| 🥖 (4800) vs '''🥨 (5136)'''
* Baguette bread
* '''Pretzel'''
|
* We will be right back with 🥖 vs. 🥨!
|-
| 🥯 (2470) vs '''🥞 (5926)'''
* Bagel
* '''Pancakes'''
|
* Uh oh. 🥯 has had words with 🥞 before. The next match will be good.
* Now I am just hungry.
|-
| 🥩 (3959) vs '''🧀 (6225)'''
* Cut of meat
* '''Cheese wedge'''
|
* Oh this one should be good.
* Truly a battle for the ages.
|-
| 🍟 (3719) vs '''🍔 (5352)'''
* French fries
* '''Hamburger'''
|
* Don't change that channel, folks. We have 🍔 and 🍟 warming up.
|-
| 🌭 (1340) vs '''🍕 (7881)'''
* Hot dog
* '''Slice of pizza'''
|
* If you're like me, you've argued over who would win head-to-head, 🌭 or 🍕.
|-
| '''🌮 (6417)''' vs 🥪 (2869)
* '''Taco'''
* Sandwich
|
* It's time to find out: Who would win in a match, 🌮 or 🥪?
*I'll be honest, even I voted in that last one.
*There are some titanic match-ups that could happen today.
*One for the history books.
|-
| '''🌯 (5359)''' vs 🥚 (3868)
* '''Burrito'''
* Egg
|
* It's time to find out: Who would win in a match, 🌯 or 🥚?
*🥚 is an fan favorite to go far today.
*One for the history books.
|-
| '''🍳 (5293)''' vs 🥗 (3101)
* '''Cooking'''
* Green salad
|
* Have at it, 🍳 and 🥗!
*There can be very food-centric history books.
*If 🍳 wins this match, it will be interesting to see how far they can go.
|-
| '''🍿 (2640)''' vs 🧂 (2067)
* '''Popcorn'''
* Salt shaker
|
* Oh, this one should be good.
*This one was over before it started.
|-
| '''🍱 (4931)''' vs 🥫 (1948)
* '''Bento box'''
* Canned food
|
* They have been attacking each other on social media all week. Next up! It's 🍱 vs. 🥫.
*It is early still. Possibly too early to predict an over-all winner. But I am hearing 🏇 mentioned a fair bit.
*And 🥫 falls to 🍱. A suprising turn of events.
|-
| 🍤 (2334) vs '''🍣 (5552)'''
* Fried shrimp
* '''Sushi'''
|
* They have been attacking each other on social media all week. Next up! It's 🍣 vs. 🍤.
* Plenty of matches left to see. Don't go anywhere.
|-
| 🥡 (3101) vs '''🥟 (4128)'''
* Takeout box
* '''Dumpling'''
|
* They have been attacking each other on social media all week. Next up! It's 🥟 vs. 🥡.
* 🥟 one, 🥡 zero.
|-
| 🦀 (3762) vs '''🦞 (4739)'''
* Crab
* '''Lobster'''
|
* Coming to you live from the Emojidome, it's 🦀 vs. 🦞!
|-
| 🦐 (2421) vs '''🦑 (6162)'''
* Shrimp
* '''Squid'''
|
* Will it be 🦐 or 🦑? Find out next after this message from our sponsors.
|-
| 🍦 (3804) vs '''🍨 (4698)'''
* Soft ice cream
* '''Ice cream'''
|
* If you're like me, you've argued over who would win head-to-head, 🍦 or 🍨.
|-
| 🍪 (3722) vs '''🍩 (5167)'''
* Cookie
* '''Doughnut'''
|
* We will be right back with 🍩 vs. 🍪!
|-
| 🎂 (3658) vs 🧁 (3658)
* Birthday cake
* Cupcake '''(Tie - unclear how winner was chosen)'''
|
* Next up, 🎂 and 🧁.
|-
| 🍬 (1244) vs '''🍫 (6674)'''
* Candy
* '''Chocolate bar'''
|
* We will be right back with 🍫 vs. 🍬!
|-
| 🍭 (2568) vs '''🍯 (5445)'''
* Lollipop
* '''Honey pot'''
|
* It's time to find out: Who would win in a match, 🍭 or 🍯?
* Thank you for tuning in. I promise you are in for a treat today.
|-
| 🍼 (1824) vs '''🥛 (5239)'''
* Baby bottle
* '''Glass of milk'''
|
* Will it be 🍼 or 🥛? Find out next after this message from our sponsors.
|-
| '''☕ (4813)''' vs 🍾 (3227)
* '''Hot beverage'''
* Bottle with popping cork
|
* If you're like me, you've argued over who would win head-to-head, ☕ or 🍾.
*Time to get another feel for our audience today.
|-
| 🍷 (3021) vs '''🍹 (3561)'''
* Wine glass
* '''Tropical drink'''
|
* It is a battle as old as time itself. 🍷 and 🍹! Facing off against each other again!
* Well now I am just getting thirsty.
|-
| '''🍺 (5763)''' vs 🥤 (3897)
* '''Beer mug'''
* Cup with straw
|
* Will it be 🍺 or 🥤? Find out next after this message from our sponsors.
*Still thirsty!
|-
| 🍴 (3917) vs '''🥢 (4348)'''
* Fork and knife
* '''Chopsticks'''
|
* We will be right back with 🍴 vs. 🥢!
* I know which one I would choose, but I don't have time to vote!
|-
| '''🔪 (5627)''' vs 🥄 (1742)
* '''Hocho'''
* Spoon
|
* Have at it, 🔪 and 🥄!
|-
| 🏺 (2604) vs '''🧭 (4784)'''
* Amphora
* '''Compass'''
|
* Don't change that channel, folks. We have 🏺 and 🧭 warming up.
* You just know that 🏺 is thinking about 🏎 right now.
|-
| ⛰ (1843) vs '''🌋 (6793)'''
* Mountain
* '''Volcano'''
|
* You do not want to miss the fan favorite ⛰. Coming up next!
* This one was over before it started.
|-
| 🏖 (3159) vs '''🏕 (5611)'''
* Beach with umbrella
* '''Camping'''
|
* Welcome back, it's time for 🏕 and 🏖 to go head to head.
* Time to pick your poison!
|-
| 🏟 (2537) vs '''🏝 (6180)'''
* Stadium
* '''Desert island'''
|
* I'm looking forward to this.
|-
| '''🏗 (4093)''' vs 🧱 (3680)
* '''Building construction'''
* Brick
|
* Oh this one should be good.
*What an amazing display of prowess from 🏗.
|-
| 🏢 (2178) vs '''🏠 (5829)'''
* Office building
* '''House building'''
|
* Oh, this one should be good.
* 🏠 has every reason to be concerned about this match-up.
|-
| 🏨 (1367) vs '''🏥 (5326)'''
* Hotel
* '''Hospital'''
|
* Next! Who would win in a match between 🏥 and 🏨? We are about to find out.
* is $6,000,000 of one and Six million of the other, am I right?
|-
| 🏪 (3114) vs '''🗽 (4875)'''
* Convenience store
* '''Statue of liberty'''
|
* It is a battle as old as time itself. 🏪 and 🗽! Facing off against each other again!
|-
| '''⛲ (4296)''' vs ⛺ (3483)
* '''Fountain'''
* Tent
|
* Don't change that channel, folks. We have ⛲ and ⛺ warming up.
*If you look away for a moment, you may miss your chance to send ⛺ into the later rounds.
|-
| 🌁 (3488) vs '''🌃 (4354)'''
* Foggy
* '''Night with stars'''
|
* I'm looking forward to this.
|-
| 🏙 (2396) vs '''🌅 (6055)'''
* Cityscape
* '''Sunrise'''
|
* Next up, 🌅 and 🏙.
* 🏙 is fully committed to this match.
|-
| 🎠 (3307) vs '''🎡 (4648)'''
* Carousel horse
* '''Ferris wheel'''
|
* It's time to find out: Who would win in a match, 🎠 or 🎡?
* Oh no. 🎠 fans are not going to like this match-up.
|-
| '''🎢 (5854)''' vs 💈 (2137)
* '''Roller coaster'''
* Barber pole
|
* Next up, 🎢 and 💈.
*This one will be filled with twists and turns!
|-
| 🚂 (3915) vs '''🚄 (4826)'''
* Steam locomotive
* '''High-speed train'''
|
* They have been attacking each other on social media all week. Next up! It's 🚂 vs. 🚄.
* The future waits on no one. Let's see those hearts!
|-
| 🚇 (3395) vs '''🚝 (4881)'''
* Metro
* '''Monorail'''
|
* Coming to you live from the Emojidome, it's 🚇 vs. 🚝!
* On the other hand, time and space are a matter of perspective, right?
* I guess it was that kind of a party.
|-
| 🚌 (2412) vs '''🚑 (5363)'''
* Bus
* '''Ambulance'''
|
* They have been attacking each other on social media all week. Next up! It's 🚌 vs. 🚑.
* Uh oh, that can't be good for 🚌.
|-
| 🚓 (2703) vs '''🚒 (6746)'''
* Police car
* '''Fire engine'''
|
* Oh, this one should be good.
* Uh oh, that can't be good for 🚓.
* This is a classic struggle.
|-
| 🚕 (3400) vs '''🚗 (3794)'''
* Taxi
* '''Automobile'''
|
* Don't change that channel, folks. We have 🚕 and 🚗 warming up.
* Well that's certainly something.
|-
| 🚘 (2922) vs '''🚜 (5363)'''
* Oncoming automobile
* '''Tractor'''
|
* Next up, 🚘 and 🚜.
* This one is a real nail biter!
* If 🚘 falls today, we might start hearing serious conversations about retirement.
|-
| 🏎 (3103) vs '''🛵 (4839)'''
* Racing car
* '''Motor scooter'''
|
* Don't change that channel, folks. We have 🏎 and 🛵 warming up.
* Well this is just fan service. And I am ok with it.
|-
| 🛴 (2103) vs '''🚲 (6970)'''
* Scooter
* '''Bicycle'''
|
* Next! Who would win in a match between 🚲 and 🛴? We are about to find out.
* Frankly, I don't think anyone saw this coming.
|-
| 🛢 (3474) vs '''🛹 (4780)'''
* Oil drum
* '''Skateboard'''
|
* Next! Who would win in a match between 🛢 and 🛹? We are about to find out.
* And 🛢 falls to 🛹. A suprising turn of events.
|-
| '''⚓ (4816)''' vs 🚨 (2389)
* '''Anchor'''
* Police cars revolving light
|
* Welcome back, it's time for ⚓ and 🚨 to go head to head.
*Just to stress this again. Live commentary, folks. Completely unscripted and coming in hot.
*This one is a true test of the audience today.
|-
| '''⛵ (4941)''' vs 🚢 (2877)
* '''Sailboat'''
* Ship
|
* Coming to you live from the Emojidome, it's ⛵ vs. 🚢!
*SAIL!
|-
| 💺 (1776) vs '''🛩 (5947)'''
* Seat
* '''Small airplane'''
|
* You do not want to miss the fan favorite 💺. Coming up next!
|-
| 🚡 (3729) vs '''🚁 (4148)'''
* Aerial tramway
* '''Helicopter'''
|
* If you're like me, you've argued over who would win head-to-head, 🚁 or 🚡.
* Sometimes miracles happen.
* Plenty of matches left to see. Don't go anywhere.
|-
| 🛰 (3655) vs '''🚀 (4861)'''
* Satellite
* '''Rocket'''
|
* Welcome back, it's time for 🚀 and 🛰 to go head to head.
* 🛰 and 🚀 have been friends for a long time. I am not sure where that relationship is going to be after today.
|-
| ⏳ (3021) vs '''🛸 (5203)'''
* Hourglass with flowing sand
* '''Flying saucer'''
|
* It's time to find out: Who would win in a match, ⏳ or 🛸?
* This one is serious, folks.
|-
| '''⌚ (4462)''' vs ⏰ (3619)
* '''Watch'''
* Alarm clock
|
* You do not want to miss the fan favorite ⌚. Coming up next!
*If you believe in ⏰, now is the time to clap or whatever, because it is not looking good.
*If you believe in ⏰, now is the time to clap or whatever, because it is not looking good.
|-
| 🌕 (3690) vs '''🌒 (4145)'''
* Full moon symbol
* '''Waxing crescent moon symbol'''
|
* You do not want to miss the fan favorite 🌒. Coming up next!
* What a shocking result!
|-
| 🌡 (2829) vs '''🌙 (4432)'''
* Thermometer
* '''Crescent moon'''
|
* It is a battle as old as time itself. 🌙 and 🌡! Facing off against each other again!
|-
| 🌝 (3559) vs '''🌞 (3871)'''
* Full moon with face
* '''Sun with face'''
|
* You do not want to miss the fan favorite 🌝. Coming up next!
|-
| ⭐ (2063) vs '''🌌 (5731)'''
* White medium star
* '''Milky way'''
|
* Uh oh. 🌌 has had words with ⭐ before. The next match will be good.
|-
| '''⛈ (5487)''' vs 🌦 (1983)
* '''Thunder butt and rain'''
* White sun behind butt with rain
|
* Don't change that channel, folks. We have ⛈ and 🌦 warming up.
*And 🌦 falls to ⛈. A suprising turn of events.
|-
| 🌨 (3646) vs '''🌪 (4139)'''
* Butt with snow
* '''Butt with tornado'''
|
* It is a battle as old as time itself. 🌨 and 🌪! Facing off against each other again!
* Folks, I am just as stunned at the outcome as you.
|-
| 🌀 (3034) vs '''🌈 (7070)'''
* Cyclone
* '''Rainbow'''
|
* Next! Who would win in a match between 🌀 and 🌈? We are about to find out.
|-
| ☂ (2117) vs '''⚡ (5125)'''
* Umbrella
* '''High voltage sign'''
|
* You do not want to miss the fan favorite ☂. Coming up next!
|-
| '''☄ (4988)''' vs ⛄ (2602)
* '''Comet'''
* Snowman without snow
|
* They have been attacking each other on social media all week. Next up! It's ☄ vs. ⛄.
*Another curious match-up with significant implications on how the rest of the day will go.
|-
| 🌊 (3356) vs '''🔥 (5286)'''
* Water wave
* '''Fire'''
|
* Oh, this one should be good.
* I am not sure if 🌊 was prepared for today.
|-
| 🎆 (3284) vs '''🎃 (4418)'''
* Fireworks
* '''Jack-o-lantern'''
|
* If you're like me, you've argued over who would win head-to-head, 🎃 or 🎆.
* This is a mystery.
|-
| 🎇 (2770) vs '''🧨 (4066)'''
* Firework sparkler
* '''Firecracker'''
|
* Coming to you live from the Emojidome, it's 🎇 vs. 🧨!
* Get ready for an explosive result!
|-
| 🎈 (2619) vs '''🎉 (4673)'''
* Balloon
* '''Party popper'''
|
* I'm looking forward to this.
* I guess it was that kind of a party.
|-
| 🎊 (2250) vs '''🎁 (4203)'''
* Confetti ball
* '''Wrapped present'''
|
* Welcome back, it's time for 🎁 and 🎊 to go head to head.
* This one was a mess.
|-
| 🎟 (2054) vs '''🏆 (4558)'''
* Admission tickets
* '''Trophy'''
|
* Don't change that channel, folks. We have 🎟 and 🏆 warming up.
* Truly a dizzying win.
|-
| ⚽ (3116) vs '''🏅 (4383)'''
* Soccer ball
* '''Sports medal'''
|
* Have at it, ⚽ and 🏅!
* A dominant performance by 🏅.
|-
| '''⚾ (5479)''' vs 🥎 (2335)
* '''Baseball'''
* Softball
|
* Uh oh. 🥎 has had words with ⚾ before. The next match will be good.
*Uhhhh. I can't tell the difference here, can you?
|-
| 🏐 (3742) vs '''🏀 (4148)'''
* Volleyball
* '''Basketball and hoop'''
|
* Oh this one should be good.
* The ball is round, everything else is negotiable.
|-
| 🏈 (2932) vs '''🎾 (6003)'''
* American football
* '''Tennis racquet and ball'''
|
* Next up, 🎾 and 🏈.
* The ball is round ...er .... well .... uh.
|-
| 🎳 (4071) vs '''🥏 (4561)'''
* Bowling
* '''Flying disc'''
|
* We will be right back with 🎳 vs. 🥏!
* I had BOWLING BALL in my March Madness bracket. I did not do well.
* Ok. Now this is just ridiculous.
|-
| 🏑 (2742) vs '''🏏 (3810)'''
* Field hockey stick and ball
* '''Cricket bat and ball'''
|
* We will be right back with 🏏 vs. 🏑!
|-
| '''🏒 (5926)''' vs 🥍 (2291)
* '''Ice hockey stick and puck'''
* Lacrosse stick and ball
|
* Oh this one should be good.
*Floor stick vs. sky stick—who will win?
|-
| '''🏓 (5858)''' vs 🥊 (2203)
* '''Table tennis paddle and ball'''
* Boxing glove
|
* Coming to you live from the Emojidome, it's 🏓 vs. 🥊!
|-
| ⛸ (2465) vs '''🛷 (4552)'''
* Ice skate
* '''Sled'''
|
* They have been attacking each other on social media all week. Next up! It's ⛸ vs. 🛷.
* Foot sled vs. regular sled!
|-
| 🎯 (1539) vs '''🥌 (1873)'''
* Direct hit
* '''Curling stone'''
|
* Next! Who would win in a match between 🎯 and 🥌? We are about to find out.
|-
| '''🎮 (6798)''' vs 🔮 (2657)
* '''Video game'''
* Crystal ball
|
* Oh, this one should be good.
|-
| 🎭 (2137) vs '''🎲 (4868)'''
* Performing arts
* '''Game die'''
|
* If you're like me, you've argued over who would win head-to-head, 🎭 or 🎲.
|-
| '''🎨 (4172)''' vs 🧶 (2994)
* '''Artist palette'''
* Ball of yarn
|
* Uh oh. 🧶 has had words with 🎨 before. The next match will be good.
*A lot of cats clicking on screens right now.
|-
| '''👓 (4206)''' vs 🥽 (3986)
* '''Eyeglasses'''
* Goggles
|
* Have at it, 👓 and 🥽!
*Glasses vs. Science Glasses!
|-
| 👛 (1029) vs '''🧦 (5468)'''
* Purse
* '''Socks'''
|
* Have at it, 👛 and 🧦!
|-
| '''🎒 (3516)''' vs 👟 (2756)
* '''School satchel'''
* Athletic shoe
|
* Don't change that channel, folks. We have 🎒 and 👟 warming up.
*Time for school! Which one will you bring?
|-
| 👠 (1627) vs '''👑 (5203)'''
* High-heeled shoe
* '''Crown'''
|
* Oh this one should be good.
|-
| '''🎩 (5611)''' vs 💄 (1719)
* '''Top hat'''
* Lipstick
|
* They have been attacking each other on social media all week. Next up! It's 🎩 vs. 💄.
*The fanciest matchup!
|-
| 💍 (1284) vs '''💎 (5973)'''
* Ring
* '''Gem stone'''
|
* Will it be 💍 or 💎? Find out next after this message from our sponsors.
* If you like the one on the right, put a ring on it!
|-
| 🎤 (1728) vs '''🎵 (5239)'''
* Microphone
* '''Musical note'''
|
* On deck, we have 🎤 and 🎵.
* :notes::notes::notes:
* Music!
|-
| '''🎷 (4934)''' vs 📻 (2021)
* '''Saxophone'''
* Radio
|
* Don't change that channel, folks. We have 🎷 and 📻 warming up.
*The radio and the saxophone are having a music fight. Who can be louder?
|-
| 🎺 (3427) vs '''🎸 (4388)'''
* Trumpet
* '''Guitar'''
|
* Uh oh. 🎺 has had words with 🎸 before. The next match will be good.
* Truly, this is a day that will live in the memories of everyone here.
|-
| '''🎻 (4450)''' vs 🥁 (2857)
* '''Violin'''
* Drum with drumsticks
|
* They have been attacking each other on social media all week. Next up! It's 🎻 vs. 🥁.
*You can hit either one with drumsticks, technically.
|-
| 📱 (3837) vs '''📞 (3980)'''
* Mobile phone
* '''Telephone receiver'''
|
* They have been attacking each other on social media all week. Next up! It's 📞 vs. 📱.
* 📞 is fully committed to this match.
|-
| 📠 (2877) vs '''📟 (3262)'''
* Fax machine
* '''Pager'''
|
* Uh oh. 📠 has had words with 📟 before. The next match will be good.
* This one is a toss-up in my book, folks.
* Only 15% of the people voting recognize either of these antique devices.
|-
| 🔋 (2676) vs '''💻 (4418)'''
* Battery
* '''Personal computer'''
|
* Oh this one should be good.
* I spoke with 💻 before the match today, and they had this to say: 💻.
* Sparks fly!
|-
| '''⌨ (5293)''' vs 🖨 (1909)
* '''Keyboard'''
* Printer
|
* Oh, this one should be good.
*A keyboard is just a reverse printer.
|-
| 🖱 (2661) vs '''💾 (6308)'''
* Three button mouse
* '''Floppy disk'''
|
* I'm looking forward to this.
* Yes, this is live commentary.
* This one is a mystery to me, folks.
|-
| 📀 (2585) vs '''🧮 (5282)'''
* Dvd
* '''Abacus'''
|
* Will it be 📀 or 🧮? Find out next after this message from our sponsors.
|-
| 📺 (2752) vs '''📷 (4543)'''
* Television
* '''Camera'''
|
* Next up, 📷 and 📺.
* 📷 certainly has its work cut out for it going up agaist 📺.
* The camera comes with a tiny TV on the back, which hardly seems fair.
|-
| 📼 (3648) vs '''🔎 (3663)'''
* Videocassette
* '''Right-pointing magnifying glass'''
|
* It's time to find out: Who would win in a match, 📼 or 🔎?
* 🔎 has every reason to be concerned about this match-up.
* These two can combine for a very unsatisfying movie-watching experience.
|-
| 🕯 (3910) vs '''💡 (4178)'''
* Candle
* '''Electric light bulb'''
|
* Welcome back, it's time for 💡 and 🕯 to go head to head.
* I'm so happy to see 💡 here, after 🧠 didn't make it.
* Some would argue this one was settled in the 1800s.
|-
| 🔦 (1663) vs '''📚 (5960)'''
* Electric torch
* '''Books'''
|
* It is a battle as old as time itself. 📚 and 🔦! Facing off against each other again!
* The flashlight illuminates the pages, but it only makes the books stronger!
|-
| 📰 (2524) vs '''📜 (5491)'''
* Newspaper
* '''Scroll'''
|
* You do not want to miss the fan favorite 📜. Coming up next!
* I thought we had seen everything, but look at 📜 go! Amazing!
* A faceoff between two types of ancient scrolls.
|-
| 💳 (2655) vs '''💰 (5595)'''
* Credit card
* '''Money bag'''
|
* It is a battle as old as time itself. 💰 and 💳! Facing off against each other again!
|-
| 📬 (3218) vs '''📦 (3350)'''
* Open mailbox with raised flag
* '''Package'''
|
* Don't change that channel, folks. We have 📦 and 📬 warming up.
* Will the package fit in the mailbox? Vote now!
|-
| 🗳 (2403) vs '''🖋 (4691)'''
* Ballot box with ballot
* '''Lower left fountain pen'''
|
* Welcome back, it's time for 🖋 and 🗳 to go head to head.
* The winner of this bout will go on to face The Sword.
* The winner of this bout will go on to face The Sword. Who’s mightier?
|-
| 🖌 (3530) vs '''🖍 (3897)'''
* Lower left paintbrush
* '''Lower left crayon'''
|
* It is a battle as old as time itself. 🖌 and 🖍! Facing off against each other again!
* If 🖍 falls today, we might start hearing serious conversations about retirement.
* Paintbrush (hard mode) vs. Paintbrush (easy mode)
|-
| 💼 (2264) vs '''📅 (3884)'''
* Briefcase
* '''Calendar'''
|
* Oh, this one should be good.
* You have to wonder if 💼 even wanted to be here today.
|-
| 🗒 (2430) vs '''📊 (4726)'''
* Spiral note pad
* '''Bar chart'''
|
* They have been attacking each other on social media all week. Next up! It's 📊 vs. 🗒.
* *checks notes* Yikes.
|-
| 📌 (2799) vs '''📎 (4796)'''
* Pushpin
* '''Paperclip'''
|
* Uh oh. 📎 has had words with 📌 before. The next match will be good.
* I am excited about this match. This might be my favorite early match so far.
|-
| '''✂ (3762)''' vs 🗑 (2409)
* '''Black scissors'''
* Wastebasket
|
* We will be right back with ✂ vs. 🗑!
*This is a day that ✂ has been anticipating for a long time.
|-
| 🔒 (2827) vs '''🗝 (5214)'''
* Lock
* '''Old key'''
|
* Oh this one should be good.
* Finally, an answer to the classic question.
|-
| 🔨 (3350) vs '''🗡 (5042)'''
* Hammer
* '''Dagger knife'''
|
* Oh, this one should be good.
* Between the two of these, you can cover almost any home improvement situation.
|-
| '''⚔ (5352)''' vs 🔫 (3734)
* '''Crossed swords'''
* Pistol
|
* I'm looking forward to this.
*Pew pew pew!
*[sword noises]
|-
| '''🏹 (4931)''' vs 🛡 (2629)
* '''Bow and arrow'''
* Shield
|
* Coming to you live from the Emojidome, it's 🏹 vs. 🛡!
*Where is the Master Sword when you need it?
*In this match, we see Legolas take on Captain America.
|-
| 🗜 (3393) vs '''🔧 (3481)'''
* Compression
* '''Wrench'''
|
* Don't change that channel, folks. We have 🔧 and 🗜 warming up.
* [drops pretense of impartiality] VOTE C clamp!
|-
| '''⚖ (4961)''' vs 🧰 (1868)
* '''Scales'''
* Toolbox
|
* Coming to you live from the Emojidome, it's ⚖ vs. 🧰!
*I know some of you out there had a challenging commute. Hopefully today's matches will improve your day.
*If there’s any justice in the world, the one on the left will win.
|-
| 🧪 (4134) vs '''🧲 (4519)'''
* Test tube
* '''Magnet'''
|
* It's time to find out: Who would win in a match, 🧪 or 🧲?
* Do you want super-powers? Because this is how you get super-powers!
|-
| 🔬 (2587) vs '''🧬 (5487)'''
* Microscope
* '''DNA double helix'''
|
* Oh, this one should be good.
* Do you want super-science? Because this is how you get super-science!
|-
| 📡 (3609) vs '''🔭 (4607)'''
* Satellite antenna
* '''Telescope'''
|
* You do not want to miss the fan favorite 📡. Coming up next!
* This one is a real nail biter!
|-
| 🚿 (3933) vs '''🚽 (4031)'''
* Shower
* '''Toilet'''
|
* Next up, 🚽 and 🚿.
* Combine these to save time in the morning!
|-
| '''🛁 (4131)''' vs 🧷 (2740)
* '''Bathtub'''
* Safety pin
|
* You do not want to miss the fan favorite 🛁. Coming up next!
*Well that just doesn't seem fair.
|-
| 🧹 (2655) vs '''🧻 (5118)'''
* Broom
* '''Roll of paper'''
|
* Will it be 🧹 or 🧻? Find out next after this message from our sponsors.
|-
| '''⚰ (4651)''' vs 🧯 (4009)
* '''Coffin'''
* Fire extinguisher
|
* You do not want to miss the fan favorite ⚰. Coming up next!
*You should have one of these handy in your house, although I guess which one is up to you.
|-
| 🆗 (5326) vs '''🆒 (5506)'''
* Squared OK
* '''Squared COOL'''
|
* Don't change that channel, folks. We have 🆒 and 🆗 warming up.
* Here it is, the final match before the second round!
* At least this one is going to be over quickly.
* Here it is, the final match before the second round!
|-
|}

==== Round 2====
{| class="wikitable mw-collapsible mw-collapsed"
|-
! Competitors and score !! Commentary
|-
| 😁 (5968) vs '''😅 (9223)'''
* Grinning face with smiling eyes
* '''Smiling face with open mouth and cold sweat'''
|
* They have been attacking each other on social media all week. Next up! It's 😁 vs. 😅.
* What a shocking result!
* Welcome to round 2!
* Welcome to round 2! These rounds will be a little slower.
* Welcome to round 2!
|-
| '''🙃 (12578)''' vs 🤣 (5892)
* '''Upside-down face'''
* Rolling On the Floor Laughing
|
* It's time to find out: Who would win in a match, 🙃 or 🤣?
*Round two is serious business, folks.
*Rolling-on-the-floor-laughing is a top seed, but the upside-down smiley has a certain intriguing ambiguity. Possible upset?
|-
| 😇 (4117) vs '''😉 (10595)'''
* Smiling face with halo
* '''Winking face'''
|
* Uh oh. 😉 has had words with 😇 before. The next match will be good.
* Is it winking *at* the halo? Or is it winking at me?
* I didn't remember 😉 qualifying.
|-
| 😘 (6659) vs '''😍 (8816)'''
* Face throwing a kiss
* '''Smiling face with heart-shaped eyes'''
|
* On deck, we have 😍 and 😘.
* I expect to see a lot of hearts on the page for this one.
|-
| 😙 (2284) vs '''😛 (11620)'''
* Kissing face with smiling eyes
* '''Face with stuck-out tongue'''
|
* It is a battle as old as time itself. 😙 and 😛! Facing off against each other again!
* This one is a toss-up in my book, folks.
* Don’t you hate it when one of you sticks out your tongue right as the other goes for the kiss?
* Close one!
|-
| 😝 (6304) vs '''😜 (7167)'''
* Face with stuck-out tongue and tightly-closed eyes
* '''Face with stuck-out tongue and winking eye'''
|
* You do not want to miss the fan favorite 😜. Coming up next!
|-
| 🤭 (1796) vs '''🤔 (15162)'''
* Smiling face with smiling eyes and hand covering mouth
* '''Thinking face'''
|
* Will it be 🤔 or 🤭? Find out next after this message from our sponsors.
* You know what the correct answer is here.
|-
| 😑 (5943) vs '''🤨 (9223)'''
* Expressionless face
* '''Face with one eyebrow raised'''
|
* You do not want to miss the fan favorite 😑. Coming up next!
* 😑 certainly has its work cut out for it going up agaist 🤨.
|-
| 🙄 (5122) vs '''😏 (8486)'''
* Face with rolling eyes
* '''Smirking face'''
|
* Welcome back, it's time for 😏 and 🙄 to go head to head.
* Why is the one on the right looking at me like that?
|-
| 😔 (4101) vs '''😬 (8574)'''
* Pensive face
* '''Grimacing face'''
|
* It's time to find out: Who would win in a match, 😔 or 😬?
* I don’t think either competitor wants to win this round.
* See? That's how you should feel. Starting at a humble live commentator doing live commentary.
|-
| '''😴 (8582)''' vs 🤒 (2281)
* '''Sleeping face'''
* Face with thermometer
|
* Coming to you live from the Emojidome, it's 😴 vs. 🤒!
*Mondays, am I right?
*Two big moods enter, one leaves.
|-
| 🤕 (5579) vs '''🤮 (8136)'''
* Face with head-bandage
* '''Face with open mouth vomiting'''
|
* On deck, we have 🤕 and 🤮.
* I don't feel so good...
* Really leaving it all on the floor with this one.
|-
| 🥴 (5548) vs '''🥶 (7121)'''
* Face with uneven eyes and wavy mouth
* '''Freezing face'''
|
* On deck, we have 🥴 and 🥶.
* Ice to see you.
* I think they might be trying to ice the kicker!
|-
| '''😎 (8912)''' vs 🤠 (5576)
* '''Smiling face with sunglasses'''
* Face with cowboy hat
|
* Have at it, 😎 and 🤠!
*Howdy, I’m the sheriff of cool!
|-
| 😕 (4748) vs '''😮 (7861)'''
* Confused face
* '''Face with open mouth'''
|
* I'm looking forward to this.
* An unexpected pairing! This should be good.
* I mean ... you can *see* the bracket so it isn't completely unexpected.
|-
| 😳 (5552) vs '''😯 (6583)'''
* Flushed face
* '''Hushed face'''
|
* It is a battle as old as time itself. 😯 and 😳! Facing off against each other again!
* Wasn't 😯 in the last match?
|-
| 😰 (2756) vs '''😭 (9508)'''
* Face with open mouth and cold sweat
* '''Loudly crying face'''
|
* Oh, this one should be good.
* 😰 is going to have to dig deep if they want to continue.
|-
| 😣 (2674) vs '''😱 (10403)'''
* Persevering face
* '''Face screaming in fear'''
|
* Oh, this one should be good.
* It doesn't get more real than this, folks.
|-
| 😓 (4790) vs '''😤 (7053)'''
* Face with cold sweat
* '''Face with look of triumph'''
|
* Welcome back, it's time for 😓 and 😤 to go head to head.
* Nice. Nice nice nice nice.
|-
| 😡 (4209) vs '''😈 (9437)'''
* Pouting face
* '''Smiling face with horns'''
|
* It's time to find out: Who would win in a match, 😈 or 😡?
* This one is a toss-up in my book, folks.
|-
| 💩 (7681) vs '''💀 (12905)'''
* Pile of poo
* '''Skull'''
|
* They have been attacking each other on social media all week. Next up! It's 💀 vs. 💩.
* This one is going to cause some arguments.
|-
| 👽 (4888) vs '''👾 (9937)'''
* Extraterrestrial alien
* '''Alien monster'''
|
* I'm looking forward to this.
* Space invaders: Analog vs. Digital
|-
| 😻 (5800) vs '''😺 (6451)'''
* Smiling cat face with heart-shaped eyes
* '''Smiling cat face with open mouth'''
|
* Coming to you live from the Emojidome, it's 😺 vs. 😻!
* I love cats. I love every kind of cat.
|-
| 😼 (4767) vs '''🙀 (7648)'''
* Cat face with wry smile
* '''Weary cat face'''
|
* Oh this one should be good.
* Every. Kind. Of. Cat.
* Did someone say "V-E-T?"
|-
| 😾 (5464) vs '''💖 (7037)'''
* Pouting cat face
* '''Sparkling heart'''
|
* Next up, 💖 and 😾.
* 😾 looks pretty upset.
|-
| ❤ (7490) vs '''💯 (7881)'''
* Heavy black heart
* '''Hundred points symbol'''
|
* You do not want to miss the fan favorite ❤. Coming up next!
* Two crowd-pleasers here, folks!
* The score is Love-100
|-
| 💣 (6379) vs '''💦 (7343)'''
* Bomb
* '''Splashing sweat symbol'''
|
* Next up, 💣 and 💦.
* From where I am standing 💦 has a commanding grip on this bracket.
* Well that's certainly something.
* I know which one I would choose, but I don't have time to vote!
|-
| '''👍 (7610)''' vs 🤘 (6417)
* '''Thumbs up sign'''
* Sign of the horns
|
* On deck, we have 👍 and 🤘.
*This is going well, right? This is working for you?
|-
| '''👊 (8368)''' vs 🦵 (3323)
* '''Fisted hand sign'''
* Leg
|
* Next up, 👊 and 🦵.
*Kickpuncher or punchkicker?
|-
| 👀 (6253) vs '''🧠 (6412)'''
* Eyes
* '''Brain'''
|
* If you're like me, you've argued over who would win head-to-head, 👀 or 🧠.
* Whoever wins this one gets punched by the fist emoji in the next round. Choose wisely.
* Whoever wins this one gets punched by the fist emoji in the next round. Choose wisely.
|-
| 👅 (4726) vs '''🤦 (7496)'''
* Tongue
* '''Face palm'''
|
* It's time to find out: Who would win in a match, 👅 or 🤦?
* Look, we are a little disappointed, too.
|-
| 👩‍🚀 (5246) vs '''👩‍🔬 (7971)'''
* Woman + Rocket
* '''Woman + Microscope'''
|
* Oh, this one should be good.
* So, what do you want to be when you grow up?
* Neither of these professions go well with concussions.
|-
| 🧛 (2269) vs '''🧙 (13138)'''
* Vampire
* '''Mage'''
|
* We will be right back with 🧙 vs. 🧛!
* Science?
|-
| '''🚶 (6112)''' vs 🧟 (6020)
* '''Pedestrian'''
* Zombie
|
* Oh this one should be good.
*Oh no. 🚶 fans are not going to like this match-up.
*Walk for your lives!
|-
| 🕴 (5070) vs '''💃 (7283)'''
* Man in business suit levitating
* '''Dancer'''
|
* You do not want to miss the fan favorite 💃. Coming up next!
* The Matrix is TWENTY YEARS OLD
* The Matrix is *TWENTY* *YEARS* *OLD*
|-
| ⛷ (4388) vs '''🤺 (7484)'''
* Skier
* '''Fencer'''
|
* On deck, we have ⛷ and 🤺.
* A slippery slope. En guard!
* The IOC has rejected this combination sport.
|-
| 🏊 (4139) vs '''🏄 (5491)'''
* Swimmer
* '''Surfer'''
|
* They have been attacking each other on social media all week. Next up! It's 🏄 vs. 🏊.
* This one, too.
|-
| 🚴 (4082) vs '''🚵 (7642)'''
* Bicyclist
* '''Mountain bicyclist'''
|
* Coming to you live from the Emojidome, it's 🚴 vs. 🚵!
* Why is 🚵 stuck in a box?
|-
| 🛀 (4042) vs '''🐒 (6948)'''
* Bath
* '''Monkey'''
|
* They have been attacking each other on social media all week. Next up! It's 🐒 vs. 🛀.
* Uh-oh.
|-
| 🐶 (5214) vs '''🦊 (12396)'''
* Dog face
* '''Fox face'''
|
* We will be right back with 🐶 vs. 🦊!
* Again, we are getting a lot of questions on this today. This is live commentary, folks.
* 12/10 Both good doggos.
|-
| 🐱 (5182) vs '''🐈 (7578)'''
* Cat face
* '''Cat'''
|
* We will be right back with 🐈 vs. 🐱!
* EVERY. CAT.
|-
| 🐎 (4944) vs '''🐅 (9398)'''
* Horse
* '''Tiger'''
|
* Have at it, 🐅 and 🐎!
* If it were up to me, the last bracket would have eight cats and then just stop there with eight winners.
|-
| 🦌 (5619) vs '''🦄 (10318)'''
* Deer
* '''Unicorn face'''
|
* Have at it, 🦄 and 🦌!
* The IOC had some words about this pairing as well
|-
| 🐷 (5341) vs '''🐏 (8541)'''
* Pig face
* '''Ram'''
|
* Welcome back, it's time for 🐏 and 🐷 to go head to head.
* Or side to head, or whatever. VOTE!
* That was 🐷's to give away and they did.
|-
| 🐐 (6038) vs '''🦒 (8345)'''
* Goat
* '''Giraffe face'''
|
* I'm looking forward to this.
* Yet more Very good dogs
|-
| '''🐘 (11342)''' vs 🦛 (3614)
* '''Elephant'''
* Hippopotamus
|
* Oh, this one should be good.
*Another curious match-up with significant implications on how the rest of the day will go.
|-
| 🐹 (3660) vs '''🐿 (10713)'''
* Hamster face
* '''Chipmunk'''
|
* It is a battle as old as time itself. 🐹 and 🐿! Facing off against each other again!
* We are incredibly excited to see so many fans here.
* Finally, the long-awaited showdown between Alvin and the Chipmunks and the Hamster Dance.
|-
| 🐨 (5171) vs '''🦔 (10929)'''
* Koala
* '''Hedgehog'''
|
* On deck, we have 🐨 and 🦔.
* It doesn't get more real than this, folks.
* Tree pocket cat vs. spiky cat
|-
| 🦘 (6954) vs '''🦡 (7727)'''
* Kangaroo
* '''Badger'''
|
* Will it be 🦘 or 🦡? Find out next after this message from our sponsors.
* If you believe in 🦘, now is the time to clap or whatever, because it is not looking good.
|-
| 🐣 (5846) vs '''🐧 (12239)'''
* Hatching chick
* '''Penguin'''
|
* We will be right back with 🐣 vs. 🐧!
* Don't count 🐣 out yet. They may have a contingent of fans just tuning in to battle.
* I thought we had seen everything, but look at 🐧 go! Amazing!
* A generational battle.
|-
| 🦆 (6558) vs '''🦉 (9674)'''
* Duck
* '''Owl'''
|
* Will it be 🦆 or 🦉? Find out next after this message from our sponsors.
* You just know that 🦆 is thinking about 🏥 right now.
* Duck... duck... duck... duck... owl!
|-
| '''🐢 (11594)''' vs 🦜 (3957)
* '''Turtle'''
* Parrot
|
* Uh oh. 🦜 has had words with 🐢 before. The next match will be good.
*Sometimes miracles happen.
|-
| 🐍 (5264) vs '''🐉 (6954)'''
* Snake
* '''Dragon'''
|
* Have at it, 🐉 and 🐍!
* How spiky do you like your sneks?
* Snake is currently losing to Fanfiction Snake.
* Snake is losing to Snake Fanfiction
|-
| 🐬 (7916) vs '''🐳 (9398)'''
* Dolphin
* '''Spouting whale'''
|
* On deck, we have 🐬 and 🐳.
* It's the battle of the blowholes!
|-
| '''🐙 (8799)''' vs 🦈 (3695)
* '''Octopus'''
* Shark
|
* Next up, 🐙 and 🦈.
*This one is potentially a battle between two mimic octopuses.
|-
| 🐛 (5330) vs '''🦋 (9176)'''
* Bug
* '''Butterfly'''
|
* On deck, we have 🐛 and 🦋.
* Time waits for no one.
* Another generational struggle.
|-
| 🕷 (5714) vs '''🐝 (12151)'''
* Spider
* '''Honeybee'''
|
* We will be right back with 🐝 vs. 🕷!
* 🕷 and 🐝 have been friends for a long time. I am not sure where that relationship is going to be after today.
|-
| 🌻 (6639) vs '''🦠 (10448)'''
* Sunflower
* '''Microbe'''
|
* Oh, this one should be good.
* You *knwo* what to do, folks.
* Oh no. 🦠 fans are not going to like this match-up.
* Fresh off its victory over the aliens in War of the Worlds…
|-
| 🌲 (8099) vs '''🌵 (8194)'''
* Evergreen tree
* '''Cactus'''
|
* Will it be 🌲 or 🌵? Find out next after this message from our sponsors.
* DISAPPOINTED!
* both are surprisingly spiky!
* This is the closest battle in the bracket so far.
|-
| 🍇 (6548) vs '''🍉 (8681)'''
* Grapes
* '''Watermelon'''
|
* Oh this one should be good.
* sweet!
|-
| 🍎 (5411) vs '''🍍 (10586)'''
* Red apple
* '''Pineapple'''
|
* Have at it, 🍍 and 🍎!
* Regular apple versus Pine’s Apple
* Fancy apple holds a clear lead over Regular Apple.
|-
| '''🍓 (8877)''' vs 🥝 (7540)
* '''Strawberry'''
* Kiwifruit
|
* It's time to find out: Who would win in a match, 🍓 or 🥝?
*Seeds: Inside or Out?
*Outside: Seeds or Hair?
|-
| 🥔 (7800) vs '''🥑 (9580)'''
* Potato
* '''Avocado'''
|
* Don't change that channel, folks. We have 🥑 and 🥔 warming up.
* Fun fact: Several different analyses confirm baby boomers like avocados more than millennials!
|-
| '''🌶 (8714)''' vs 🥒 (6360)
* '''Hot pepper'''
* Cucumber
|
* You do not want to miss the fan favorite 🌶. Coming up next!
*I know some very invested audience members for this one.
|-
| '''🍄 (8929)''' vs 🥜 (5311)
* '''Mushroom'''
* Peanuts
|
* You do not want to miss the fan favorite 🍄. Coming up next!
*It's peanut butter mushroom time!
|-
| 🥨 (7003) vs '''🥐 (9204)'''
* Pretzel
* '''Croissant'''
|
* Don't change that channel, folks. We have 🥐 and 🥨 warming up.
* Buttery curved bread: extra-buttery or extra-curved?
|-
| 🥞 (7881) vs '''🧀 (9457)'''
* Pancakes
* '''Cheese wedge'''
|
* Will it be 🥞 or 🧀? Find out next after this message from our sponsors.
* I wonder what cheesy pancakes are like.
|-
| 🍔 (5917) vs '''🍕 (11407)'''
* Hamburger
* '''Slice of pizza'''
|
* It is a battle as old as time itself. 🍔 and 🍕! Facing off against each other again!
* Friday Night Food Fight!
|-
| 🌮 (7714) vs '''🌯 (8885)'''
* Taco
* '''Burrito'''
|
* Coming to you live from the Emojidome, it's 🌮 vs. 🌯!
* ………
* . . . . . .
|-
| 🍿 (7104) vs '''🍳 (8128)'''
* Popcorn
* '''Cooking'''
|
* You do not want to miss the fan favorite 🍳. Coming up next!
* The saltiest and butteriest matchup yet
|-
| 🍱 (4259) vs '''🍣 (7578)'''
* Bento box
* '''Sushi'''
|
* Oh, this one should be good.
* Hungry again. Wasn't it just lunch time?
* This part of the bracket has been *wild*
* Sushi takes the lead!
|-
| 🥟 (5804) vs '''🦞 (7681)'''
* Dumpling
* '''Lobster'''
|
* Oh this one should be good.
* A delicious dumpling vs some kind of large spider
|-
| 🍨 (7349) vs '''🦑 (7834)'''
* Ice cream
* '''Squid'''
|
* If you're like me, you've argued over who would win head-to-head, 🍨 or 🦑.
* I think there’s another squid hiding in the ice cream bowl.
|-
| 🎂 (4175) vs '''🍩 (8454)'''
* Birthday cake
* '''Doughnut'''
|
* If you're like me, you've argued over who would win head-to-head, 🍩 or 🎂.
|-
| 🍯 (4787) vs '''🍫 (7565)'''
* Honey pot
* '''Chocolate bar'''
|
* Next! Who would win in a match between 🍫 and 🍯? We are about to find out.
* The beans vs. the bees!
|-
| '''☕ (7674)''' vs 🥛 (5344)
* '''Hot beverage'''
* Glass of milk
|
* Coming to you live from the Emojidome, it's ☕ vs. 🥛!
*Would you like some coffee with your milk?
|-
| 🍹 (4901) vs '''🍺 (7490)'''
* Tropical drink
* '''Beer mug'''
|
* Uh oh. 🍺 has had words with 🍹 before. The next match will be good.
* how drunk do you want to get?
* One small glass of beer with an umbrella, please.
|-
| '''🔪 (7787)''' vs 🥢 (5468)
* '''Hocho'''
* Chopsticks
|
* Oh, this one should be good.
*The two most popular ways to eat food
|-
| '''🌋 (8706)''' vs 🧭 (4079)
* '''Volcano'''
* Compass
|
* I'm looking forward to this.
*That compass is not leading you in a good direction.
|-
| 🏝 (5445) vs '''🏕 (8722)'''
* Desert island
* '''Camping'''
|
* Coming to you live from the Emojidome, it's 🏕 vs. 🏝!
|-
| 🏠 (5722) vs '''🏗 (5804)'''
* House building
* '''Building construction'''
|
* It is a battle as old as time itself. 🏗 and 🏠! Facing off against each other again!
* It's building vs. building!
|-
| '''🏥 (7053)''' vs 🗽 (5981)
* '''Hospital'''
* Statue of liberty
|
* We will be right back with 🏥 vs. 🗽!
|-
| ⛲ (5498) vs '''🌃 (6519)'''
* Fountain
* '''Night with stars'''
|
* You do not want to miss the fan favorite ⛲. Coming up next!
|-
| 🎡 (3212) vs '''🌅 (8000)'''
* Ferris wheel
* '''Sunrise'''
|
* It is a battle as old as time itself. 🌅 and 🎡! Facing off against each other again!
|-
| 🎢 (4701) vs '''🚄 (7014)'''
* Roller coaster
* '''High-speed train'''
|
* We will be right back with 🎢 vs. 🚄!
* Do you like your fast trains flat, or up-and-down?
|-
| 🚑 (4901) vs '''🚝 (7087)'''
* Ambulance
* '''Monorail'''
|
* On deck, we have 🚑 and 🚝.
|-
| 🚗 (2707) vs '''🚒 (8391)'''
* Automobile
* '''Fire engine'''
|
* Will it be 🚒 or 🚗? Find out next after this message from our sponsors.
|-
| 🛵 (5344) vs '''🚜 (6475)'''
* Motor scooter
* '''Tractor'''
|
* It's time to find out: Who would win in a match, 🚜 or 🛵?
* Both of these are popular rideshare vehicles.
|-
| 🛹 (3509) vs '''🚲 (9447)'''
* Skateboard
* '''Bicycle'''
|
* They have been attacking each other on social media all week. Next up! It's 🚲 vs. 🛹.
* next wave of rideshare vehicles.
|-
| '''⚓ (6608)''' vs ⛵ (6431)
* '''Anchor'''
* Sailboat
|
* Welcome back, it's time for ⚓ and ⛵ to go head to head.
*Should I stay or should I go?
|-
| 🛩 (5694) vs '''🚁 (6529)'''
* Small airplane
* '''Helicopter'''
|
* Will it be 🚁 or 🛩? Find out next after this message from our sponsors.
* Here in the future, flying cars are common!
|-
| 🚀 (7266) vs '''🛸 (14945)'''
* Rocket
* '''Flying saucer'''
|
* They have been attacking each other on social media all week. Next up! It's 🚀 vs. 🛸.
* IFO vs UFO
|-
| ⌚ (6623) vs '''🌒 (7404)'''
* Watch
* '''Waxing crescent moon symbol'''
|
* They have been attacking each other on social media all week. Next up! It's ⌚ vs. 🌒.
* Waxing crescent already? I must be running slow.
|-
| 🌙 (8921) vs '''🌞 (15703)'''
* Crescent moon
* '''Sun with face'''
|
* Welcome back, it's time for 🌙 and 🌞 to go head to head.
* Two contenders as different as night and day.
* In five billion years, this battle will play out in real life with the same result.
|-
| ⛈ (9358) vs '''🌌 (17038)'''
* Thunder butt and rain
* '''Milky way'''
|
* I'm looking forward to this.
* Astronomers are hammering the button on the right as hard as they can.
|-
| 🌪 (9848) vs '''🌈 (11326)'''
* Butt with tornado
* '''Rainbow'''
|
* You do not want to miss the fan favorite 🌈. Coming up next!
* The Wizard Of Oz (1938)
* The Wizard Of Oz (1939)
|-
| '''☄ (8014)''' vs ⚡ (7597)
* '''Comet'''
* High voltage sign
|
* Oh, this one should be good.
*The two leading theories for what killed the dinosaurs: A comet strike, or Zeus.
*Boom!
|-
| 🎃 (4112) vs '''🔥 (10407)'''
* Jack-o-lantern
* '''Fire'''
|
* If you're like me, you've argued over who would win head-to-head, 🎃 or 🔥.
|-
| 🎉 (5422) vs '''🧨 (18509)'''
* Party popper
* '''Firecracker'''
|
* Oh this one should be good.
* How emphatic do you like your celebrations?
|-
| 🏆 (5564) vs '''🎁 (6499)'''
* Trophy
* '''Wrapped present'''
|
* Have at it, 🎁 and 🏆!
|-
| ⚾ (5404) vs '''🏅 (7337)'''
* Baseball
* '''Sports medal'''
|
* Oh, this one should be good.
* Sports fact: If you hit a medal-winner with a ball, you take their title.
|-
| 🎾 (6117) vs '''🏀 (6171)'''
* Tennis racquet and ball
* '''Basketball and hoop'''
|
* We will be right back with 🎾 vs. 🏀!
* Sports fact: If you hit a medal-winner with a ball, you take the medal (but they take first base.)
* Sports showdowns: Bouncy edition
* Would you rather play basketball with a tennis ball, or tennis with a basketball?
|-
| 🏏 (7343) vs '''🥏 (7546)'''
* Cricket bat and ball
* '''Flying disc'''
|
* You do not want to miss the fan favorite 🏏. Coming up next!
|-
| 🏒 (8078) vs '''🏓 (8739)'''
* Ice hockey stick and puck
* '''Table tennis paddle and ball'''
|
* Uh oh. 🏓 has had words with 🏒 before. The next match will be good.
|-
| 🛷 (7104) vs '''🥌 (7733)'''
* Sled
* '''Curling stone'''
|
* Have at it, 🛷 and 🥌!
|-
| 🎲 (11931) vs '''🎮 (14739)'''
* Game die
* '''Video game'''
|
* They have been attacking each other on social media all week. Next up! It's 🎮 vs. 🎲.
* Digital or analog?
* Devices or, uh, dices?
|-
| '''🎨 (5374)''' vs 👓 (4988)
* '''Artist palette'''
* Eyeglasses
|
* We will be right back with 🎨 vs. 👓!
*two ways to add color to your world
|-
| '''🎒 (4961)''' vs 🧦 (4819)
* '''School satchel'''
* Socks
|
* We will be right back with 🎒 vs. 🧦!
*You can put your feet in either of these! No one can stop you.
|-
| '''🎩 (23265)''' vs 👑 (19274)
* '''Top hat'''
* Crown
|
* Will it be 🎩 or 👑? Find out next after this message from our sponsors.
*Hats for fancy people!
|-
| '''🎵 (17951)''' vs 💎 (9378)
* '''Musical note'''
* Gem stone
|
* We will be right back with 🎵 vs. 💎!
*C-notes
|-
| 🎷 (6954) vs '''🎸 (10692)'''
* Saxophone
* '''Guitar'''
|
* They have been attacking each other on social media all week. Next up! It's 🎷 vs. 🎸.
* I've never heard the dueling banjos played like this!
|-
| '''🎻 (11568)''' vs 📞 (8172)
* '''Violin'''
* Telephone receiver
|
* They have been attacking each other on social media all week. Next up! It's 🎻 vs. 📞.
*Can I put you on hold? I can't hang onto both of these with my chin
|-
| 💻 (7355) vs '''📟 (9348)'''
* Personal computer
* '''Pager'''
|
* It is a battle as old as time itself. 💻 and 📟! Facing off against each other again!
* Over time, computers have gotten steadily smaller.
|-
| ⌨ (3372) vs '''💾 (8550)'''
* Keyboard
* '''Floppy disk'''
|
* I'm looking forward to this.
* fun fact: it would take the average person 20 years to type an entire floppy disk
|-
| 📷 (10623) vs '''🧮 (12401)'''
* Camera
* '''Abacus'''
|
* Oh, this one should be good.
|-
| 🔎 (7902) vs '''💡 (12706)'''
* Right-pointing magnifying glass
* '''Electric light bulb'''
|
* On deck, we have 💡 and 🔎.
* it's mostly clicks either way.
* Both equally bad for bugs.
|-
| 📜 (4020) vs '''📚 (32459)'''
* Scroll
* '''Books'''
|
* Oh, this one should be good.
* Turning pages: hot new technology, or too much complication?
|-
| 💰 (5378) vs '''📦 (17957)'''
* Money bag
* '''Package'''
|
* Oh, this one should be good.
* Let's be real. Neither contain actual money.
|-
| 🖋 (6166) vs '''🖍 (42115)'''
* Lower left fountain pen
* '''Lower left crayon'''
|
* It is a battle as old as time itself. 🖋 and 🖍! Facing off against each other again!
* Neither is coming off your walls if a kid gets ahold of them.
|-
| 📅 (3309) vs '''📊 (5217)'''
* Calendar
* '''Bar chart'''
|
* Have at it, 📅 and 📊!
* It’s cool how, if you design an emoji font, you get to tell everyone your birthday.
|-
| ✂ (4504) vs '''📎 (5846)'''
* Black scissors
* '''Paperclip'''
|
* It is a battle as old as time itself. ✂ and 📎! Facing off against each other again!
* Look, we all have too much paper in our lives, but we all deal with it differently
* Clippy, I swear…
|-
| 🗡 (5537) vs '''🗝 (6193)'''
* Dagger knife
* '''Old key'''
|
* They have been attacking each other on social media all week. Next up! It's 🗝 vs. 🗡.
* There are two ways to open doors: The easy way and the fun way.
|-
| ⚔ (5514) vs '''🏹 (7201)'''
* Crossed swords
* '''Bow and arrow'''
|
* Welcome back, it's time for ⚔ and 🏹 to go head to head.
* Close-up stabby, or stabby from a ways off?
|-
| '''⚖ (6153)''' vs 🔧 (4351)
* '''Scales'''
* Wrench
|
* Will it be ⚖ or 🔧? Find out next after this message from our sponsors.
*⚖ comes out on top.
|-
| 🧲 (4654) vs '''🧬 (9019)'''
* Magnet
* '''DNA double helix'''
|
* Oh this one should be good.
|-
| 🚽 (4388) vs '''🔭 (8647)'''
* Toilet
* '''Telescope'''
|
* They have been attacking each other on social media all week. Next up! It's 🔭 vs. 🚽.
* I got these mixed up last week and I still haven't heard the end of it.
|-
| 🛁 (4540) vs '''🧻 (11347)'''
* Bathtub
* '''Roll of paper'''
|
* Welcome back, it's time for 🛁 and 🧻 to go head to head.
* Needed both of these after the telescope incident.
|-
| '''⚰ (7909)''' vs 🆒 (6024)
* '''Coffin'''
* Squared COOL
|
* On deck, we have ⚰ and 🆒.
*And that wraps up the round!
|-
|}

==== Round 3====
{| class="wikitable mw-collapsible mw-collapsed"
|-
! Competitors and score !! Commentary
|-
| 😅 (6285) vs '''🙃 (31589)'''
* Smiling face with open mouth and cold sweat
* '''Upside-down face'''
|
* Uh oh. 🙃 has had words with 😅 before. The next match will be good.
|-
| 😍 (8430) vs '''😉 (10837)'''
* Smiling face with heart-shaped eyes
* '''Winking face'''
|
* Next! Who would win in a match between 😉 and 😍? We are about to find out.
* Some of us are more suave than others...
|-
| 😛 (9010) vs '''😜 (10428)'''
* Face with stuck-out tongue
* '''Face with stuck-out tongue and winking eye'''
|
* Uh oh. 😜 has had words with 😛 before. The next match will be good.
* Battle of the tongues
|-
| 🤨 (6519) vs '''🤔 (18849)'''
* Face with one eyebrow raised
* '''Thinking face'''
|
* Next up, 🤔 and 🤨.
* Some behind the scenes for you, folks. I know for a fact that 🤔 wanted first billing for this match and 🤨 refused to budge.
|-
| 😬 (8983) vs '''😏 (11449)'''
* Grimacing face
* '''Smirking face'''
|
* It is a battle as old as time itself. 😏 and 😬! Facing off against each other again!
|-
| '''😴 (10588)''' vs 🤮 (7773)
* '''Sleeping face'''
* Face with open mouth vomiting
|
* Have at it, 😴 and 🤮!
*🤮 opened strong and 😴 never caught up.
*I hope everyone has printed their brackets and are ready, because time waits for very few people!
*I guess it was that kind of a party.
|-
| '''😎 (11469)''' vs 🥶 (9176)
* '''Smiling face with sunglasses'''
* Freezing face
|
* Oh, this one should be good.
*🥶 has a chance here, but it is slipping away.
*What's cooler than being cool?
*What’s cooler than being cool?
*You need to be cooler than that!
|-
| 😯 (7648) vs '''😮 (7944)'''
* Hushed face
* '''Face with open mouth'''
|
* Oh, this one should be good.
* Anyone want to go bowling?
* Sometimes I spend so long deciding on which of these to use that the conversation moves on.
|-
| 😭 (7559) vs '''😱 (8894)'''
* Loudly crying face
* '''Face screaming in fear'''
|
* They have been attacking each other on social media all week. Next up! It's 😭 vs. 😱.
* In these kinds of contests, everyone comes away a little hurt.
|-
| 😤 (5475) vs '''😈 (9739)'''
* Face with look of triumph
* '''Smiling face with horns'''
|
* Uh oh. 😤 has had words with 😈 before. The next match will be good.
* I don't think 😤 expected to see 😈 opposite them today.
* Devils over Cotton by a country mile. Let's see those hearts!
* This one was over before it started.
|-
| 💀 (6669) vs '''👾 (11173)'''
* Skull
* '''Alien monster'''
|
* It's time to find out: Who would win in a match, 👾 or 💀?
* It doesn't get more real than this, folks.
|-
| 😺 (7993) vs '''🙀 (8903)'''
* Smiling cat face with open mouth
* '''Weary cat face'''
|
* On deck, we have 😺 and 🙀.
* I spoke with 🙀 before we started today. They were hoping to dodge 😺. Too bad for them.
* The next few are contests are going to break friendships.
* This one is a real nail biter!
|-
| 💯 (9859) vs '''💖 (10041)'''
* Hundred points symbol
* '''Sparkling heart'''
|
* Next! Who would win in a match between 💖 and 💯? We are about to find out.
* I've always considered 💖 to be one of the greats.
* Starting to think 100 might go all the way.
* Starting to think 💯 might go all the way.
|-
| 👍 (9892) vs '''💦 (9960)'''
* Thumbs up sign
* '''Splashing sweat symbol'''
|
* It's time to find out: Who would win in a match, 👍 or 💦?
* What an unexpected result!!
* Now what is going to happen here:
* We are seeing some real back and forth matches this round.
* Again, cannot stress this enough. This commentary is 100% (sorry) live.
|-
| 👊 (6867) vs '''🧠 (12115)'''
* Fisted hand sign
* '''Brain'''
|
* They have been attacking each other on social media all week. Next up! It's 👊 vs. 🧠.
* Sometimes miracles happen.
* The match-up you have been waiting for!
|-
| '''👩‍🔬 (15141)''' vs 🤦 (7172)
* '''Woman + Microscope'''
* Face palm
|
* Oh this one should be good.
*Looks like someone forgot their PPE today!
|-
| 🚶 (2581) vs '''🧙 (17413)'''
* Pedestrian
* '''Mage'''
|
* Welcome back, it's time for 🚶 and 🧙 to go head to head.
* Another fan favorite. Can 🚶 catch up to 🧙?
* Well folks, it is not looking good for 🚶.
* In the end, there was nothing 🚶 could do to stop the power of 🧙.
|-
| 💃 (10409) vs '''🤺 (10987)'''
* Dancer
* '''Fencer'''
|
* We will be right back with 💃 vs. 🤺!
* Pointy Dancy vs. Pointy Stancy
* This one should be familiar to anyone who has tried fencing in heels.
|-
| 🏄 (7355) vs '''🚵 (10300)'''
* Surfer
* '''Mountain bicyclist'''
|
* Oh this one should be good.
* 🏄 has a chance here, but it is slipping away.
* Bicycle --> Unicycle --> None-cycle with left waves
* 🏄 has a chance here, but it is slipping away.
|-
| 🐒 (4784) vs '''🦊 (15635)'''
* Monkey
* '''Fox face'''
|
* It is a battle as old as time itself. 🐒 and 🦊! Facing off against each other again!
* Another challenging contest of cute!
* What *does* the fox say? "NOT TODAY, MONKEY."
|-
| 🐅 (7014) vs '''🐈 (11420)'''
* Tiger
* '''Cat'''
|
* Oh this one should be good.
* I have taken this yoga class!
* It looks like it is Cat vs. Extremely Cat.
|-
| 🐏 (12498) vs '''🦄 (12505)'''
* Ram
* '''Unicorn face'''
|
* On deck, we have 🐏 and 🦄.
* 🐏 is an fan favorite to go far today.
* This one is a real nail biter!
* This one is a real horn-biter!
|-
| '''🐘 (11723)''' vs 🦒 (6162)
* '''Elephant'''
* Giraffe face
|
* Have at it, 🐘 and 🦒!
*Two great examples of character creator parameters set to different extremes.
|-
| 🐿 (9539) vs '''🦔 (12565)'''
* Chipmunk
* '''Hedgehog'''
|
* Have at it, 🐿 and 🦔!
* I have no idea how you are going to handle this one, folks.
* 🦔 is out to an early lead, but don't count 🐿 out just yet.
* the crowd is going nuts!
* One for the history books.
|-
| '''🐧 (14230)''' vs 🦡 (7361)
* '''Penguin'''
* Badger
|
* It is a battle as old as time itself. 🐧 and 🦡! Facing off against each other again!
*Arriving at the party ... same party two hours later.
|-
| 🐢 (10674) vs '''🦉 (10893)'''
* Turtle
* '''Owl'''
|
* Coming to you live from the Emojidome, it's 🐢 vs. 🦉!
* Yeah, we know. This one is going to sting.
* It's neck and ... very interesting neck!
* Owl standing in for Hare in this round. We're all as surprised as you are.
|-
| 🐳 (9881) vs '''🐉 (12000)'''
* Spouting whale
* '''Dragon'''
|
* Welcome back, it's time for 🐉 and 🐳 to go head to head.
* Dry Snek vs. Wet Snek.
* A showdown between two mythical creatures!
* The dragon keeps beating real animals, even though dragons are just our animal fanfic.
* Save the whales!
|-
| '''🐙 (13431)''' vs 🦋 (6011)
* '''Octopus'''
* Butterfly
|
* On deck, we have 🐙 and 🦋.
*save the butterwhales!
*Here we have a contest between two mimic octopuses
*The octopus has over twice as many clicks, folks. This one isn’t looking close.
*The octopus has over twice as many clicks, folks. This one isn’t close.
|-
| '''🐝 (19577)''' vs 🦠 (16657)
* '''Honeybee'''
* Microbe
|
* I'm looking forward to this.
*nooooon, :butterfly:
*nooooon, butterfly (edited)
*Honeybees vs. colony collapse disorder
*I’m looking at the totals, and this one is extremely close.
*🦠 fans need to click more and faster!
*I mean, 🐝 fans need to keep clicking!
*Fun fact: You can click more than once, although if you click too much it ignores you.
*No! Save the bees!
*Bees!
|-
| 🍉 (12946) vs '''🌵 (13830)'''
* Watermelon
* '''Cactus'''
|
* Have at it, 🌵 and 🍉!
* As a dessert for saving the bees, try one of these fine desert fruits.
* Ever wonder what the inside of a cactus looks like? We’ve cut one open for you here.
|-
| 🍓 (12167) vs '''🍍 (12522)'''
* Strawberry
* '''Pineapple'''
|
* Uh oh. 🍓 has had words with 🍍 before. The next match will be good.
* What fruit is best to eat in the night? Could it be Pine’s Apple?
* The weird-textured fruit showdown features two strong competitors.
|-
| 🌶 (13812) vs '''🥑 (13975)'''
* Hot pepper
* '''Avocado'''
|
* Uh oh. 🥑 has had words with 🌶 before. The next match will be good.
* We have reached the halfway point of round 3!
* As Twitter user @jitka said, “I like avocados because they taste pretty good and also they come with a cool wood ball you get to keep”
|-
| 🍄 (11290) vs '''🥐 (11348)'''
* Mushroom
* '''Croissant'''
|
* Next up, 🍄 and 🥐.
* Don’t eat either of these if you find them on the ground in the woods.
|-
| '''🍕 (13520)''' vs 🧀 (8558)
* '''Slice of pizza'''
* Cheese wedge
|
* Don't change that channel, folks. We have 🍕 and 🧀 warming up.
*cheese: baked or not?
*pizza is just impure cheese
|-
| 🍳 (8407) vs '''🌯 (9848)'''
* Cooking
* '''Burrito'''
|
* Don't change that channel, folks. We have 🌯 and 🍳 warming up.
* one burrito, sunny-side up
* Now I want a burrito.
|-
| '''🍣 (11362)''' vs 🦞 (9488)
* '''Sushi'''
* Lobster
|
* It is a battle as old as time itself. 🍣 and 🦞! Facing off against each other again!
*I thought we had seen everything, but look at 🍣 go! Amazing!
|-
| 🍩 (12192) vs '''🦑 (12893)'''
* Doughnut
* '''Squid'''
|
* On deck, we have 🍩 and 🦑.
* Do not mix these flavors.
|-
| ☕ (7248) vs '''🍫 (13919)'''
* Hot beverage
* '''Chocolate bar'''
|
* If you're like me, you've argued over who would win head-to-head, ☕ or 🍫.
* what a cruel choice
* in which form would you like your beans?
* mocha hold the chocolate vs. mocha hold the coffee
|-
| 🍺 (11448) vs '''🔪 (12597)'''
* Beer mug
* '''Hocho'''
|
* Will it be 🍺 or 🔪? Find out next after this message from our sponsors.
* What an amazingly bad combination!
* Its ... a close shave.
|-
| 🏕 (6055) vs '''🌋 (13928)'''
* Camping
* '''Volcano'''
|
* They have been attacking each other on social media all week. Next up! It's 🌋 vs. 🏕.
* What an amazingly bad combination! .... Again!
* the eruption of mt. Saint helens (artist's conception)
* ruuuuunn!
|-
| 🏥 (7225) vs '''🏗 (8415)'''
* Hospital
* '''Building construction'''
|
* You do not want to miss the fan favorite 🏗. Coming up next!
* the crane can build hospitals, so voting for the crane is like wishing for infinite wishes
|-
| 🌅 (7042) vs '''🌃 (10460)'''
* Sunrise
* '''Night with stars'''
|
* Oh this one should be good.
* all good things must come to an end
|-
| 🚄 (8128) vs '''🚝 (8903)'''
* High-speed train
* '''Monorail'''
|
* I'm looking forward to this.
|-
| 🚜 (6598) vs '''🚒 (8085)'''
* Tractor
* '''Fire engine'''
|
* Coming to you live from the Emojidome, it's 🚒 vs. 🚜!
* We can put out your fire, or we can move it over there.
|-
| ⚓ (6987) vs '''🚲 (9001)'''
* Anchor
* '''Bicycle'''
|
* If you're like me, you've argued over who would win head-to-head, ⚓ or 🚲.
|-
| 🚁 (3409) vs '''🛸 (12591)'''
* Helicopter
* '''Flying saucer'''
|
* Oh, this one should be good.
* Independence Day (1996)
|-
| 🌞 (6290) vs '''🌒 (11026)'''
* Sun with face
* '''Waxing crescent moon symbol'''
|
* Coming to you live from the Emojidome, it's 🌒 vs. 🌞!
|-
| 🌈 (12417) vs '''🌌 (13194)'''
* Rainbow
* '''Milky way'''
|
* Uh oh. 🌌 has had words with 🌈 before. The next match will be good.
|-
| ☄ (7687) vs '''🔥 (8315)'''
* Comet
* '''Fire'''
|
* Have at it, ☄ and 🔥!
* Armageddon (1998)
|-
| 🎁 (5311) vs '''🧨 (9417)'''
* Wrapped present
* '''Firecracker'''
|
* I'm looking forward to this.
* Do you like surprises?
|-
| 🏀 (3729) vs '''🏅 (9083)'''
* Basketball and hoop
* '''Sports medal'''
|
* If you're like me, you've argued over who would win head-to-head, 🏀 or 🏅.
* This match has me questioning 🏀's commitment.
|-
| '''🏓 (9290)''' vs 🥏 (7916)
* '''Table tennis paddle and ball'''
* Flying disc
|
* I'm looking forward to this.
*Don't blink.
|-
| 🎮 (11060) vs '''🥌 (14205)'''
* Video game
* '''Curling stone'''
|
* Welcome back, it's time for 🎮 and 🥌 to go head to head.
* Curling Simulator 2019
* If you love 🥌, you will have to show it now!
* Its a close match!
* 🎮 sweeping up
* 🥌 sweeping up
* I think 🥌 has it.
|-
| 🎒 (5682) vs '''🎨 (8574)'''
* School satchel
* '''Artist palette'''
|
* Oh this one should be good.
* Is the backpack Blue or Red??
* Blue or Red isn't going to matter if 🎨 keeps their lead!
* This one was over before it started.
|-
| 🎩 (9120) vs '''🎵 (10259)'''
* Top hat
* '''Musical note'''
|
* It's time to find out: Who would win in a match, 🎩 or 🎵?
* Top Hat (1935)
|-
| 🎸 (7349) vs '''🎻 (10889)'''
* Guitar
* '''Violin'''
|
* Don't change that channel, folks. We have 🎸 and 🎻 warming up.
* the day the music died
|-
| 📟 (3276) vs '''💾 (14470)'''
* Pager
* '''Floppy disk'''
|
* Don't change that channel, folks. We have 💾 and 📟 warming up.
* 🖍, are you watching this match?
* At this rate, 📟 will lose worse than 🎒 earlier!
|-
| 💡 (7834) vs '''🧮 (10579)'''
* Electric light bulb
* '''Abacus'''
|
* It is a battle as old as time itself. 💡 and 🧮! Facing off against each other again!
* What an illuminating contest.
* In case you were wondering, the obsolete tech bracket is coming to a close soon.
* 🧮 comes out on top.
|-
| 📦 (3650) vs '''📚 (13464)'''
* Package
* '''Books'''
|
* Uh oh. 📦 has had words with 📚 before. The next match will be good.
* Remember trees?
|-
| 📊 (7144) vs '''🖍 (8035)'''
* Bar chart
* '''Lower left crayon'''
|
* It is a battle as old as time itself. 📊 and 🖍! Facing off against each other again!
* Which crayon is the shortest
* Which crayon is the shortest?
|-
| 📎 (8114) vs '''🗝 (9019)'''
* Paperclip
* '''Old key'''
|
* Have at it, 📎 and 🗝!
* Have you considered just casting 'Knock'?
|-
| ⚖ (6910) vs '''🏹 (9251)'''
* Scales
* '''Bow and arrow'''
|
* You do not want to miss the fan favorite ⚖. Coming up next!
* I am not sure if there is anything else that 🏹 needs to prove.
|-
| 🔭 (9037) vs '''🧬 (11772)'''
* Telescope
* '''DNA double helix'''
|
* It's time to find out: Who would win in a match, 🔭 or 🧬?
* Pretty sure that is not how any of this works.
|-
| ⚰ (12470) vs '''🧻 (13083)'''
* Coffin
* '''Roll of paper'''
|
* Don't change that channel, folks. We have ⚰ and 🧻 warming up.
* This is the final match of round 3!
* You have died of Dysentery.
|-
|}

==== Round 4====
{| class="wikitable mw-collapsible mw-collapsed"
|-
! Competitors and score !! Commentary
|-
| 😉 (13589) vs '''🙃 (22912)'''
* Winking face
* '''Upside-down face'''
|
* Will it be 😉 or 🙃? Find out next after this message from our sponsors.
* Finally! A rivalry spoke only in whispers now takes center stage.
* I see our friends in Australia have joined in the fun.
* 😉 has some time to recover, but they are going to need help.
* Down to our last minute in the match!
* 😉 never had a chance.
|-
| 😜 (6578) vs '''🤔 (25692)'''
* Face with stuck-out tongue and winking eye
* '''Thinking face'''
|
* Next! Who would win in a match between 😜 and 🤔? We are about to find out.
* This match-up reminds me of something clever I heard earlier ...
* Oh! I remember what it was!
* Someone said
|-
| 😴 (11518) vs '''😏 (12506)'''
* Sleeping face
* '''Smirking face'''
|
* If you're like me, you've argued over who would win head-to-head, 😏 or 😴.
* Success is no stranger to 😏. Let's see if they can keep it going.
* Don't sleep on this match-up!
|-
| 😮 (18361) vs '''😎 (18415)'''
* Face with open mouth
* '''Smiling face with sunglasses'''
|
* Next up, 😎 and 😮.
* I don't know about you, but this is the match I have been waiting all day to see.
* Sunglasses pulling ahead.
* The betting markets had 😮 as favourite today, but it sure looks like 😎 is going to make it!
* It's all up to 😎 now. Can they hold 😮 back long enough to claim victory?
* The betting markets had 😮 as favourite today, but it sure looks like 😎 is going to make it!
* The gap is closing! Is there enough time for 😮 to take the lead?
* This one is coming down to the wire!
* Surprised Pikachu pulls ahead!
|-
| 😱 (4868) vs '''😈 (5411)'''
* Face screaming in fear
* '''Smiling face with horns'''
|
* It is a battle as old as time itself. 😈 and 😱! Facing off against each other again!
|-
| 👾 (18385) vs '''🙀 (18571)'''
* Alien monster
* '''Weary cat face'''
|
* 👾 and 🙀 have been friends for a long time. I am not sure where that relationship is going to be after today.
* This could get interesting if 🙀 brings out their lasers!
* This could get interesting if 👾 brings out their lasers!
* Can we go back to the laser kittens for a minute?
* laser kittens! mew mew mew!
* Uh oh. The cat cheering section seems to be slacking.
* Can the cats make a comeback and save us all?
* It's gonna be tight!
|-
| 💦 (13865) vs '''💖 (15698)'''
* Splashing sweat symbol
* '''Sparkling heart'''
|
* Someone has to win this match and someone has to lose, but you have to acknowledge the pure sportsmanship of these competitors.
* Click the link at the bottom of the comic to view the current bracket! (Just updated.)
* That last one came down to the wire, and this one's looking like it might too.
* The three other Planeteers are watching this match tensely.
* Sparkle Heart has been a surprisingly strong contender, knocking out the 100 emoji early!
* Click the link at the bottom of the comic to view the current bracket!
* Sparkle heart appears to be running away with another one.
|-
| '''👩‍🔬 (19865)''' vs 🧠 (9398)
* '''Woman + Microscope'''
* Brain
|
* This is a match that no one wanted to deal with until the end.
*what exactly is 👩‍🔬 going to do with that beaker?
*Neuroscience vs. Neuro!
*There seems to be a commotion in the audience as to whether that was a flask or a beaker.
*I *was* a beaker, but someone changed it in post!
*Looks like 👩‍🔬 is really taking 🧠 to *flask*.
|-
| 🤺 (8947) vs '''🧙 (25337)'''
* Fencer
* '''Mage'''
|
* 🤺 has been a fan favorite all day. Suprising literally no one.
* However, 🧙 has literally been disintegrating their competition all afternoon.
* What are we thinking here? 'Heat Metal'?
* Parry hotter vs Harry Potter?
|-
| 🚵 (7397) vs '''🦊 (27045)'''
* Mountain bicyclist
* '''Fox face'''
|
* This is a match that no one wanted to deal with until the end.
* several people are typing.
* 🦊 is putting 🚵 in the rear-view mirror and stepping on the gas.
* I have never seen 🦊 crush an opponent that mercilessly before.
|-
| '''🐈 (25965)''' vs 🦄 (20912)
* '''Cat'''
* Unicorn face
|
* Oh this one should be good.
*I am not sure if there is anything else that 🐈 needs to prove.
|-
| 🐘 (23083) vs '''🦔 (23975)'''
* Elephant
* '''Hedgehog'''
|
* I spoke with 🐘 before the match today, and they had this to say: 🐘.
* This is one grudge that won't be resolved soon: 🐘 never forgets.
* Hedgehog has been a strong contender but elephant is running surprisingly close.
* This is going to come down to the final seconds.
* An amazing match from 🦔.
|-
| 🐧 (19957) vs '''🦉 (22737)'''
* Penguin
* '''Owl'''
|
* There are a lot of 🐧 fans in the audience today hoping to see their champ make it through.
* Another close match in the making!
* 1 minute for 🦉 to overtake 🐧!
* I think the bird has it.
|-
| 🐉 (25129) vs '''🐙 (25238)'''
* Dragon
* '''Octopus'''
|
* You wouldn't know it to look at them right now, but 🐉 and 🐙 have been friends for years.
* I think 🐉 may have finally met their match.
* 🐙 is trying to get back in the lead. But 🐉 is not having any of it.
* The totals are back and forth!
* An unbelievably close match is down to the final minute!
* It’s neck and neck, despite one being all neck and the other having none.
* The final seconds are here. Who will take the final lead?
|-
| 🌵 (17985) vs '''🐝 (18691)'''
* Cactus
* '''Honeybee'''
|
* 🌵 has really suprised me today.
* another close match. Are all of the contests going to be like this now?
|-
| '''🍍 (19728)''' vs 🥑 (18099)
* '''Pineapple'''
* Avocado
|
* 🍍 continues to show why they are just the dominant force to be reckoned with today.
*Avocado Toast or Pineapple Pizza
*Avocado Toast or Pineapple Pizza?
|-
| '''🍕 (19207)''' vs 🥐 (11100)
* '''Slice of pizza'''
* Croissant
|
* Oh this one should be good.
*Pineapple pizza isn't real pizza
*There are two correct answers here. Choose wisely.
*Pizzas are like croissant tacos
*Looks like 🥐 is getting roasted.
*🥐 burn so easily. Who knew?
|-
| 🌯 (16204) vs '''🍣 (17599)'''
* Burrito
* '''Sushi'''
|
* 🌯 came to play. It is so obvious.
* why do we have to choose?
* I have definitely eaten food that was described as both of these.
|-
| 🍫 (17503) vs '''🦑 (18313)'''
* Chocolate bar
* '''Squid'''
|
* Oh this one should be good.
* No No Nothing about this is good.
* 🍫 is pretty sweet, but I'm a sucker for 🦑
|-
| '''🌋 (18049)''' vs 🔪 (7144)
* '''Volcano'''
* Hocho
|
* 🌋 has been a fan favorite all day. Suprising literally no one.
*before the knives come out of the mountain they're technically called "magma"
*before knives come out of a mountain they're technically called 'magma'
|-
| 🏗 (7355) vs '''🌃 (12660)'''
* Building construction
* '''Night with stars'''
|
* Oh this one should be good.
* Has anyone ever seen one of these without the other? Hmm.
* 163
|-
| 🚒 (4736) vs '''🚝 (9570)'''
* Fire engine
* '''Monorail'''
|
* 🚒 is dedicating this match to someone very special in their lives.
|-
| 🚲 (11477) vs '''🛸 (14994)'''
* Bicycle
* '''Flying saucer'''
|
* 🚲 has really suprised me today.
* E.T. (1982)
|-
| 🌒 (7313) vs '''🌌 (15975)'''
* Waxing crescent moon symbol
* '''Milky way'''
|
* I am very excited to see 🌌 still in this competition.
* This battle is out of this world!
|-
| '''🔥 (13588)''' vs 🧨 (8239)
* '''Fire'''
* Firecracker
|
* This is a match with a special meaning for 🔥.
*Uh oh, this is one of those battles where nobody wins.
*🔥 bolting ahead with an alarming lead against 🧨
*Take cover folks, this looks like it's going to be a hot one.
*aaaaaand boom goes the dynamite!
|-
| 🏅 (9309) vs '''🏓 (11409)'''
* Sports medal
* '''Table tennis paddle and ball'''
|
* I am very excited to see 🏅 still in this competition.
* Ohhhhhhhh. That one is going to leave a mark.
|-
| 🎨 (11242) vs '''🥌 (20329)'''
* Artist palette
* '''Curling stone'''
|
* Look at where you came from 🎨. Look at where you started! You would think that this would be enough.
* C'mon baby put the rock in the house
|-
| 🎵 (10452) vs '''🎻 (11806)'''
* Musical note
* '''Violin'''
|
* 🎵 came to play. It is so obvious.
* It is a battle as old as time itself. 🎵 and 🎻! Facing off against each other again!
* No, that's not the iTunes logo
* 🎻's tuning might be working against them right now.
|-
| '''💾 (16887)''' vs 🧮 (13339)
* '''Floppy disk'''
* Abacus
|
* 💾 is dedicating this match to someone very special in their lives.
*Welcome back to the Obsolete Technology Dome!
*MicroSD Card is watching closely at this battle of two square data storage options
|-
| 🖍 (6157) vs '''📚 (16083)'''
* Lower left crayon
* '''Books'''
|
* This is going to be a challenge for 📚.
* 📚 really left a mark on 🖍 in their last match.
* 🖍 really left a mark on 📚 in their last match.
|-
| '''🏹 (14112)''' vs 🗝 (11789)
* '''Bow and arrow'''
* Old key
|
* 🏹 is looking fierce, but 🗝 is having none of it.
|-
| 🧻 (8107) vs '''🧬 (24415)'''
* Roll of paper
* '''DNA double helix'''
|
* 🧬 came to play. It is so obvious.
* 🧻 and 🧬 are neck and neck here in the final bout of round 3!
* when either is missing, you're in trouble
* And 🧻 falls to 🧬. A suprising turn of events.
|-
|}

==== Round 5====
{| class="wikitable mw-collapsible mw-collapsed"
|-
! Competitors and score !! Commentary
|-
| 🙃 (77562) vs '''🤔 (85714)'''
* Upside-down face
* '''Thinking face'''
|
* all remaining rounds will be 26 minutes
* all remaining bouts will be 26 minutes
* Sometimes I think they've gone too far with plastic surgery
* This one's a fitting start to the round of 32, don't you think?
* Spiderman (2002)
* these vote totals are getting *close*! 🤔
* up is down, down is up! 🤔
* up is down, down is up! 🙃
* 🤔🤔🤔🤔🤔
* Getting knocked out in the round of 32 🙃
|-
| 😎 (35129) vs '''😏 (35485)'''
* Smiling face with sunglasses
* '''Smirking face'''
|
* 😎 and 😏 have been friends for a long time. I am not sure where that relationship is going to be after today.
* wink wink vs nudge nudge
* The Blues Brothers (1980)
* Can't read my p-p-p-poker face"
* Can't read my p-p-p-poker face
* David Caruso, is that you
* explicit vs. implicit
|-
| 🙀 (34060) vs '''😈 (46401)'''
* Weary cat face
* '''Smiling face with horns'''
|
* Are we about to see a huge upset?
* The devil went down to kittytown
* We're not sure which of these is a more accurate representation of a cat
* Both of them like to make your life hell.
* Which side are the Hellcats cheering for?
* 9 circles of hell. 9 lives. COINCIDENCE?
* Better the devil you know than the one you pet.
|-
| 💖 (15594) vs '''👩‍🔬 (43035)'''
* Sparkling heart
* '''Woman + Microscope'''
|
* This is a match that no one wanted to deal with until the end.
* Love Potion No. 9 (1963)
* The shine seems to be wearing off for sparkle heart.
* The shine seems to be wearing off for sparkle heart. What's in that flask?
|-
| 🦊 (48941) vs '''🧙 (49275)'''
* Fox face
* '''Mage'''
|
* 🦊 has really suprised me today.
* :leaves:: Target creature gets +3/+3 until end of turn targeting Devilthorn Fox
* G: Target creature gets +3/+3 until end of turn targeting Devilthorn Fox
|-
| 🐈 (32862) vs '''🦔 (42994)'''
* Cat
* '''Hedgehog'''
|
* I don't care if you are a 🐈 fan or a 🦔 fan, you have to admire their work here today.
* Scoring of this bout might be delayed, we're having to re-calibrate our cuteness meter.
|-
| 🐙 (38553) vs '''🦉 (204094)'''
* Octopus
* '''Owl'''
|
* Someone has to win this match and someone has to lose, but you have to acknowledge the pure sportsmanship of these competitors.
* This staring contest began hours before the match started.
* You obviously like owls.
|-
| 🍍 (25531) vs '''🐝 (28801)'''
* Pineapple
* '''Honeybee'''
|
* 🍍 is dedicating this match to someone very special in their lives.
* Neither of these really go well with a bonnet.
|-
| 🍕 (30696) vs '''🍣 (33247)'''
* Slice of pizza
* '''Sushi'''
|
* We didn't expect 🍕 to show up today, and ... well ... we are just as suprised as you!
* It's come down to this... which one is going to get taken out.
* In Toronto, this isn't even a competition.
|-
| '''🌋 (24884)''' vs 🦑 (20329)
* '''Volcano'''
* Squid
|
* There was never any doubt in my mind that 🌋 would be right here, right now.
*Finally the mastermind has an appropriate lair
|-
| 🌃 (21192) vs '''🚝 (24042)'''
* Night with stars
* '''Monorail'''
|
* I am very excited to see 🌃 still in this competition.
|-
| '''🌌 (25884)''' vs 🛸 (14803)
* '''Milky way'''
* Flying saucer
|
* 🌌 has been a fan favorite all day. Suprising literally no one.
*Will we go to the stars, or will the stars come to us?
|-
| 🏓 (13494) vs '''🔥 (17154)'''
* Table tennis paddle and ball
* '''Fire'''
|
* 🏓 continues to show why they are just the dominant force to be reckoned with today.
* Would you rather be on fire, or on fire?
* Have you ever seen a ping pong paddle on fire? Me neither.
|-
| '''🎻 (26281)''' vs 🥌 (26221)
* '''Violin'''
* Curling stone
|
* 🎻 certainly has its work cut out for it going up agaist 🥌.
*Which do you prefer, classical or house?
|-
| 📚 (16770) vs '''💾 (19628)'''
* Books
* '''Floppy disk'''
|
* 💾 had an interesting previous round. Let's see what they do now.
* One of these is a universal icon for saving data, and the other is a floppy.
* The Persistence of Memory (1931)
|-
| 🏹 (9717) vs '''🧬 (20370)'''
* Bow and arrow
* '''DNA double helix'''
|
* We didn't expect 🏹 to show up today, and ... well ... we are just as suprised as you!
* The latest ad targeting technology is pretty scary.
|-
|}

==== Round 6====
{| class="wikitable mw-collapsible mw-collapsed"
|-
! Competitors and score !! Commentary
|-
| 😏 (17357) vs '''🤔 (23903)'''
* Smirking face
* '''Thinking face'''
|
* Look at where you came from 😏. Look at where you started! You would think that this would be enough.
* I know something you don't know.
* How do you know for sure that your votes are doing anything?
|-
| 😈 (11306) vs '''👩‍🔬 (30208)'''
* Smiling face with horns
* '''Woman + Microscope'''
|
* This is a match with a special meaning for 👩‍🔬.
* The scientific method's problem is that the devil's in the details.
|-
| 🧙 (26205) vs '''🦔 (27999)'''
* Mage
* '''Hedgehog'''
|
* 🦔 had an interesting previous round. Let's see what they do now.
* Hedge magic is generally more pragmatic than other forms of sorcery.
* The wizard didn't do it
|-
| 🐝 (21941) vs '''🦉 (28070)'''
* Honeybee
* '''Owl'''
|
* 🐝 came to play. It is so obvious.
* Of course we all know about the Owls and the Bees
* The Owlbee is a lesser known, but beloved D&D monster.
* The Owlbee is a lesser known, but beloved D and D monster.
* The Owlbee is a lesser known, but beloved DnD monster.
* Owls well that ends well
|-
| 🍣 (27026) vs '''🌋 (33364)'''
* Sushi
* '''Volcano'''
|
* 🌋 is dedicating this match to someone very special in their lives.
* Cooked or raw?
* Sushi is tasty, but the volcano offers free delivery.
* Click the link at the bottom for a just-updated bracket!
* Sushi has received a technical disqualification for being very very cooked
|-
| '''🌌 (36285)''' vs 🚝 (17405)
* '''Milky way'''
* Monorail
|
* 🌌 continues to show why they are just the dominant force to be reckoned with today.
*~future~
*The red carpet is empty tonight; the sky is full of stars.
*NIGHT TRAIN!
*Spaaaaaaaaace
|-
| 🎻 (26806) vs '''🔥 (32652)'''
* Violin
* '''Fire'''
|
* 🎻 is dedicating this match to someone very special in their lives.
* Either can kill if used indiscriminately.
* And fire flew from his fingertips as he rosined up his bow.
* That fiddle-playing is [fire emoji], but that fire emoji is [actual fire].
* That 🎻 is 🔥, but that 🔥 is actual 🔥.
* Click the link below the comic to see the current round of 32! (just updated)
* Click the link at the bottom to see the current round of 32! (just updated)
* That 🎻 is 🔥, but that 🔥 is actual 🔥.
|-
| 💾 (57577) vs '''🧬 (58313)'''
* Floppy disk
* '''DNA double helix'''
|
* Look at where you came from 💾. Look at where you started! You would think that this would be enough.
* Magnets work on both of these, right?
* Fun fact: Your genome could fit on just a few hundred floppy disks.
* This is the final match of the round, determining whether 💾 or 🧬 makes it into the Elite Eight.
* These two have been neck-and-neck through the whole bout.
* The “3d-printed save icon” is pulling ahead in the home stretch!
* This is a close one!
* Fun fact: Your genome could fit on just a few hundred floppy disks.
|-
|}

==== Round 7 - Quarterfinals====
{| class="wikitable mw-collapsible mw-collapsed"
|-
! Competitors and score !! Commentary
|-
| '''👩‍🔬 (113683)''' vs 🤔 (108653)
* '''Woman + Microscope'''
* Thinking face
|
* Nearly tied at 40,000 votes each!
*Nearly tied at 50,000 votes each!
*👩‍🔬 has the lead, but 🤔 points out it’s not a statistically significant difference.
*🤔 has the lead, but 👩‍🔬 points out it’s not a statistically significant difference.
*🤔 pulls ahead, but reminds everyone that it’s not a statistically significant lead.
*👩‍🔬 pulls ahead, but reminds everyone that it’s not a statistically significant lead.
*Hmmmmmmmmmmmmmmmmmmmm
*👩‍🔬 is ahead, but reminds everyone that it’s not statistically significant.
*👩‍🔬 appears to be leading, but more studies are needed.
*🤔
|-
| 🦉 (103212) vs '''🦔 (105260)'''
* Owl
* '''Hedgehog'''
|
* I've always considered 🦉 to be one of the greats.
* sky cat vs. pointy cat
* This bout will decide which animal emoji advances to the final 4.
* The main difference between these two is the number of potentially flying spines.
* This one's going to be close.
* One might say this was neck and neck if either of these had one.
* 🦔 just barely squeaking in a victory.
|-
| 🌋 (105716) vs '''🌌 (175099)'''
* Volcano
* '''Milky way'''
|
* 🌋 had an interesting previous round. Let's see what they do now.
* Star stuff or regurgitated star stuff?
* This is secretly a referendum on air pollution.
* “Earth” and “Space” have each sent their most exciting representatives
* 🌋 is going to go extinct at this rate.
* This combination led to the cretaceous extinction.
* It’s looking like 🌌 will advance to the final 4.
* Good (starry) Night!
|-
| '''🔥 (178121)''' vs 🧬 (159553)
* '''Fire'''
* DNA double helix
|
* Did you know the melting point of DNA depends on the information it encodes?
*Jurassic Park III (2001)
*🧬 pulled ahead early, but 🔥 has closed the gap.
*🧬 is pulling away!
*Click the link below to see the current bracket!
*🧬 seems eager to move up the ladder.
*Whatever happens, this one will have a twist ending.
*🧬 has pulled ahead in the home stretch!
*🔥 has pulled ahead in the home stretch!
*🔥🔥🔥🔥🔥
|-
|}

==== Round 8 - Semifinals====
{| class="wikitable mw-collapsible mw-collapsed"
|-
! Competitors and score !! Commentary
|-
| 👩‍🔬 (285263) vs '''🦔 (285736)'''
* Woman + Microscope
* '''Hedgehog'''
|
* 👩‍🔬 defeated [purple devil face] and [sparkling heart] to get here.
* 👩‍🔬 defeated the wizard and then beat out the rest of the animal quadrant.
* 🦔 defeated the wizard and then beat out the rest of the animal quadrant.
* With over a quarter of a million votes, this one is coming down to the wire.
* In the final minutes, 🦔 is opening up the first real lead of the bout!
* 🦔 fans had better keep clicking!
* 👩‍🔬 is ahead but 🦔 is closing the gap!
* It’s virtually tied going into the final minute! Keep clicking!
* 🦔 pulls ahead!
* Science!
|-
| '''🌌 (281040)''' vs 🔥 (155282)
* '''Milky way'''
* Fire
|
* Without oxygen, there’s no 🔥.
*Space fire fact: If we detect fire on exoplanets, it may indicate life. Oxygen is volatile and shouldn’t persist in an atmosphere without something replenishing it.
*Space fire fact: If we detect fire on exoplanets, it may indicate life. Oxygen is volatile and shouldn’t persist in an atmosphere without replenishment.
*Just how much fire is there in a star, anyway?
*The winner of this match will go on to face hedgehog in the finals.
*The galaxy is running away with this one.
*Click the link below for the bracket! (Change the 32 to 128 for a larger one.)
*Space is running away so fast with this one we're seeing red shift.
*Spaaaaaaaaaaaaace
*Space ran away with that one so fast it redshifted.
|-
|}

==== Round 9 - Final====
{| class="wikitable mw-collapsible mw-collapsed"
|-
! Competitors and score !! Commentary
|-
| '''🌌 (710129)''' vs 🦔 (682919)
* '''Milky way'''
* Hedgehog
|
* 🦔 is in the lead!
*🌌 has pulled ahead again!
*🦔 is slowly trying to close the gap that 🌌 managed to open.
*🦔 is catching up!
*🦔 is in the lead, 🌌 hot on its tail.
*🌌 beginning to expand its lead again.
*Over a million votes have been cast!
*🌌 in the lead, but 🦔 isn't out of this yet.
*This is it folks, the final moments...
*🌌 takes it!
|-
|}

===Error image transcript===
:[This is the image that appears when JavaScript fails or other errors occur. This is what embeds and automated programs usually see, as they load down dynamic comics. The transcript for this image is below the image:]
:[[File:2131_Emojidome_Error_image.png]]
:[A tournament bracket tree is shown with eight participants each on the left and right side, for a total of sixteen, all of which are the 😰 emoji ("Face With Open Mouth and Cold Sweat"). From both sides towards the middle the brackets reduce to eight, then four, two, and one line where the latter join to a rectangle in the middle. Below is an explanation of why this is seen instead of the correct comic. It is due to an error with JavaScript. This is also why the sad emoji is used in all sweet sixteen places.]

:Visit xkcd.com to participate

:If you ''are'' on xkcd.com, then you're seeing this
:because of something something JavaScript.

:Listen, websites are hard 😰

{{comic discussion}}

[[Category:April fools' comics]]
[[Category:Interactive comics]]
[[Category:Comics with color]]
[[Category:Emoji]]
[[Category:Sport]]
[[Category:Tournament bracket]]

2248: New Year's Eve

2019-12-30T09:04:49Z

Tbodt: Transcript

{{comic
| number = 2248
| date = December 30, 2019
| title = New Year's Eve
| image = new_years_eve.png
| titletext = "Off-by-one errors" isn't the easiest theme to build a party around, but I've seen worse.
}}

==Explanation==
{{incomplete|Created by an OFF-BY-ONE ERROR - Please change this comment when editing this page. Do NOT delete this tag too soon.}}

==Transcript==

:[Cueball, excited, is talking to Megan and White Hat.]]
:Cueball: Tomorrow is New Year's Eve, and you know what that means:
:Cueball: It's the one day of the year when you can convert between ages and birth years by subtraction without worrying about off-by-one errors!
:Cueball: Also there are probably parties.

{{comic discussion}}

2248

2019-12-30T08:56:17Z

Tbodt: new decade, new comic

#REDIRECT [[2248: New Year's Eve]]

Template:LATESTCOMIC

2019-12-30T08:54:56Z

Tbodt: darned bot don't update the page no more

<noinclude>The latest [[xkcd]] comic is number:</noinclude> 2248

File:new years eve.png

2019-12-30T08:53:10Z

Tbodt:

== Licensing ==
{{XKCD file}}

File:new years eve.png

2019-12-30T08:51:48Z

Tbodt:

2248: New Year's Eve

2019-12-30T08:47:41Z

Tbodt: RIP bot

2169: Predictive Models

2019-09-19T05:01:44Z

Tbodt:

{{comic
| number = 2169
| date = June 28, 2019
| title = Predictive Models
| image = predictive_models.png
| titletext = WE WILL ARREST THE REVOLUTION MEMBERS [AT THE JULY 28TH MEETING][tab] "Cancel the meeting! Our cover is blown."
}}

==Explanation==

{{w|Predictive text}} is a feature on many systems where as you type the system automatically suggests likely words or phrases to follow what you have written to that point. For instance, if you type "I'm heading" the system may suggest "home" or "back" as likely words to follow. Predictive systems usually use prior input to generate their predictions, so if you frequently type "Totally amazing!" the system will suggest "amazing!" every time you type "totally" even if you actually want to type "totally true" sometimes.

In the comic, [[Cueball]] is using predictive text in {{w|Gmail}} to uncover a plot against his organization/government, but instead of using only his personal input, the system is using input from ''all'' users. By typing in an obscure phrase related to revolution and a meeting, he gets the predictive text algorithm to display where and when the next supposedly secret meeting will be held based on other users input. This works because it is unlikely that anyone else other than revolutionaries would be typing this phrase, thus the only data the algorithm has to predict from is the actual message from the revolutionaries on their next meeting. The caption of the comic is pointing out that systems which use prior input for predictive purposes in this way can end up leaking information that might otherwise be considered private. (However, this method may produce outdated information. On June 29, 2019, typing in Google "Long live the revolution. Our next meeting will be at" gave the predicted completion "long live the revolution. our next meeting will be at comic con 2018", which would not be useful information to anyone looking for revolutionaries, because Comic-Con 2018 was already over.)

The title text shows the revolutionaries using the same technique. By typing in "We will arrest the revolution members" they are hoping that the algorithm will suggest the time and date of their planned arrest, since no one other than the authorities would be typing in that phrase. Pressing the key [tab] to autocomplete that text produces "WE WILL ARREST THE REVOLUTION MEMBERS [AT THE JULY 28TH MEETING]", and the revolutionaries then say "Cancel the meeting! Our cover is blown." The revolutionaries have apparently made the serious mistake of holding secret meetings on regular, predictable dates (such as the 28th day of each month, the last date guaranteed to exist in any month of the Gregorian Calendar), and the authorities have successfully figured this out, either through the predictive-text attack or by other means.

Both examples assume that the revolutionaries and the authorities would be talking about very secret information in the clear on a network accessible to their adversaries. In the real world people engaged in sensitive activities would communicate via code, encryption, or both, or would do so through what they believe to be secure channels. There is still the danger of secret information leaking via non-secret channels, however.

{{w|Side-channel attack|Side-channel attacks}} use information gained from the implementation of a system to deduce supposedly protected information. A famous example occurred in World War II. The Germans kept tank production figures a secret, but they gave items like engine blocks sequential serial numbers. The Allies wanted to know exact tank production figures, so they solved the {{w|German tank problem}} by using statistical methods to analyze the distribution of these numbers on captured vehicles. They were able to predict tank production figures extremely accurately, to the point they predicted 270 tanks in a month when 276 were actually built. Thus the secret information on tank production leaked.

Some systems require frequent password change, in an effort to limit danger from a password being discovered. However, people respond by chosing passwords in patterns, so it is easy to predict what subsequent passwords will be, given old ones, thus defeating the purpose of requiring frequent changes.[https://www.troyhunt.com/passwords-evolved-authentication-guidance-for-the-modern-era/ Passwords Evolved: Authentication Guidance for the Modern Era]

Although the comic title is "Predictive Models", the term {{w|Predictive modelling}} usually refers to computer programs that try to predict outcomes from data aggregation, such as reviewing health records to identify people most at risk from certain diseases based on weight, prior injuries, etc., before testing directly for the diseases themselves. This is similar to but not precisely like the example in the comic, since predictive text is using direct input to predict further input, while predictive modelling is using related input (such as make and model of a car along with driver acceleration patterns) to predict a different output (such as likelihood of a crash). Both predictive text and predictive modelling could leak information as the comic suggests, however.

Predictive text and the possibility to leak unintended information has been parodied on xkcd before in [[1068: Swiftkey]].

==Transcript==
:[Cueball is sitting in an office chair at a desk typing on a laptop. Above him is the text he writes along with what the predictive text tool suggests, the latter in grey text. The TAB at the end is in a small frame.]
:Cueball typing: Long live the revolution. Our next meeting will be at| the docks at midnight on June 28 [tab]
:Cueball: ''Aha, found them!''

:[Caption below the panel:]
:When you train predictive models on input from your users, it can leak information in unexpected ways.

==Trivia==
*On its original release, the alt text was bugged. The full text would not display in certain browsers, and clicking the comic takes you to this page: [https://xkcd.com/%5BAT%2520THE%2520JULY%252028TH%2520MEETING%5D%5Btab%5D <nowiki>https://xkcd.com/[AT%20THE%20JULY%2028TH%20MEETING][tab]</nowiki>], which only shows "404 Not Found".
**The anchor actually contains invalid HTML <nowiki><a href=" [AT THE JULY 28TH MEETING][tab] "Cancel the meeting! Our cover is blown.""></nowiki>. This would suggest that [[Randall]] didn't intend this behaviour.
**The image and alt text were later corrected, long before July 28th, 2019, further implying it was a simple mistake on Randall's part.
*Some browsers, only show the first part of the title text "WE WILL ARREST THE REVOLUTION MEMBERS." For example Firefox version 66 Windows does this, evidently some versions of Firefox and chrome do likewise on GNU/Linux, also Windows 10 Microsoft Edge

{{comic discussion}}

[[Category:Comics featuring Cueball]]

2169: Predictive Models

2019-09-19T05:01:28Z

Tbodt: The UI drawn is that of Gmail

{{comic
| number = 2169
| date = June 28, 2019
| title = Predictive Models
| image = predictive_models.png
| titletext = WE WILL ARREST THE REVOLUTION MEMBERS [AT THE JULY 28TH MEETING][tab] "Cancel the meeting! Our cover is blown."
}}

==Explanation==

{{w|Predictive text}} is a feature on many systems where as you type the system automatically suggests likely words or phrases to follow what you have written to that point. For instance, if you type "I'm heading" the system may suggest "home" or "back" as likely words to follow. Predictive systems usually use prior input to generate their predictions, so if you frequently type "Totally amazing!" the system will suggest "amazing!" every time you type "totally" even if you actually want to type "totally true" sometimes.

In the comic, [[Cueball]] is using predictive text in Gmail to uncover a plot against his organization/government, but instead of using only his personal input, the system is using input from ''all'' users. By typing in an obscure phrase related to revolution and a meeting, he gets the predictive text algorithm to display where and when the next supposedly secret meeting will be held based on other users input. This works because it is unlikely that anyone else other than revolutionaries would be typing this phrase, thus the only data the algorithm has to predict from is the actual message from the revolutionaries on their next meeting. The caption of the comic is pointing out that systems which use prior input for predictive purposes in this way can end up leaking information that might otherwise be considered private. (However, this method may produce outdated information. On June 29, 2019, typing in Google "Long live the revolution. Our next meeting will be at" gave the predicted completion "long live the revolution. our next meeting will be at comic con 2018", which would not be useful information to anyone looking for revolutionaries, because Comic-Con 2018 was already over.)

The title text shows the revolutionaries using the same technique. By typing in "We will arrest the revolution members" they are hoping that the algorithm will suggest the time and date of their planned arrest, since no one other than the authorities would be typing in that phrase. Pressing the key [tab] to autocomplete that text produces "WE WILL ARREST THE REVOLUTION MEMBERS [AT THE JULY 28TH MEETING]", and the revolutionaries then say "Cancel the meeting! Our cover is blown." The revolutionaries have apparently made the serious mistake of holding secret meetings on regular, predictable dates (such as the 28th day of each month, the last date guaranteed to exist in any month of the Gregorian Calendar), and the authorities have successfully figured this out, either through the predictive-text attack or by other means.

Both examples assume that the revolutionaries and the authorities would be talking about very secret information in the clear on a network accessible to their adversaries. In the real world people engaged in sensitive activities would communicate via code, encryption, or both, or would do so through what they believe to be secure channels. There is still the danger of secret information leaking via non-secret channels, however.

{{w|Side-channel attack|Side-channel attacks}} use information gained from the implementation of a system to deduce supposedly protected information. A famous example occurred in World War II. The Germans kept tank production figures a secret, but they gave items like engine blocks sequential serial numbers. The Allies wanted to know exact tank production figures, so they solved the {{w|German tank problem}} by using statistical methods to analyze the distribution of these numbers on captured vehicles. They were able to predict tank production figures extremely accurately, to the point they predicted 270 tanks in a month when 276 were actually built. Thus the secret information on tank production leaked.

Some systems require frequent password change, in an effort to limit danger from a password being discovered. However, people respond by chosing passwords in patterns, so it is easy to predict what subsequent passwords will be, given old ones, thus defeating the purpose of requiring frequent changes.[https://www.troyhunt.com/passwords-evolved-authentication-guidance-for-the-modern-era/ Passwords Evolved: Authentication Guidance for the Modern Era]

Although the comic title is "Predictive Models", the term {{w|Predictive modelling}} usually refers to computer programs that try to predict outcomes from data aggregation, such as reviewing health records to identify people most at risk from certain diseases based on weight, prior injuries, etc., before testing directly for the diseases themselves. This is similar to but not precisely like the example in the comic, since predictive text is using direct input to predict further input, while predictive modelling is using related input (such as make and model of a car along with driver acceleration patterns) to predict a different output (such as likelihood of a crash). Both predictive text and predictive modelling could leak information as the comic suggests, however.

Predictive text and the possibility to leak unintended information has been parodied on xkcd before in [[1068: Swiftkey]].

==Transcript==
:[Cueball is sitting in an office chair at a desk typing on a laptop. Above him is the text he writes along with what the predictive text tool suggests, the latter in grey text. The TAB at the end is in a small frame.]
:Cueball typing: Long live the revolution. Our next meeting will be at| the docks at midnight on June 28 [tab]
:Cueball: ''Aha, found them!''

:[Caption below the panel:]
:When you train predictive models on input from your users, it can leak information in unexpected ways.

==Trivia==
*On its original release, the alt text was bugged. The full text would not display in certain browsers, and clicking the comic takes you to this page: [https://xkcd.com/%5BAT%2520THE%2520JULY%252028TH%2520MEETING%5D%5Btab%5D <nowiki>https://xkcd.com/[AT%20THE%20JULY%2028TH%20MEETING][tab]</nowiki>], which only shows "404 Not Found".
**The anchor actually contains invalid HTML <nowiki><a href=" [AT THE JULY 28TH MEETING][tab] "Cancel the meeting! Our cover is blown.""></nowiki>. This would suggest that [[Randall]] didn't intend this behaviour.
**The image and alt text were later corrected, long before July 28th, 2019, further implying it was a simple mistake on Randall's part.
*Some browsers, only show the first part of the title text "WE WILL ARREST THE REVOLUTION MEMBERS." For example Firefox version 66 Windows does this, evidently some versions of Firefox and chrome do likewise on GNU/Linux, also Windows 10 Microsoft Edge

{{comic discussion}}

[[Category:Comics featuring Cueball]]

1925: Self-Driving Car Milestones

2019-09-18T04:01:05Z

Tbodt: /* Milestones */

{{comic
| number = 1925
| date = December 6, 2017
| title = Self-Driving Car Milestones
| image = self_driving_car_milestones.png
| titletext = I'm working on a car capable of evaluating arbitrarily complex boolean expressions on "honk if [...]" bumper stickers and responding accordingly.
}}

==Explanation==
With the creation of self driving cars, many new milestones are being found and / or solved thanks to them. Some are good, and some are downright weird. This comic lists some that have already been achieved, some that that are being worked on, and some that are facetious "milestones".

===Milestones===

;Automatic emergency brakes
:This is another reference to how hard it can be to program human-obvious stuff (as in [[1425: Tasks]]). A self driving car has to be able to distinguish a danger (cliff, person on foot/cycle/etc., other cars coming the wrong way/doing weird stuff) from the side of the road, the background, the other cars or even a light pole safely standing on the side of the road. Then the car also has to decide the optimal response, taking into account weather conditions, road type and traffic - whether to turn aside, just slow down (as danger is not imminent), or actually do the strong brake. There are big potential advantages for self-driving cars, if this problem can be solved: computers don't tend to panic as much as humans, would have faster reaction times, and would have {{w|Autonomous_car#Safety|more reliable judgment}}. (Done)

;Highway lane-keeping
:Sometimes, especially on highways where road delimitations might be [https://upload.wikimedia.org/wikipedia/commons/thumb/1/11/Route_66_2073773569_7b3fae3b91_b.jpg/220px-Route_66_2073773569_7b3fae3b91_b.jpg faint or absent], or when lane markings could have faded away, a self-driving car programmed to pilot based on road markings would have issues holding to the correct side of the road. This is a bigger problem on highways than in cities, as cars move faster on highways, so the danger detection mentioned above might not manage to detect danger in time, while braking or avoiding the obstacle needs to be anticipated much more.(Done)

;Self-parking
:Already implemented in recent normal cars, this feature is important to remove the car from the road while not in use, and is sometimes considered a difficult maneuver for drivers to master, as it requires a good "feeling" of the car dimensions, as well as of distances and maneuverability of the car, and information about surrounding barriers. The latter parameters, being easy to sense with radar and back-camera aide, are made more reliable with computers.(Done)

;Full highway autonomy
:The ability for a car to drive itself on a highway. As of 2017, there are [http://www.popularmechanics.com/technology/infrastructure/a13615577/self-driving-cars-lane-wisconsin/ plans] under consideration to set highway lanes aside for self-driving cars, but this milestone would require a car to be able to operate on a highway that also has human-driven cars, as well as wildlife, pedestrians, debris, and other obstacles, should they enter the highway.(Done with restrictions)

;First sex in a self-driving car
:This is not a milestone for the cars themselves, but just the age-old practice of having sex in cars, performed in a car that happens to be self-driving. Whether or not this would happen while the car is in motion (other than that induced by the passengers) or on a public road is not specified, though both are implied. Given the nature of human sexuality, it is probable this has already happened. In May of 2019, a video featuring coitus occurring in a Tesla model X on Autopilot went viral on Pornhub.

;Full trips with no input from driver
:The main point of self-driving cars, allowing all humans within to act as passengers. As of 2017, self-driving cars require a human to be able to take over just in case, but any such trip where the human never actually took control would qualify for this milestone. However, there could be an additional joke here that the car is driving without human input ''including the destination.'' In this case, the car itself is choosing where to go, leaving the humans helpless.

;Full trips by empty cars
:A more complete version of the above, since with no humans present, no human can take control. This could be considered fulfilled by the {{w|DARPA Grand Challenge}} entrants, as the challenges are racing competitions of autonomous cars with no humans on board.

;Self-refueling of empty cars
:This would require either: a robotic fuel station, able to refuel cars with humans inside as well; an ordinary full-service fuel station (that is, one where the station's employee performs the refueling of the car) that happens to service a self-driving car with no humans aboard (which could be arranged as a publicity stunt); a specially designed fuel station that would allow self-driving cars to refuel by docking to it (likely to require fine control of the docking procedure that would render it unsuitable for more fallible human-driven cars); or, perhaps least likely, a robotic arm attachment on the car that would allow it to use a normal self-service fuel station. Currently [https://www.theverge.com/2015/8/6/9109027/tesla-model-s-snake-charger-elon-musk Tesla's robotic charging station] is the closest thing to this accomplishment.

;An empty car wandering the highways for months or years until someone notices the credit card fuel charges
:The first completely facetious milestone of the list (since "first sex", despite having little to do with self-driving cars, has probably happened). Cars are expensive enough that, were one to drive itself off and wander, some effort would be made to track it down. As this would require the self-refueling milestone, local fuel stations could be alerted to look for the "rogue" car—and in any case, whatever payment method is used to pay for the fuel would be traced.

;Cars that read other cars' bumper stickers before deciding whether to cut them off
:Another facetious milestone, implying self-driving cars might obtain the capacity to hold and act upon opinions that might override safety and efficiency of transit. This would be generally considered undesirable{{Citation needed}}, so this seems unlikely to actually happen, except perhaps as an unintended consequence of runaway self-learning.

;Autonomous engine revving at red lights
:Mimicking the human practice. This is often done by human drivers who wish to draw attention to their car and then speed off as quickly as possible once the light turns green, but is regarded by most as being a nuisance. As such, this is an unlikely goal for self-driving cars to achieve.

;Self-loathing cars
:This would require cars to become sentient enough to understand, and have negative opinions about, themselves. Depending on one's definition, though, self-diagnostic software might qualify, as they would be running on a car's computer and could express a negative opinion about the car (albeit normally limited to the context of the car needing maintenance).

;Autonomous canyon jumping
:Although it seems unlikely that a navigation routine would ever decide that jumping a canyon is part of an optimal route, a car could be programmed to jump a canyon as part of a stunt or show, with no human driver (or any other human aboard) at the time of the jump. It is questionable how "autonomous" such a car would be, though. Could also be a reference to the next point, with another popular setting in below mentioned discussions: "should a self-driving car leave the road and drive into a canyon, which will kill the driver (and passengers), or stay on the road and kill others?". Possibly a reference to [https://electrek.co/2017/04/19/tesla-model-s-crash-cliff-save-life/ when a Tesla was driven off a cliff] and the driver and his passenger survived without injury. The car was not on autopilot at the time. Could also be a reference to the previous point where the car develops enough self-loathing to want to commit suicide. Or it may be a reference to [http://www.imdb.com/title/tt0620882/ certain Knight Rider episodes.]

;Cars capable of arguing about the trolley problem on {{w|Facebook}}
:The {{w|Trolley problem}} is a well-known thought experiment in ethics, in which a person must choose between passively allowing several people to die, or actively causing a single person to die. With the increasing likelihood of fully autonomous vehicles, there's been a flurry of interest in this problem, centered around what a vehicle should be programmed to do in such a case (for example, if avoiding a high-speed collision required running over a pedestrian). Munroe seems to mock this debate by arguing that the true milestone would not be when the vehicle can make such a decision, but when it can argue about it on Facebook. This may refer to the idea that humans aren't capable of agreeing on a resolution to the problem, so expecting a vehicle to resolve it would be less reasonable than expecting it to be able to debate. On the day this comic was released the Youtube channel Vsauce posted a video, [https://youtu.be/1sl5KJ69qiA The Greater Good - Mind Field S2 (Ep 1)], where they tested people's reactions to the trolley problem in a fake situation where the subjects genuinely believed they were in a situation where they where choosing between saving five from an oncoming train by killing one on another track. Given such a coincidence, it is extremely likely that this milestone was added after Munroe saw the episode.

;Evaluating arbitrarily complex Boolean expressions on "honk if [...]" bumper stickers and responding accordingly (title text)
:As with the cut-off milestone, this implies development of artificial intelligence unrelated to the basic functions of a car, though still imitating human drivers' behavior. This joke is a reference to [[1033| a previous comic about honking and formal logic]].

==Transcript==

:Upcoming and recently-achieved
:'''Self-driving car milestones'''

:* Automatic emergency braking
:* Highway lane-keeping
:* Self-parking
:* Full highway autonomy
:* First sex in a self-driving car
:* Full trips with no input from driver
:* Full trips by empty cars
:* An empty car wandering the highways for months or years until someone notices the credit card fuel charges
:* Cars that read other cars' bumper stickers before deciding whether to cut them off
:* Autonomous engine revving at red lights
:* Self-loathing cars
:* Autonomous canyon jumping
:* Cars capable of arguing about the trolley problem on Facebook

==Trivia==
*The Trolley problem became part of the joke a month after this comic in [[1938: Meltdown and Spectre]]. And earlier, in [[1455: Trolley Problem]], it is even the entire subject.

{{comic discussion}}

[[Category:Self-driving cars]]
[[Category:Sex]]

1644: Stargazing

2019-09-16T07:39:03Z

Tbodt:

{{comic
| number = 1644
| date = February 17, 2016
| title = Stargazing
| image = stargazing.png
| titletext = Some of you may be thinking, 'But wait, isn't the brightest star in our sky the Sun?' I think that's a great question and you should totally ask it. On the infinite tree of possible conversations spread out before us, I think that's definitely the most promising branch.
}}

==Explanation==
This is the first comic in the [[:Category:Stargazing|Stargazing]] series. It was followed by [[2017: Stargazing 2]] two and a half years later.

This comic opens on a host for a '''{{w|stargazing}}''' TV show, or simply a stargazing tour. She claims to be a doctor in {{w|astronomy}} though herr remarks, however enthusiastic, may call this into question.

Throughout the comic the host's tone and choice of words becomes increasingly unprofessional, referring to most of the stars as "shitty," personifying them based on different astronomical observations, and providing little useful information on the study of stars or how they work.

It seems that this is not an isolated issue as the television host mentions that people keep asking him whether or not she is a real astronomer.

Throughout the comic the television host continuously glosses over the arguably less exciting portions of a typical presentation on astronomy sharing only what he sees as "the good stuff." This penchant for only caring about something if it is interesting extends past astronomy as well as the host is too bored when reading the dictionary to look up the meaning of astronomer.

The comic derives much of its humor from the absurdity of the host's comments on various astronomical bodies. Although not technically incorrect, the way she presents the information is far from informative. (See details below on [[#The host's observations|the host's observations]]).

One of her observations regards the fact that {{w|Sirius}} is a {{w|binary star}}, a system where two stars orbit each other. So even though it is the brightest star as seen from Earth we only really see one of them, as the other is, to quote the host, "not even trying". Sirius A is "large" and "bright" {{w|main sequence}} white star, while Sirius B is a {{w|white dwarf}} with a little under half the mass, 0.49% the radius and only 0.22% the luminosity of Sirius A.

{{w|Andromeda Galaxy|Andromeda}} is the largest galaxy in our {{w|Local Group}}. It is 220,000 light years across and contains a trillion stars. Humans have difficulty conceptualizing distances of this scale. Suffice to say that it is very large.

{{w|Betelgeuse}} is the 9th brightest star visible from earth. One of its prominent features is its visible redness. Within the next million years it is expected to explode as a {{w|supernova}}, which will certainly be a spectacular sight.

In the title text it is mentioned that the {{w|Sun}} is also a star and of course is much brighter than Sirius seen from Earth, and thus Sirius is technically not the brightest star in our sky (although it is in the night sky). The title text sarcastically encourages the audience to raise that obvious but irrelevant point (a standard joke when people mentions bright stars) instead of asking a more interesting, informative, or fruitful question, when there are so many to ask regarding astronomy.

Alternatively, she might not be sarcastic, but applauding the joker for lateral thinking.

See also [[1371: Brightness]] and [[1342: Ancient Stars]]. Saying cool things about space to make people like you is mentioned in [[1746: Making Friends]].

===The host's observations===
Here is a list of the host's observations:
*Most {{w|Bright Star Catalogue|visible stars}} are still very faint, and just becomes background to the bright {{w|stars}} that form the named {{w|constellations}}.
**The host correctly states that they are just dots. (This is also true for the bright stars, but at least they are clearly distinguishable).
*{{w|Sirius}} is the {{w|Apparent magnitude|brightest}} star in our {{w|List of brightest stars|night sky}}. But it is not the brightest object in the night sky, as several of the planets, especially {{w|Venus}} and {{w|Jupiter}}, and of course the {{w|Moon}} are much brighter. It is also far from being one of the most {{w|Absolute magnitude|luminous star}} in the {{w|Milky Way}}, but its proximity to Earth makes it the brightest in the night sky. There are {{w|List_of_most_luminous_stars#Data|twenty visible stars}} that are more luminous than Sirius, {{w|List of most luminous stars|none of which}} come even close to being in the top 100 of the most luminous stars observed today.
**The host thus names Sirius as the star in charge since it outshines all the others as seen from the {{w|Earth}}.
*Sirius is actually a star system consisting of two stars as it is a {{w|binary star}} system. But where Sirius A is twice the size of the {{w|Sun}} and much brighter, then Sirius B is now just a dim {{w|white dwarf}}, the remains from a much larger star that became a {{w|red giant}} before shedding its outer layers and collapsing into its current state around 120 million years ago. So now Sirius A completely outshines Sirius B, which actually is now a dead star with no further fusion going on inside its core.
**This is construed by the host as it is barely even trying, as it is now only radiating away the rest of the heat from the now exposed core.
*{{w|Andromeda Galaxy|Andromeda}} is a {{w|spiral galaxy}}, like the Milky Way, and it is the largest galaxy in the {{w|Local Group}} where our own galaxy the Milky Way is the second largest. It is one of a few visible objects that are located outside the Milky Way. It is "only" 2.5 million light-years from the Sun and it is heading our way (or vice versa), and will {{w|Andromeda–Milky Way collision|collide with the Milky way}} in about 4 billion years (before the Sun goes into {{w|Sun#After_core_hydrogen_exhaustion|its red giant phase}}). Being 220,000 light years across and consisting of a trillion stars, it is somewhere between 1.2-2.2 times wider than the Milky Way and has 2.5-10 times as many stars. (The local group was also mentioned two comics ago, in [[1642: Gravitational Waves]], together with the much less well known third largest galaxy in the group the {{w|Triangulum Galaxy}}).
**It is therefore true when the host says that it is too big to try to understand, and thinking about it will make your head spin, so she suggests we do not think about it.
*{{w|Betelgeuse}} is a clearly visible (9th brightest) {{w|Red_supergiant|red supergiant}} {{w|Semiregular_variable_star|variable star}} located in the {{w|Orion (constellation)|constellation of Orion}}. It is one of the largest and most luminous observable stars (12th) and one of the few where it is clear that the light is not white. Most people can see that it is slightly red, whereas most other stars are so faint that they look white despite having different colors (when seeing Orion's two brightest stars, to remember which is which between Rigel and Betelgeuse, its diagonal opposite, just remember: Rigel is "R" like blue, and Betelgeuse is "B" like red). It is expected that Betelgeuse, being at a late stage of its {{w|Stellar_evolution|evolution}}, {{w|Betelgeuse#Approaching_supernova|will go supernova}} within the next million years as a {{w|type II supernova}}. The exact time when it will become a {{w|Supernova}} is so uncertain that it could [http://earthsky.org/brightest-stars/betelgeuse-will-explode-someday#explode just as likely happen tomorrow] as in a million years. When it happens it will not be dangerous to anyone on Earth, but it will likely be visible even during the day, as it may even become as bright as the full Moon.
**When it does go nova, it will be a fantastic spectacle for everyone, but especially for anyone who likes the ''good stuff'' in space like the host, who cannot wait for the star to explode. Clearly he hopes it will be in his lifetime, and, although this is unlikely, there is a small chance that it might just happen.
*A {{w|meteor}} (also known as {{w|shooting star}}), is debris from space that rains down on Earth, and burns up in the atmosphere. This happens all the time, but you need to be either lucky, patient, or know the right time for one of the {{w|meteor showers}} to see one. Often they are visible for so short a time period, that it is difficult to share the experience with anyone, as it will be gone by the time they turn their head to look where you are pointing.
**The host becomes very excited when she spots such a meteor, especially because it is likely that her audience got to share the experience with him, as they were already looking in the same direction as he. But still she asks if they saw it, because it is so short lived.
*{{w|Outer space}} is the void that exists between {{w|Astronomical object|celestial bodies}}, including the Earth. There is by definition nothing there but {{w|vacuum}}, and the interesting part of space is thus not the space but the astronomical objects found out there.
**The host says that ''space is cool'', which is a very un-astronomical comment, as explained above. Also her excitement for a simple shooting star is cause for the suspicion that is raised after his space comment.

===Relevant TV-shows===
The comic could be a reference to BBC's ''{{w|Stargazing Live}}'', which {{w|Brian Cox (physicist)|Brian Cox}} has appeared in since 2011. If drawn in xkcd style he would likely look like Megan. He has a PhD in high-energy {{w|particle physics}}, but not astronomy. The newest season of the show aired during January 2016 just a month before this comic's release. Brian Cox has also been the presenter of several other science programs, especially such as the ''{{w|Wonders of the Solar System}}'', ''{{w|Wonders of the Universe}}'' and ''{{w|Wonders of Life (TV series)|Wonders of Life}}''.

It could also be a reference to {{w|Jack Horkheimer}}'s PBS shows ''Star Hustler'' and ''{{w|Star Gazers}}''. Horkheimer, however, does not at all look like Megan, and he died 6 years ago. But he was not a doctor in astronomy, only getting into it when he started volunteering at the Miami Museum of Science's planetarium. He ended up writing shows for the planetarium and the PBS series developed from there. He rarely covered facts about the night sky that couldn't be found in any basic reference (possibly because the show was aimed at children and non-astronomy buffs), although he did get more in-depth about current astronomical events such as {{W|Comet Hale–Bopp}}.

==Transcript==
:[A thin panel where a TV-host, holding her hands up, is drawn in white on a black background. Behind him is an audience drawn in faint gray lines consisting of Hairy (to the left) and two Cueball-like guys and Ponytail (seen in a rare full face position) to the right of the host. One of the Cueball-like guys is partly hidden behind the host.]
:Host: Welcome to stargazing, with your host, me.
:Host: I'm a doctor or whatever.

:[Same scene as before but in a broader panel, and the host is now holding only one hand up with a finger pointing up. The audience is the same four people, but now Hairy has moved further to the left in the panel to make room for Megan also to the left of the host.]
:Host: I'm not gonna waste your time on the shitty stars.
:Host: Just the good stuff.
:Host: Honestly half of 'em just look like dots.

:[A frame-less drawing with a zoom out showing the group of six people in black silhouette on a white background. Part of the ground beneath them is shown as a black pool. The host is pointing up with one hand. The people have been rearranged, so left of the host is now a Cueball-like guy and Megan, and to the right is the other Cueball-like guy, then Ponytail (seen from the side as usual) and Hairy. All are looking up following the host's directions.]
:Host: This is Sirius. It's the brightest star in our sky so it's in charge.
:Host: It's really two stars but one of them is barely even trying.
:Host: This is Andromeda, it's too big to think about, so let's not.

:[Zoom in of the host's upper body, again drawn in white on a black background. She is looking right gesturing with one arm raised, and the other still pointing up with a finger stretched out. Her audience is no longer shown.]
:Host: That red stars is Betelgeuse. It's gonna explode someday.
:Host: Can't happen soon enough, as far as I'm concerned. I-
:Host: ''Holy shit did you see that meteor!?!''
:Host: Space is ''awesome!''

:[Same scene as the previous panel, but the host has turned towards left looking at someone in the audience (not shown) who speaks off-screen. She has taken both her hands down for the first time.]
:Off-screen voice: Are you ''sure'' you're an astronomer?
:Host: People keep asking that, so I finally tried to look that word up in a dictionary, and ''wow'' is that book ever boring. No thank you.
:Off-screen voice: But-
:Host: ''Space!''

==Trivia==
*Randall changed the [http://www.explainxkcd.com/wiki/images/archive/4/48/20160221022727!stargazing.png original] posted version of the comic.
**The only thing that changed was in the third panel where '''''That's''' Andromeda'' was changed to the current version: '''''This is''' Andromeda''
*The official transcript originally used male pronouns for the TV host. It now (as of 2019) uses female pronouns.
**The official transcript seems to have been messed up on xkcd at the time being.
***The [http://xkcd.com/1644/info.0.json transcript for 1644] is thus at the moment a mix of that comics main info (top and bottom) which results in the correct title and title text, but the entire description in this transcript is describing the comic from two releases before no. [[1642]].
***This seems to be a general problem for recent comics...
***Thus the description of this comic, was first released when comic no. [[1646]] came out (today when this was written).
***This probably will be corrected later? But at this moment the official transcript for 1644 can be found together with the [http://xkcd.com/1646/info.0.json data for comic 1646].
**The transcript is included here below due to the issues with xkcd's transcript at the current time (correcting a typo with a missing "s" in "stuff" and formatting to look like our normal transcripts):
::[A television host in the foreground, speaking toward the reader. A group of other people are in the background behind them.]
::Host: Welcome to Stargazing, with your host, me. I'm a doctor or whatever.
::[He continues to talk.]]
::Host: I'm not gonna waste your time on the shitty stars. Just the good stuff. Honestly half of 'em just look like dots.
::[Normal color panel - black on white. A shot from far away of the host standing in the center of the group of people watching him, he points to the sky.]
::Host: This is Sirius. It's the brightest star in our sky so it's in charge. It's really two stars, but one of them is barely even trying. This is Andromeda. It's too big to think about, so let's not.
::[Inverse color panel. Close-up on the host gesturing toward the sky behind him.]
::Host: That red star is Betelgeuse. It's gonna explode someday. Can't happen soon enough, as far as I'm concerned. I-- ''HOLY SHIT DID YOU SEE THAT METEOR?!?!'' Space is ''awesome''!
::[The host speaks to someone out of panel.]
::Other: Are you ''sure'' you're an astronomer?
::Host: People keep asking that, so I finally tried to look that word up in a dictionary, and ''wow'' is that book ever boring. No ''thank'' you.
::Other: But--
::Host: ''SPACE!''

{{comic discussion}}
[[Category:Stargazing|Stargazing]]
[[Category:Comics sharing name|Stargazing]]
[[Category:Comics with inverted brightness]]
[[Category:Comics featuring Hairy]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring Megan]]
[[Category:Multiple Cueballs]]
[[Category:Astronomy]]
[[Category:Space]]

1644: Stargazing

2019-09-16T07:38:35Z

Tbodt: Checked the transcript and it now uses female pronouns.

{{comic
| number = 1644
| date = February 17, 2016
| title = Stargazing
| image = stargazing.png
| titletext = Some of you may be thinking, 'But wait, isn't the brightest star in our sky the Sun?' I think that's a great question and you should totally ask it. On the infinite tree of possible conversations spread out before us, I think that's definitely the most promising branch.
}}

==Explanation==
This is the first comic in the [[:Category:Stargazing|Stargazing]] series. It was followed by [[2017: Stargazing 2]] two and a half years later.

This comic opens on a host for a '''{{w|stargazing}}''' TV show, or simply a stargazing tour. She claims to be a doctor in {{w|astronomy}} though herr remarks, however enthusiastic, may call this into question. (Although the host is drawn like [[Megan]], it is a male television host according to the official transcript on xkcd – see the [[#Trivia|trivia section]]. Also see a list of [[#Relevant TV-shows|TV host]] below that this comic could could be based on. The most likely host has long hair and would look like Megan).

Throughout the comic the host's tone and choice of words becomes increasingly unprofessional, referring to most of the stars as "shitty," personifying them based on different astronomical observations, and providing little useful information on the study of stars or how they work.

It seems that this is not an isolated issue as the television host mentions that people keep asking him whether or not she is a real astronomer.

Throughout the comic the television host continuously glosses over the arguably less exciting portions of a typical presentation on astronomy sharing only what he sees as "the good stuff." This penchant for only caring about something if it is interesting extends past astronomy as well as the host is too bored when reading the dictionary to look up the meaning of astronomer.

The comic derives much of its humor from the absurdity of the host's comments on various astronomical bodies. Although not technically incorrect, the way she presents the information is far from informative. (See details below on [[#The host's observations|the host's observations]]).

One of her observations regards the fact that {{w|Sirius}} is a {{w|binary star}}, a system where two stars orbit each other. So even though it is the brightest star as seen from Earth we only really see one of them, as the other is, to quote the host, "not even trying". Sirius A is "large" and "bright" {{w|main sequence}} white star, while Sirius B is a {{w|white dwarf}} with a little under half the mass, 0.49% the radius and only 0.22% the luminosity of Sirius A.

{{w|Andromeda Galaxy|Andromeda}} is the largest galaxy in our {{w|Local Group}}. It is 220,000 light years across and contains a trillion stars. Humans have difficulty conceptualizing distances of this scale. Suffice to say that it is very large.

{{w|Betelgeuse}} is the 9th brightest star visible from earth. One of its prominent features is its visible redness. Within the next million years it is expected to explode as a {{w|supernova}}, which will certainly be a spectacular sight.

In the title text it is mentioned that the {{w|Sun}} is also a star and of course is much brighter than Sirius seen from Earth, and thus Sirius is technically not the brightest star in our sky (although it is in the night sky). The title text sarcastically encourages the audience to raise that obvious but irrelevant point (a standard joke when people mentions bright stars) instead of asking a more interesting, informative, or fruitful question, when there are so many to ask regarding astronomy.

Alternatively, she might not be sarcastic, but applauding the joker for lateral thinking.

See also [[1371: Brightness]] and [[1342: Ancient Stars]]. Saying cool things about space to make people like you is mentioned in [[1746: Making Friends]].

===The host's observations===
Here is a list of the host's observations:
*Most {{w|Bright Star Catalogue|visible stars}} are still very faint, and just becomes background to the bright {{w|stars}} that form the named {{w|constellations}}.
**The host correctly states that they are just dots. (This is also true for the bright stars, but at least they are clearly distinguishable).
*{{w|Sirius}} is the {{w|Apparent magnitude|brightest}} star in our {{w|List of brightest stars|night sky}}. But it is not the brightest object in the night sky, as several of the planets, especially {{w|Venus}} and {{w|Jupiter}}, and of course the {{w|Moon}} are much brighter. It is also far from being one of the most {{w|Absolute magnitude|luminous star}} in the {{w|Milky Way}}, but its proximity to Earth makes it the brightest in the night sky. There are {{w|List_of_most_luminous_stars#Data|twenty visible stars}} that are more luminous than Sirius, {{w|List of most luminous stars|none of which}} come even close to being in the top 100 of the most luminous stars observed today.
**The host thus names Sirius as the star in charge since it outshines all the others as seen from the {{w|Earth}}.
*Sirius is actually a star system consisting of two stars as it is a {{w|binary star}} system. But where Sirius A is twice the size of the {{w|Sun}} and much brighter, then Sirius B is now just a dim {{w|white dwarf}}, the remains from a much larger star that became a {{w|red giant}} before shedding its outer layers and collapsing into its current state around 120 million years ago. So now Sirius A completely outshines Sirius B, which actually is now a dead star with no further fusion going on inside its core.
**This is construed by the host as it is barely even trying, as it is now only radiating away the rest of the heat from the now exposed core.
*{{w|Andromeda Galaxy|Andromeda}} is a {{w|spiral galaxy}}, like the Milky Way, and it is the largest galaxy in the {{w|Local Group}} where our own galaxy the Milky Way is the second largest. It is one of a few visible objects that are located outside the Milky Way. It is "only" 2.5 million light-years from the Sun and it is heading our way (or vice versa), and will {{w|Andromeda–Milky Way collision|collide with the Milky way}} in about 4 billion years (before the Sun goes into {{w|Sun#After_core_hydrogen_exhaustion|its red giant phase}}). Being 220,000 light years across and consisting of a trillion stars, it is somewhere between 1.2-2.2 times wider than the Milky Way and has 2.5-10 times as many stars. (The local group was also mentioned two comics ago, in [[1642: Gravitational Waves]], together with the much less well known third largest galaxy in the group the {{w|Triangulum Galaxy}}).
**It is therefore true when the host says that it is too big to try to understand, and thinking about it will make your head spin, so she suggests we do not think about it.
*{{w|Betelgeuse}} is a clearly visible (9th brightest) {{w|Red_supergiant|red supergiant}} {{w|Semiregular_variable_star|variable star}} located in the {{w|Orion (constellation)|constellation of Orion}}. It is one of the largest and most luminous observable stars (12th) and one of the few where it is clear that the light is not white. Most people can see that it is slightly red, whereas most other stars are so faint that they look white despite having different colors (when seeing Orion's two brightest stars, to remember which is which between Rigel and Betelgeuse, its diagonal opposite, just remember: Rigel is "R" like blue, and Betelgeuse is "B" like red). It is expected that Betelgeuse, being at a late stage of its {{w|Stellar_evolution|evolution}}, {{w|Betelgeuse#Approaching_supernova|will go supernova}} within the next million years as a {{w|type II supernova}}. The exact time when it will become a {{w|Supernova}} is so uncertain that it could [http://earthsky.org/brightest-stars/betelgeuse-will-explode-someday#explode just as likely happen tomorrow] as in a million years. When it happens it will not be dangerous to anyone on Earth, but it will likely be visible even during the day, as it may even become as bright as the full Moon.
**When it does go nova, it will be a fantastic spectacle for everyone, but especially for anyone who likes the ''good stuff'' in space like the host, who cannot wait for the star to explode. Clearly he hopes it will be in his lifetime, and, although this is unlikely, there is a small chance that it might just happen.
*A {{w|meteor}} (also known as {{w|shooting star}}), is debris from space that rains down on Earth, and burns up in the atmosphere. This happens all the time, but you need to be either lucky, patient, or know the right time for one of the {{w|meteor showers}} to see one. Often they are visible for so short a time period, that it is difficult to share the experience with anyone, as it will be gone by the time they turn their head to look where you are pointing.
**The host becomes very excited when she spots such a meteor, especially because it is likely that her audience got to share the experience with him, as they were already looking in the same direction as he. But still she asks if they saw it, because it is so short lived.
*{{w|Outer space}} is the void that exists between {{w|Astronomical object|celestial bodies}}, including the Earth. There is by definition nothing there but {{w|vacuum}}, and the interesting part of space is thus not the space but the astronomical objects found out there.
**The host says that ''space is cool'', which is a very un-astronomical comment, as explained above. Also her excitement for a simple shooting star is cause for the suspicion that is raised after his space comment.

===Relevant TV-shows===
The comic could be a reference to BBC's ''{{w|Stargazing Live}}'', which {{w|Brian Cox (physicist)|Brian Cox}} has appeared in since 2011. If drawn in xkcd style he would likely look like Megan. He has a PhD in high-energy {{w|particle physics}}, but not astronomy. The newest season of the show aired during January 2016 just a month before this comic's release. Brian Cox has also been the presenter of several other science programs, especially such as the ''{{w|Wonders of the Solar System}}'', ''{{w|Wonders of the Universe}}'' and ''{{w|Wonders of Life (TV series)|Wonders of Life}}''.

It could also be a reference to {{w|Jack Horkheimer}}'s PBS shows ''Star Hustler'' and ''{{w|Star Gazers}}''. Horkheimer, however, does not at all look like Megan, and he died 6 years ago. But he was not a doctor in astronomy, only getting into it when he started volunteering at the Miami Museum of Science's planetarium. He ended up writing shows for the planetarium and the PBS series developed from there. He rarely covered facts about the night sky that couldn't be found in any basic reference (possibly because the show was aimed at children and non-astronomy buffs), although he did get more in-depth about current astronomical events such as {{W|Comet Hale–Bopp}}.

==Transcript==
:[A thin panel where a TV-host, holding her hands up, is drawn in white on a black background. Behind him is an audience drawn in faint gray lines consisting of Hairy (to the left) and two Cueball-like guys and Ponytail (seen in a rare full face position) to the right of the host. One of the Cueball-like guys is partly hidden behind the host.]
:Host: Welcome to stargazing, with your host, me.
:Host: I'm a doctor or whatever.

:[Same scene as before but in a broader panel, and the host is now holding only one hand up with a finger pointing up. The audience is the same four people, but now Hairy has moved further to the left in the panel to make room for Megan also to the left of the host.]
:Host: I'm not gonna waste your time on the shitty stars.
:Host: Just the good stuff.
:Host: Honestly half of 'em just look like dots.

:[A frame-less drawing with a zoom out showing the group of six people in black silhouette on a white background. Part of the ground beneath them is shown as a black pool. The host is pointing up with one hand. The people have been rearranged, so left of the host is now a Cueball-like guy and Megan, and to the right is the other Cueball-like guy, then Ponytail (seen from the side as usual) and Hairy. All are looking up following the host's directions.]
:Host: This is Sirius. It's the brightest star in our sky so it's in charge.
:Host: It's really two stars but one of them is barely even trying.
:Host: This is Andromeda, it's too big to think about, so let's not.

:[Zoom in of the host's upper body, again drawn in white on a black background. She is looking right gesturing with one arm raised, and the other still pointing up with a finger stretched out. Her audience is no longer shown.]
:Host: That red stars is Betelgeuse. It's gonna explode someday.
:Host: Can't happen soon enough, as far as I'm concerned. I-
:Host: ''Holy shit did you see that meteor!?!''
:Host: Space is ''awesome!''

:[Same scene as the previous panel, but the host has turned towards left looking at someone in the audience (not shown) who speaks off-screen. She has taken both her hands down for the first time.]
:Off-screen voice: Are you ''sure'' you're an astronomer?
:Host: People keep asking that, so I finally tried to look that word up in a dictionary, and ''wow'' is that book ever boring. No thank you.
:Off-screen voice: But-
:Host: ''Space!''

==Trivia==
*Randall changed the [http://www.explainxkcd.com/wiki/images/archive/4/48/20160221022727!stargazing.png original] posted version of the comic.
**The only thing that changed was in the third panel where '''''That's''' Andromeda'' was changed to the current version: '''''This is''' Andromeda''
*The official transcript originally used male pronouns for the TV host. It now (as of 2019) uses female pronouns.
**The official transcript seems to have been messed up on xkcd at the time being.
***The [http://xkcd.com/1644/info.0.json transcript for 1644] is thus at the moment a mix of that comics main info (top and bottom) which results in the correct title and title text, but the entire description in this transcript is describing the comic from two releases before no. [[1642]].
***This seems to be a general problem for recent comics...
***Thus the description of this comic, was first released when comic no. [[1646]] came out (today when this was written).
***This probably will be corrected later? But at this moment the official transcript for 1644 can be found together with the [http://xkcd.com/1646/info.0.json data for comic 1646].
**The transcript is included here below due to the issues with xkcd's transcript at the current time (correcting a typo with a missing "s" in "stuff" and formatting to look like our normal transcripts):
::[A television host in the foreground, speaking toward the reader. A group of other people are in the background behind them.]
::Host: Welcome to Stargazing, with your host, me. I'm a doctor or whatever.
::[He continues to talk.]]
::Host: I'm not gonna waste your time on the shitty stars. Just the good stuff. Honestly half of 'em just look like dots.
::[Normal color panel - black on white. A shot from far away of the host standing in the center of the group of people watching him, he points to the sky.]
::Host: This is Sirius. It's the brightest star in our sky so it's in charge. It's really two stars, but one of them is barely even trying. This is Andromeda. It's too big to think about, so let's not.
::[Inverse color panel. Close-up on the host gesturing toward the sky behind him.]
::Host: That red star is Betelgeuse. It's gonna explode someday. Can't happen soon enough, as far as I'm concerned. I-- ''HOLY SHIT DID YOU SEE THAT METEOR?!?!'' Space is ''awesome''!
::[The host speaks to someone out of panel.]
::Other: Are you ''sure'' you're an astronomer?
::Host: People keep asking that, so I finally tried to look that word up in a dictionary, and ''wow'' is that book ever boring. No ''thank'' you.
::Other: But--
::Host: ''SPACE!''

{{comic discussion}}
[[Category:Stargazing|Stargazing]]
[[Category:Comics sharing name|Stargazing]]
[[Category:Comics with inverted brightness]]
[[Category:Comics featuring Hairy]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Ponytail]]
[[Category:Comics featuring Megan]]
[[Category:Multiple Cueballs]]
[[Category:Astronomy]]
[[Category:Space]]

Talk:1350: Lorenz

2019-09-14T19:19:03Z

Tbodt: I suck at signatures

During the first few weeks there were so much talk on this page, that it became too long. The solution was to remove the page from the explanation. But now almost no one makes any comment anymore. To help with this I will try to collapse all the original talk - lat entry (mine) is already a month old. It will always be possible to see all the old comments by pressing the expand button to the far right. So feel free to comment below again - then someone might notice that there has been written something new again! [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 22:32, 19 June 2014 (UTC)

'''Click to expand:'''
<div class="mw-collapsible mw-collapsed leftAlign" style="width:100%">

I've had the story loop back to the first frame, so it wouldn't surprise me if this could go on infinitely if it had the available dialogue options.

This is going to be a hell of a thing. Good luck... [[User:H|H]] ([[User talk:H|talk]]) 15:39, 1 April 2014 (UTC)
:I think this is one of those times when the custom field might come in handy. Duplicating Randall's code seems like it might be difficult, and it might just be easier to link to the original page. Probably. '''[[User:Davidy22|{{Color|#707|David}}y²²]]'''[[User talk:Davidy22|<tt>[talk]</tt>]] 15:47, 1 April 2014 (UTC)b
::I think it should just show a screenshot of the initial image and options [[Special:Contributions/173.245.50.61|173.245.50.61]] 02:49, 2 April 2014 (UTC)
There's always new story lines, even when you think you've read them all, new ones appear to replace them. I don't think it'll ever be possible to record them all. [[Special:Contributions/108.162.212.192|108.162.212.192]] 15:55, 1 April 2014 (UTC)
:The text changes, but there are recurring themes with the panels. The rocket, the big hole, the little hole, Dinosaurcomics, pokemon, waking up, stranded swimming.........[[User:H|H]] ([[User talk:H|talk]]) 18:03, 1 April 2014 (UTC)

When I go to XKCD, all I see is the comic from Monday... weird. --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 16:45, 1 April 2014 (UTC)
:Same here... and a lot of space below it. [[User:Z|Z]] ([[User talk:Z|talk]]) 17:43, 1 April 2014 (UTC)
:: I think that happens when you have refreshed the page too many time -- kind of an anti spam for user submissions. I simply create an anonymous browser window and I got back to the real page once xkcd was not able to track me as a returning user. [[User:Spongebog|Spongebog]] ([[User talk:Spongebog|talk]]) 17:59, 1 April 2014 (UTC)

Currently there appears to be a bug. Instead of the evolving, crowd-sourced comic, I just see an off-center copy of the previous comic, 1349: Shouldn't Be Hard. [http://i.imgur.com/pw2OfOL.png Screenshot here].
UPDATE: it appears to be a bug in the XSRF-blocking code. Chrome console shows me the error "XMLHttpRequest cannot load http://c1.xkcd.com/graph/1/. The 'Access-Control-Allow-Origin' header has a value 'http://xkcd.com' that is not equal to the supplied origin. Origin 'http://www.xkcd.com' is therefore not allowed access."
FURTHER UPDATE: you can work around this bug by going to http://xkcd.com instead of http://www.xkcd.com!
It also doesn't work if you have HTTPS Everywhere enabled.
[[Special:Contributions/108.162.216.38|108.162.216.38]] 16:46, 1 April 2014 (UTC)

** I can confirm this bug in Firefox. Weirdly, the work-around functioned one time for me, but now going to "xkcd.com" rather than "www.xkcd.com" just gives me a copy of 1349 as well. [[Special:Contributions/199.27.130.180|199.27.130.180]] 17:40, 1 April 2014 (UTC)
:The workaround didn't work for me, I still got monday's comic on either URL. (Chromium 36.0.1919.0 (260611), Mac OS 10.9.2) [[User:Z|Z]] ([[User talk:Z|talk]]) 17:45, 1 April 2014 (UTC)
:Same here. Used IE and Firefox. Removed the "www." and haven't. (Never used https:// at all.) Tried InPrivate (and FF equivalent) browsers. Gone into the code and can't even fudge it manually from ''<nowiki><div id="comic"><img src="http://imgs.xkcd.com/comics/shouldnt_be_hard.png" title="Every choice, no matter how small, begins a new story." alt="Lorenz" /> <script type="text/javascript">Bernardo.comic({el: $('#comic')})
</script></div></nowiki>'', and the rest, manually. (Indeed, that shows why I get 1349's "shouldn't be hard" image, by default.) Pity. [[Special:Contributions/141.101.89.224|141.101.89.224]] 02:25, 2 April 2014 (UTC)

** I only get a blank page with on the bottom a link to the comic 1349. Both on 2 firefoxes (different systems) and a chromium. so however wonderfull it might be, the delivery is less then stellar. [[Special:Contributions/173.245.53.145|173.245.53.145]] 15:54, 10 April 2014 (UTC)

This comic introduced(?) a font of its own of Randalls comic type. I don't know if it has been sitting there for long, but I just noticed it: http://xkcd.com/fonts/xkcd-Regular.eot -- phiarc [[Special:Contributions/108.162.219.12|108.162.219.12]] 17:20, 1 April 2014 (UTC)
:Is it the same as was used in Externalities? [[User:H|H]] ([[User talk:H|talk]]) 18:00, 1 April 2014 (UTC)

Does everyone have these options in some order for the first tile?
*Refresh... No New Email... Refresh .. No New Tweets... Refresh...
*These Stupid Tiles... I'll Just Play One More Game
*Oh. Hey. There's Some Kind Of Politicial Thing Going On.
*Let's See If BSD Is Any Easier to Install Nowadays
--[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 17:54, 1 April 2014 (UTC)

http://xkcd.com/1350/#p:0cd52ed0-bb15-11e3-8004-002590d77bdd There's a frame with Chinese in it! [[Special:Contributions/141.101.99.118|141.101.99.118]] 18:06, 26 April 2015 (UTC)
:If so, we can begin to build a map of at least the first set of options before the crowd-sourced ones. --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 17:56, 1 April 2014 (UTC)
::Yes, though the second-tier options have changed [[User:H|H]] ([[User talk:H|talk]]) 18:00, 1 April 2014 (UTC)
:::The first level options may be constant (Im seeing the same as Jeff), but I suspect that the following options is based on some sort of ckick though statitics / machine learning -- which means that the will continue to change until Randall closes off the 'voting' -- if [http://www.explainxkcd.com/wiki/index.php/1193:_Externalities 1193: Externalities] is anything to go by that should be within the next 24-48 hours, at which point automating the collection of story lines may be possible. [[User:Spongebog|Spongebog]] ([[User talk:Spongebog|talk]]) 18:11, 1 April 2014 (UTC)
:::: I'm going to transcript some of what I get at least through the first few levels and then we can start with a list of options for those who don't want to go through them all. --[[User:Jeff|Jeff]] ([[User talk:Jeff|talk]]) 18:37, 1 April 2014 (UTC)
::::: I have no idea how one would do this, but it would be cool to render the transcript as a tree of some sort; having one vertical list will be hard to follow for more than a few decisions. [[Special:Contributions/199.27.130.180|199.27.130.180]] 00:14, 2 April 2014 (UTC)
::::::New initial option! I just got "Hurry! We're in talks with Facebook." In place of the "refresh" option. http://xkcd.com/1350/#p:2b330d48-bb01-11e3-8003-002590d77bdd --[[Special:Contributions/108.162.242.8|108.162.242.8]] 23:15, 3 April 2014 (UTC)

Ohh, this comic is buggy and the link here at the top gives just the page from Monday, showing errors on debuggers. But removing the WWW from URL helps. Further more I can't see that the result of the choices is dynamic. So let's prove this. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 19:33, 1 April 2014 (UTC)
: Have a look at http://www.explainxkcd.com/wiki/images/2/2b/lorenz_combination1.png and http://www.explainxkcd.com/wiki/images/9/9a/lorenz_combination2.png and you can see the option orders are changing -- this is a typical artifact of A/B testing where randomization of options is needed to avoid selection bias. I have futher observed "your car is on fire" instead of the "dinosaur" option, hence not only the orders are channging but the content as well -- maybe somebody else can capture this. [[User:Spongebog|Spongebog]] ([[User talk:Spongebog|talk]]) 22:08, 1 April 2014 (UTC)

How are new dialogue suggestions approved? Are they random, by popular vote (unlikely, not very many people would suggest the same thing), or is Randall approving them one by one? [[User:Z|Z]] ([[User talk:Z|talk]]) 20:26, 1 April 2014 (UTC)
: They may not need to be explicitly approved at all -- one of the beutiful things about click though measures is that the public '''votes''' for what is good by clicking -- this is also a factor in search ranking by your favorite search engine where statistics are driving the entire show -- in a search engine some input to the statistical process comes from the web pages, but other comes from what people are actually clicking [[User:Spongebog|Spongebog]] ([[User talk:Spongebog|talk]]) 22:14, 1 April 2014 (UTC)

What is this a screenshot of? It's zoomed out so far. http://xkcd.com/1350/#p:5b5bd04e-b9d6-11e3-8008-002590d77bdd [[User:Haithere|Haithere]] ([[User talk:Haithere|talk]]) 20:39, 1 April 2014 (UTC)
: you mean this : http://imgs.xkcd.com/comics/a1-2014/Rl92nFEWd9huvXABNkHKHg.png ? [[User:Spongebog|Spongebog]] ([[User talk:Spongebog|talk]]) 22:20, 1 April 2014 (UTC)
:: It appears to be a screen shot from a flight simulator program of some sort, however im not able to tell which, and since it is most likely an 'in-game' screen short we will never find out unless somebody else is playing this precises flight simulator program [[User:Spongebog|Spongebog]] ([[User talk:Spongebog|talk]]) 22:37, 1 April 2014 (UTC)
:: I am not certain, but I strongly suspect that is Kerbal Space Program {{unsigned ip|108.162.242.111}}
::: it really is Kerbal Space Program, or KSP for short {{unsigned ip|108.162.219.65}}
:::: found this image from KSP http://i.imgur.com/UofvQ.png [[User:Spongebog|Spongebog]] ([[User talk:Spongebog|talk]]) 09:07, 2 April 2014 (UTC)

A transcript is going to be futile. It appears as though the comic may go on indefinitely (I've definitely had some branches continue extending until I've seen frames that were present in other branches). I suspect what's happening here is that... options are "suggested", and those suggestions are displayed at random to people. The ones with the most clickthroughs begin to appear more often, until eventually the top 4 are "locked in" and no more suggestions can be made. Very creative! But I'm not convinced that Randall is making frames in near-real-time, nor am I even convinced he's part of the approval process at all. I suspect it's all automated. [[Special:Contributions/108.162.215.28|108.162.215.28]] 00:29, 2 April 2014 (UTC)

It seems it is possible to have the same option appear twice in the first panel. http://xkcd.com/1350/#p:be7a3304-b685-11e3-8001-94de80a03a29 --[[Special:Contributions/173.245.54.48|173.245.54.48]] 10:27, 2 April 2014 (UTC)
: They are not the same options -- the text differes where one option has "I'll" with a captal I and the other option is 'i'll' with a lowercase I -- I guess some prankster submitted a very similar text and somehow that got included. The branching also differs for the two options. [[User:Spongebog|Spongebog]] ([[User talk:Spongebog|talk]]) 17:12, 2 April 2014 (UTC)

Is it still supposed to work or was it turned off? All I see is Monday comics ... and no errors in firebug console. Oh, wait, there is javascript error:
Timestamp: 04/02/14 12:56:21
Error: TypeError: this.$lastPanel is null
Source File: http://xkcd.com/1350/bernardo.min.js
Line: 2 -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 11:03, 2 April 2014 (UTC)
: It still works for me -- try to clear your cookies or use an anonymous window or go to xkcd.com (no www no https) or some of the other helpful suggestions on this page to overcome some of the buggy nature of this page. [[User:Spongebog|Spongebog]] ([[User talk:Spongebog|talk]]) 17:12, 2 April 2014 (UTC)

tl;dr, but I applaud Randall's creativity. Added to the Colossal time sinks category. ''– [[User:Tbc|tbc]] ([[User talk:Tbc|talk]]) 13:15, 2 April 2014 (UTC)''

Has it restarted? It used to work just fine on my browser but now only the first panel is available, after clicking an option it said my suggestion has been submitted. Great when it works though, thanks Randal. Jet_proppeled_elephant[[Special:Contributions/108.162.219.35|108.162.219.35]] 14:53, 2 April 2014 (UTC)

It feels like there are a bunch of "dead-end panels", that we never really get past. One example the "bright background" strip, in which we only see the shadows of the two characters. Nobody seems to care what happens after those. [[Special:Contributions/108.162.245.8|108.162.245.8]] 18:59, 2 April 2014 (UTC)

I found a Dinosaur Comics reference, permalink: http://xkcd.com/1350/#p:3d243960-b9b6-11e3-8001-002590d77bdd
Has this been found before?
[[Special:Contributions/173.245.55.73|173.245.55.73]] 20:08, 2 April 2014 (UTC)

I don't have time to do it myself, but most of the space images from this path are not in the images page. http://xkcd.com/1350/#p:6490cc4a-b9f0-11e3-8009-002590d77bdd
[[User:Zweisteine|Zweisteine]] ([[User talk:Zweisteine|talk]]) 23:33, 2 April 2014 (UTC)
:Ok, I'm gonna add those. [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 23:38, 2 April 2014 (UTC)
Great! And now I found another: Pikachu uses Ethylene Dichloride. http://xkcd.com/1350/#p:6f59d766-ba95-11e3-8001-002590d77bdd
I'll add it to the but about pikachu in the comic, but the pictures are up to someone else.[[User:Zweisteine|Zweisteine]] ([[User talk:Zweisteine|talk]]) 23:47, 2 April 2014 (UTC)

Slightly different space path, in which the rocket expodes: http://xkcd.com/1350/#p:dd99ea0e-ba04-11e3-8017-002590d77bdd [[User:Zweisteine|Zweisteine]] ([[User talk:Zweisteine|talk]]) 23:59, 2 April 2014 (UTC)

:Good. I've finished adding all images that you mentioned. Also, the two last images of the slightly different space path were not in the images page, now I added them too. [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 00:14, 3 April 2014 (UTC)

Pikachu died! Radicality failed -> Pikachu in shock! http://xkcd.com/1350/#p:5c565bf2-ba05-11e3-8017-002590d77bdd --eternia 7:33, 3 April 2014 (UTC)
:Pikachu uses Graph Theory. How is that not effective?! http://xkcd.com/1350/#p:52f2389c-baaf-11e3-801f-002590d77bdd --eternia 7:47, 3 April 2014 (UTC)
::Pikachu uses Ant Colony. Uwah... http://xkcd.com/1350/#p:2b707ed6-ba97-11e3-8006-002590d77bdd --eternia 8:02, 3 April 2014 (UTC)
:::1 shark instead of 3. http://xkcd.com/1350/#p:9ba111ee-ba96-11e3-8004-002590d77bdd --eternia 8:14, 3 April 2014 (UTC)
::::0 sharks. http://xkcd.com/1350/#p:e0e4d984-baaf-11e3-8026-002590d77bdd --eternia 8:17, 3 April 2014 (UTC)
:::::I'm gonna add those too. [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 12:41, 3 April 2014 (UTC)

Are there any panels that have two speech bubbles that are not dead ends? It seems that there are never any options for the second bubble, and sometimes the first bubble has options that would fit in the second bubble after the other options for the first bubble. Maybe submissions for the second bubble accidentally end up in the first instead? Another bug? [[User:Zweisteine|Zweisteine]] ([[User talk:Zweisteine|talk]]) 23:56, 2 April 2014 (UTC)

There's a change for us still-bugged people (well, me at least). The "show previous comic" part is gone. It shows a blank area (instead of Comic 1349 and a blank area of the same size) and the page-source shows that the ''<nowiki><img src="http://imgs.xkcd.com/comics/shouldnt_be_hard.png" title="Every choice, no matter how small, begins a new story." alt="Lorenz" /></nowiki>'' part has now been excised from the page. That's on Javascript-enabled, cookie-enabled Firefox ''and'' IE browsers, and every valid URL configuration one can think of (including shift-refreshing to force redownloading, just in case it was page-cache issues as well). I'll update the Bugs section of the explanation page with a summary of that, if you don't mind. [[Special:Contributions/141.101.88.211|141.101.88.211]] 01:48, 4 April 2014 (UTC)

We need some place to discuss certain issues. I give it a shot below [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:10, 2 April 2014 (UTC)
;Transcipt discussion
;Design
*What about four transcripts - one for each of the four first original choices?
*Should these transcripts be on a separate page? It becomes tedious to scroll to the discussion page...[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:13, 2 April 2014 (UTC)
*Could we use the hide option so you only see the options from the first panel. Then you unhide to see the next panel etc. This would be a little like the comic and would make it much easier to read and it would not be such a long page! [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 10:35, 3 April 2014 (UTC)
*:I'm working on the hide option. [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 15:14, 3 April 2014 (UTC)
*::I now implemented the hide option. It looks good! in my opinion. It should be easy to edit. It would be too much work to convert the whole thing to the collapsible version so, sorry but I just removed the whole thing and started from the very beginning. This[http://www.explainxkcd.com/wiki/index.php?title=1350:_Lorenz&oldid=64245] is the link to the old version, in case anyone wants to help converting it to the collapsible version. [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 16:46, 3 April 2014 (UTC)
:I did the same for trivia with a separate page for the old version that can be expanded if anyone wishes. And all the work is not lost. I have linked to it from trivia but it is here: [[1350: Lorenz/Transcript]]. [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 22:19, 4 April 2014 (UTC)
*How will the transcript work for when two characters speak? Those cases do exist; they're not all bugged. For example, in the "OpenBSD Branch", "Why not haiku?" and "Let's go exploring!" have further responses. --[[Special:Contributions/199.27.128.63|199.27.128.63]] 06:31, 5 April 2014 (UTC)
;Characters
*Where does the name Dave come from for the hairy guy who comes in after the first panel? I can see it once in the transcript - but it is said by White hat the sales guy. I'm not sure it is his name and the chatagory for hairy is assigned to the comic! [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:16, 2 April 2014 (UTC)
** Also he is called Dave here: http://www.xkcd.com/1350/#p:3b1a226e-b9c6-11e3-8001-002590d77bdd [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 21:37, 2 April 2014 (UTC)
*Hat guy? Is it a hat? Is there not a better English word for the type of "hat" worn by the main character from the first panel? It is not a hat like white or black hat! [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:18, 2 April 2014 (UTC)
** I named him Hat Guy originally to make things easier. Feel free to change the name, I guess :) Knit Cap Guy, maybe? If a change is warranted, a simple search-and-replace should do it. Also, I'm not sure it's a guy or a girl... But the previous text was also treating him as male to begin with, anyway. [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 21:36, 2 April 2014 (UTC)
*Is the right politician = Cueball?
*Who is the left? [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:23, 2 April 2014 (UTC)

Isn't is likely that the characters only have names given to them by us readers in our suggestions? They don't necessarily have constant names. [[User:Zweisteine|Zweisteine]] ([[User talk:Zweisteine|talk]]) 23:33, 2 April 2014 (UTC)

Exactly my point. I think we should stick with hairy guy and maybe Knit Cap Guy! [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 10:28, 3 April 2014 (UTC)

:I see you already changed Hat Guy to Knit Cap Guy and Dave to Hairy. Knit Cap Guy is a nice name. Originally, I would disagree with you and insist we should stick to Dave because that's what the character is called in one storyline of the strip itself, but I see he is also called Frank in other timeline. Since he has multiple names, using just Hairy is better in my opinion, too. [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 12:40, 3 April 2014 (UTC)

Knit Cap Guy is probably a Girl. Just sayin'. [[Special:Contributions/173.245.52.28|173.245.52.28]] 12:22, 3 April 2014 (UTC)

:Probably! Originally I thought it was Megan with a knit cap on. [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 12:40, 3 April 2014 (UTC)

:It IS a girl! http://www.xkcd.com/1350/#p:1e4325a2-baaf-11e3-801f-002590d77bdd [[Special:Contributions/173.245.48.66|173.245.48.66]] 21:44, 3 April 2014 (UTC)

::Well I think you are correct - that it is a girl. However you can NEVER use text in the comic to decide - because it is user created - I could have written the same line with guy instead of girl! Anyway - could someone change Knit Cap Guy to Knit Cap Girl? [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 10:04, 4 April 2014 (UTC)
:::Can see it has been done - great [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 08:32, 6 April 2014 (UTC)
::::I've found a story where he/she is male! Thus contradicting the story above, where he/she is female, and proving that we really can't use text to determine the sex. Here we have "Beanie Man". http://xkcd.com/1350/#p:b6fcd098-ba98-11e3-8008-002590d77bdd
::::(But... She looks female-ish enough to me, so I personally feel inclined to keep Knit Cap Girl in the article. Also, for laziness if nothing else. Feel free to disagree with me on that.) [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 11:07, 8 April 2014 (UTC)
:::::Also, sometimes she is called Lorenz. http://xkcd.com/1350/#p:bcc77a5c-ba23-11e3-801b-002590d77bdd [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 11:40, 8 April 2014 (UTC)
:I always mentally called the guy 'Hikaru' because the guy's hat reminded me of the Nice Hat that Hikaru Azuma wore a lot in {{w|With the Light}}. [[User:Greyson|Greyson]] ([[User talk:Greyson|talk]]) 03:55, 5 April 2014 (UTC)

;Other
*Seems like the permalink at the top of the transcript does not work for me anymore - then they will be useless! Else they are the best way to quote different lines of the comic. [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:31, 2 April 2014 (UTC)
Oh, now they work again. ;) [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 10:31, 3 April 2014 (UTC)
:The permalinks has stopped working for me [[User:Spongebog|Spongebog]] ([[User talk:Spongebog|talk]]) 20:45, 5 April 2014 (UTC)

I'm pretty sure that the initial four options presented to the reader are now fixed and do not change. "These stupid tiles..." and "Gravity. Lots of it." are no longer available options. (Correct me if I'm wrong, but I've played the comic many times over the past couple of days and I've never received those two options). Should the transcript be edited to reflect that? [[User:Enchantedsleeper|Enchantedsleeper]] ([[User talk:Enchantedsleeper|talk]]) 21:53, 6 April 2014 (UTC)

;Chategories not yet included
Should they be?
*I have seen the word Raptor mentioned - so should velociraptor be a chategory? [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:21, 2 April 2014 (UTC)
*Cueball? I.e. the politician on the right? [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:28, 2 April 2014 (UTC)
*I understand that many categories has been deleted as all text references can be user generated. But when there is a drawing with a dinosaur then this categories should be included etc. [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 19:14, 4 April 2014 (UTC)
*I would like to discuss the number of categories. If anything is in thks comics pictures then it should be included as a category. So dinos and Pokémon for sure as well as character's and collor. So I include some again - please do not delete. If you need to find where Pokémon has been referenced this commic should come in the list! [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 19:03, 8 April 2014 (UTC)

;Images
I created [[1350: Lorenz/Images]] with all the images I could find in the comic. I'm not sure if I should have left them in the main page [[1350: Lorenz]], but feel free to decide what to do with them. Also, I tried using the tag <nowiki><gallery></nowiki>, but I couldn't make it work, so I used a lot of divs. [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 23:23, 2 April 2014 (UTC)
:Great idea - just what I hoped someone would and could do. Thanks ;) Is it easy to add new images to the page if they show up? [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 10:32, 3 April 2014 (UTC)
::You're welcome! :) It's pretty easy... I explained in the images page how exactly you would save a new image if they show up. [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 13:52, 3 April 2014 (UTC)
:Can see there keep appearing new images from the text above. [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 10:39, 3 April 2014 (UTC)
:New shark images here: http://xkcd.com/1350/#p:30f53d98-bbb3-11e3-801c-002590d77bdd {{unsigned ip|108.162.221.65}}
:I have updated the page and made a talk page there to add comments like the above. Have already found d 3 new images cannot add them with this tablet [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 22:19, 4 April 2014 (UTC)

Thanks for this work, but nobody knows if this is complete. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 19:49, 3 April 2014 (UTC)

;Many-worlds interpretation

The title text "Every choice, no matter how small, begins a new story" might as well be a hint to Hugh Everett III 's "Many-worlds interpretation"
of quantum theory. {{unsigned ip|108.162.219.74}}
:Except that the title is Lorenz a direct reference to the guy with the butterfly effect... [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 10:37, 3 April 2014 (UTC)
::Can't it be both? The Butterfly Effect can be seen as one consequence of the Many-Worlds interpretation. A choice as simple as whether (or where) a butterfly flaps its wings can send our entire universe down a different timeline, in which a hurricane occurs. [[Special:Contributions/108.162.216.49|108.162.216.49]] 19:46, 3 April 2014 (UTC)

;Most, maybe all pictures do correspond to an existing comic here
I'm calling on you to not destroy a first simple explain, even the transcript. But nearly every picture belongs to a former comic — this has to be explained at the ''Themes'' section. We have some dinosaurs, but there is much more. Please help on this issue. --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 21:56, 4 April 2014 (UTC)
::After I understood what you mean I agree. All pictures collected should be explained in the themes section and preferably with a line to a story that includes the picture. There are so many I can't find. Some may never be available again... ? [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 18:59, 8 April 2014 (UTC)

:What are you referring to? Has anyone deleted something important? Hope it wasn't me? [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 22:19, 4 April 2014 (UTC)

::Well I can see it was me. We obviously disagree with what could be a trivia item and with which categories should be included even obvious ones. There has before been mention of missing pieces of hats etc and when there is one in hundreds of images with an error then it could make a fun trivia item in my opinion! I will stop editing and let you decide what to do with this comic? [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 22:30, 4 April 2014 (UTC)

:::You totally misunderstand me. I'm asking for an explain to every picture because it should belong to a former comic.
:::Further more I'm just trying to keep the explain as simple as possible; individual error experiences should not be posted at the explain. I did remove that content in order to keep it simple as possible to an ordinary reader.
:::Please improve the picture explains, but also please keep that explain simple as possible to readers are not interested on all that crap done by Randall.
:::--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 22:38, 4 April 2014 (UTC)
::::Great and thanks for this explain and sorry I was grumpy in my reply before. Do you mean there should be an explanation for every single picture? Maybe this should be moved to a separate page like the list of images - they take up lots of space in the explain page - or they could be hided like the new transcript? [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 08:32, 6 April 2014 (UTC)
::::Have begun the full image explanation...[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 23:03, 6 April 2014 (UTC)

;Visual tree / map?
How hard would it be to come up with a tree graphing out the different choices? The nodes could be panels and the lines could represent text choices. Has anyone tried it?
--[[Special:Contributions/108.162.221.34|108.162.221.34]] 23:40, 4 April 2014 (UTC)
:I added hide/show functionality to the transcript. It's easier to read and navigate now. [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 15:59, 5 April 2014 (UTC)
::Great - this was also what I had in mind :-) [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 08:32, 6 April 2014 (UTC)
:::Not so great it has been deleted... Again! I have inserted a link to the last page before Dgbrt deleted all 25000 signs. Considering the enormous work done to create this transcript I think we should let it be at least awailable as a trivia link. I cannot create the page from my tablet, but would rather have a lorenz transcript page than an old version like now. Maybe on this page again? [[1350: Lorenz/Transcript]]. [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 23:03, 6 April 2014 (UTC)
::::I restored the old version in [[1350: Lorenz/Transcript]]. (Also, I used divs this time rather than templates.) [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 05:00, 7 April 2014 (UTC)

;I got my suggestion as part of the main story!
I noticed in the "references to video games" section that "Actually it's the final castle - grab your fire flower!" was one of the options. I suggested that! [[Special:Contributions/108.162.212.27|108.162.212.27]] 17:07, 5 April 2014 (UTC)

;Are we sure the title is not related to http://en.wikipedia.org/wiki/Lorenz_gauge_condition ?
For example, in Italy, the Lorenz Gauge Condition is dubbed "The Lorenz's choice". {{unsigned ip|108.162.212.218}}

;Should there be an interactive comic category?
It is kind of covered by the dynamic category, but between click and drag and this, as well as possible future comics, might it need to be its own seperate new category? [[User:Athang|Athang]] ([[User talk:Athang|talk]]) 23:00, 5 April 2014 (UTC)

The "stupid tiles" option has vanished from panel 1. [[Special:Contributions/199.27.130.222|199.27.130.222]] 00:14, 6 April 2014 (UTC)
:Is that for good or just for you? How many times did you reload and did you try different browsers? It should always be awailable via a saved permalink, like you findin the transcript. [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 08:32, 6 April 2014 (UTC)
::This probably happens at the same time for all users, considering that I read 199.27.130.222's message immediately after he/she sent it and at that point the "stupid tiles" option had vanished for me as well, but this was clearly temporary since it's back now.
::I only tested on Firefox. [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 04:08, 7 April 2014 (UTC)
::I still get this option?? [[Special:Contributions/199.27.130.216|199.27.130.216]] 22:38, 8 April 2014 (UTC)

;Records in most panels
I have started a collection of records. I just entered what I could find to give an example. I was sure that my pheble attempts soon would be helped sore by someone who had saved the good ones... And already this is happening. Please continue to improve the records and also add more themes if I left them out [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 17:00, 7 April 2014 (UTC)

;Gravity lots of it?
I have never seen this option. Could someone post a permalink to such a story - could be as a record. [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:58, 7 April 2014 (UTC)

;Some cool stuff i found, don't know if anyone wants to add these to the main page

Pikachu: http://xkcd.com/1350/#p:80858d8c-ba22-11e3-801a-002590d77bdd

Giant pit: http://xkcd.com/1350/#p:ea9342a0-bc02-11e3-8034-002590d77bdd

Goodbye, BSD: http://xkcd.com/1350/#p:bae4c63c-ba31-11e3-8034-002590d77bdd

Reddit and rockets: http://xkcd.com/1350/#p:602c39a8-ba92-11e3-8006-002590d77bdd

More BSD Pikachu: http://xkcd.com/1350/#p:f5760770-baae-11e3-801f-002590d77bdd

Bird-powered car: http://xkcd.com/1350/#p:cc4467b2-baf3-11e3-8001-002590d77bdd

This happens a lot: http://xkcd.com/1350/#p:b69f6096-b9f0-11e3-8009-002590d77bdd

Dinos: http://xkcd.com/1350/#p:679012b0-bb4f-11e3-805b-002590d77bdd

These stupid lines: http://xkcd.com/1350/#p:360411c2-baa2-11e3-8012-002590d77bdd

Pretty long: http://xkcd.com/1350/#p:7d40621c-bae7-11e3-8002-002590d77bdd

[[Special:Contributions/199.27.130.216|199.27.130.216]] 22:37, 8 April 2014 (UTC)

:Thanks for your findings. This has to be added to the explain, your titles on this are GREAT! Maybe you — or someone else — does have a nice idea how to publish all this permalinks in a proper way.--[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 23:39, 8 April 2014 (UTC)

::More (mostly dream recursion):

Lord of the rings: http://www.xkcd.com/1350/#p:40a1ac80-ba06-11e3-8017-002590d77bdd

Another moat: http://www.xkcd.com/1350/#p:eee0d4c6-baea-11e3-8002-002590d77bdd

Looping back: http://www.xkcd.com/1350/#p:d7970042-bae5-11e3-8001-002590d77bdd

Looping back 2: http://www.xkcd.com/1350/#p:3f654048-badd-11e3-8001-002590d77bdd

Never seen it loop this many times: http://www.xkcd.com/1350/#p:20698602-bbb1-11e3-801c-002590d77bdd

Even more looping: http://www.xkcd.com/1350/#p:75e8f03e-baaf-11e3-801f-002590d77bdd

Looping to a rocket: http://www.xkcd.com/1350/#p:3aa7da8e-bae7-11e3-8002-002590d77bdd

Dream recursion: http://www.xkcd.com/1350/#p:5e94d028-bb7d-11e3-8012-002590d77bdd

Where did the Pikachu come from?: http://www.xkcd.com/1350/#p:97c42da2-bb01-11e3-8004-002590d77bdd

Ethylene dichloride: http://www.xkcd.com/1350/#p:93312202-ba4f-11e3-8037-002590d77bdd

More rockets: http://www.xkcd.com/1350/#p:34f7f602-ba3b-11e3-8035-002590d77bdd

Even more rockets: http://www.xkcd.com/1350/#p:8440e346-bb16-11e3-8004-002590d77bdd

More recursion: http://www.xkcd.com/1350/#p:20698602-bbb1-11e3-801c-002590d77bdd

Blowtorch: http://www.xkcd.com/1350/#p:c40db5fc-baf9-11e3-8001-002590d77bdd

Another blowtorch: http://www.xkcd.com/1350/#p:97cbd552-bb01-11e3-8004-002590d77bdd

Most different stories i've seen in one: http://www.xkcd.com/1350/#p:60d11a70-bb16-11e3-8004-002590d77bdd

[[Special:Contributions/199.27.130.216|199.27.130.216]] 21:33, 9 April 2014 (UTC)

More:

More pikachu: http://www.xkcd.com/1350/#p:feaa5d4e-bbd2-11e3-802c-002590d77bdd

Long pikachu fight: http://www.xkcd.com/1350/#p:d87d8344-bafb-11e3-8001-002590d77bdd

Plantains: http://www.xkcd.com/1350/#p:22d57484-bb28-11e3-8004-002590d77bdd

Many pikachus: http://www.xkcd.com/1350/#p:d04aabf0-b9fe-11e3-8016-002590d77bdd

Much pikachu: http://www.xkcd.com/1350/#p:f203d1c6-ba22-11e3-801a-002590d77bdd

Such pikachu: http://www.xkcd.com/1350/#p:a5485722-ba26-11e3-8020-002590d77bdd

Very pikachu: http://www.xkcd.com/1350/#p:81c9e8c8-ba1d-11e3-8018-002590d77bdd
[[Special:Contributions/199.27.130.216|199.27.130.216]] 22:49, 9 April 2014 (UTC)

:I haven't seen them all - but have you checked the records at the bottom of the explain page - those you call pretty long does not seem to get close to the 77 picture record... Are there any new pictures not featured in the picture page linked to from the top of the explain? Else this does not seem so interesting to me... ;-) [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 14:55, 10 April 2014 (UTC)
::Ah so there were interesting stuff around. And I can see that at least one of them has already been added as a Pokémon record. Great - cool if you wrote how many panels - or if there where new pictures - it would be easier to look through them. The double dream I had been looking for, thanks I will add it to the record page under dreams [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 14:59, 10 April 2014 (UTC)
::Seen them all and added several to the record for themes trivia. Thanks - but please more info~(length, themes) if you still care to share [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 15:36, 10 April 2014 (UTC)

;Finishing the explanation
I have just done a huge job putting all the images from the list in under the themes sections. I hope others can take over and find permalinks that include all the images that are not yet on references in the links I have inserted. Also there are some of the first options that seeem to not exist anymore (Gravity lots of it) and also there was the error with the same line twice. I found it one day, but then there where no new images if you chose it. I did not save the permalink and now it seems like it is all gone.
Good work guys and girls - I have a holiday comming up with no much computer time... [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 02:51, 12 April 2014 (UTC)

;Greasemonkey Script
I've just mad a script to visit random stories, and record the corresponding transcripts. It's available here: https://github.com/edfel/Lorenz/ . I hope someone can find it useful! Edfel. [[Special:Contributions/108.162.254.163|108.162.254.163]] 14:24, 18 April 2014 (UTC)

;Dump
One idea: Maybe someone could create a script to automatically navigate Lorenz and create a dump of all the results, to fill [[1350: Lorenz/Transcript]].
I know more-or-less how that would work in "pseudocode" so I could help but I'm not going to do it (writing actual code, testing, debugging, accounting for each individual frame, etc) any time soon. [[User:Daniel Carrero|Daniel Carrero]] ([[User talk:Daniel Carrero|talk]]) 07:47, 29 April 2014 (UTC)

;Go home, Saturn, you're drunk.

Quintuple Saturn POWER!
http://xkcd.com/1350/#p:9adca534-b9b0-11e3-8004-002590d77bdd [[Special:Contributions/173.245.54.10|173.245.54.10]] 01:44, 5 May 2014 (UTC)

;What-If XKCD

http://xkcd.com/1350/#p:b1210692-bae5-11e3-8001-002590d77bdd
Recognize this one? [[Special:Contributions/173.245.54.10|173.245.54.10]] 02:09, 5 May 2014 (UTC)

;Why are the punctuation marks clipping?

I don't know what's going on, but a comma looks just like a period in the comic. The letters E, F, and I also display strangely. What's going on?[[Special:Contributions/199.27.128.96|199.27.128.96]] 01:58, 6 May 2014 (UTC)

; Lorenz down time
Today there was no access to Lorenz. Tried both Firefox, Chrome and internet explorer. Just mentioning it here, if this is a permanent problem - so people can see how long it has been down. [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 18:43, 15 May 2014 (UTC)
:Well it was already up again now. [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:42, 16 May 2014 (UTC)
</div>
 
After inserting the collapsing talk page - the old can be seen just by clicking the expand button. But if you wish to write anything new, then do it here below at the very bottom of the talk page so it may be seen. I have this comment - after a few weeks I believe nothing new happened in this comic. I think it is now fixed. Of course this is very hard to prove. But I have completed some branches of the interactive transcript. So let me know if you can find any new options I have missed (I could have missed if there were more than four options in a panel - but not at the dead-ends! I have also just made major revisions of the explanation and it's layout - based on my observations. [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 22:48, 19 June 2014 (UTC)

I just found a panel where it gets past the person on the comet, only one panel though... http://xkcd.com/1350/#p:25743f70-baee-11e3-8001-002590d77bdd [[Special:Contributions/108.162.254.69|108.162.254.69]] 19:24, 15 July 2014 (UTC)
:Great. Have added the image to the list of images and to the theme above. Keep any new images coming here.--[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 14:24, 30 March 2016 (UTC)

It's interesting the chess player in 1112 ("Think logically") resembles the knit cap girl. It's weird that Megan (or Randall's wife) after chemotherapy also wears a cap (1141, "Two years"). Is there any possible connections between them (or simply a coincidence)?[[Special:Contributions/108.162.215.108|108.162.215.108]] 04:24, 29 July 2014 (UTC)
:I have added links to three other comics using knit caps, including the two you mentioned. Thanks. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 14:24, 30 March 2016 (UTC)

I noticed that the image url noted on xkcd.com is the same as the one for #1349 - Shouldn't Be Hard. Not sure if it is caused by the interactivity disallowing an image upload, or an error on Randall's part (I'd imagine working through this comic's issues was pretty distracting). 15:37, 24 April 2015 (UTC)
:I believe this was fixed. At least it seems to look correct now. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 14:24, 30 March 2016 (UTC)

God damn I hate boomerangs now.
[[Special:Contributions/172.68.65.240|172.68.65.240]] 03:49, 22 November 2017 (UTC)Bob

Hey guys, are we still missing the ocean comics? because I found one that links there. https://www.xkcd.com/1350/#p:3df213b4-ba4f-11e3-8037-002590d77bdd . not far after though. [[Special:Contributions/173.245.48.129|173.245.48.129]] 02:41, 6 August 2018 (UTC)

I found a (possibly) bug where the comic doesn't load and there's just a comic-sized blank space. 19:48, 3 January 2019 (UTC) {{unsigned|Cheese12}}

As of this week I found out that {{xkcd|1350|Lorenz}} seems to have stopped working on xkcd... This makes all the permalink invalid. ;-( --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:03, 8 September 2019 (UTC)
:I also found that people have been writing new entries from the top which meant I did not see Cheese12 comment that this was so all the way back in January 2019. I have rearranged the three comments on top to the right post order here at the bottom and added a signature for Cheese12 and a day for the edit for reference to how long it has been broken. Also removed a (now broken) permalink that was left over when a user posted something and then deleted it again. It was stick beneath my previous comment. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:12, 8 September 2019 (UTC)
::Looked on the webarchive and the latest version of the comic there is from July 2019. [https://web.archive.org/web/20190719205955/https://xkcd.com/1350/ 2019-07-19]. It seems correct there with the first picture with options... Of course it is no use trying to move on, either because it is a web archive or because Lorentz doesn't work anymore on xkcd. But it seems like it should not have displayed that image if it had been a recent version of the comic, as there are no image on the page now. If this is true, then it should not have been down all the time since January as Cheese12 wrote above... But I have no idea how the web archive works for such a complicated comic page? --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:22, 8 September 2019 (UTC)
:I suspect this is related to the XKCD forums being taken down. Umwelt, Externalities, Landing, and xkcloud are also down. [[User:Tbodt|Tbodt]] ([[User talk:Tbodt|talk]]) 19:19, 14 September 2019 (UTC)

Talk:1350: Lorenz

2019-09-14T19:18:37Z

Tbodt:

Talk:183: Snacktime Rules

2019-09-13T03:00:24Z

Tbodt:

Hm, how can we know, really, if it's Randall or Cueball speaking? –[[User:St.nerol|St.nerol]] ([[User talk:St.nerol|talk]]) 20:19, 5 March 2013 (UTC)

It's Randall. I was there. [[User:Spotlouise|Spotlouise]] ([[User talk:Spotlouise|talk]]) 16:13, 21 March 2013 (UTC)

:I'm pretty sure that Cueball is basically just an abstraction of Randall. Black Hat, too, at times. Odd that no one seems to notice. [[User:Daddy|Daddy]] ([[User talk:Daddy|talk]]) 15:43, 28 April 2013 (UTC)
:: Everyone knows it; it'd be impossible for Randall to not put himself in the comic. However, the ''title text'' is '''always''' Randalll, so that implies that the stick figure is definitely Randall. [[Special:Contributions/75.185.176.214|75.185.176.214]] 00:07, 16 August 2013 (UTC) I should probably join... I'd be able to stop displaying my IP
::: The title text is not always Randall.{{unsigned|Flewk}}

:: I feel like most of the characters are at least sometimes abstractions of Randall. I mean almost always Cueball is. But I think the other characters can be aspects of him sometimes. Black Hat, Beret Guy, he'll sometimes even White Hat and Megan. Although they usually represent other things, if anything at all. But sometimes. {{unsigned ip|108.162.245.64}}

Based on the title text Randall had probably just turned 6, so there would be two years until he next could have a snack - and the mother probably believed that he would have forgotten such a rule by then (alas that was clearly not the case... :-) [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 20:27, 12 December 2013 (UTC)

: Or is it ( :-))? [[541: TED Talk]] {{unsigned|Aronurr}}

As I read it, it isn't that he gets no snacks, it is that he gets no snacks in his rom. {{unsigned ip|162.158.252.185}}

Just a thought, but maybe this rule is based on a measurement of Randall's age in terms of some unit other than years, which would be ''really'' nerdy. —[[User:CsBlastoise|CsBlastoise]] ([[User talk:CsBlastoise|talk]]) 18:28, 22 January 2017 (UTC)

Is it possible the obscure logic is related to school exams - perhaps he is 12 and starting Junior High, the previous year having sat an SSAT exam to get. He turned 12 in the October, so would have been studying aged 11 and perhaps allowed to snack in his room as a result. His mum observed that he'll next sit exams for senior high aged 14 and then for undergrad at 17... so can only snack in years he is prepping for exams. (Unlikely that this is the ACTUAL reason for the pattern, but I'll bet it was something of similar spirit, she'd allowed it age 11 and was post-associating it to some other life event so he can do it at 14 and 17 as well).{{unsigned ip|141.101.99.53 }}

I asked Randall about this on the How To book tour. He said it's real. The first two times he wore his mom down on this topic, he was 2 and 5. The first time was an exception, the second time she made a rule. [[User:Tbodt|Tbodt]] ([[User talk:Tbodt|talk]]) 03:00, 13 September 2019 (UTC)

Talk:183: Snacktime Rules

2019-09-13T02:58:42Z

Tbodt:

1406: Universal Converter Box

2017-10-02T22:48:59Z

Tbodt: /* Right side */

{{comic
| number = 1406
| date = August 11, 2014
| title = Universal Converter Box
| image = universal_converter_box.png
| titletext = Comes with a 50-lb sack of gender changers, and also an add-on device with a voltage selector and a zillion circular center pin DC adapter tips so you can power any of those devices from the 90s.
}}

==Explanation==
Converter boxes are used to connect two or more devices together which otherwise couldn't be, due to differently shaped plugs, different voltages, or different protocols of communication.

Converter boxes or converter cables are commonly found for several of the plugs at the top of the list - such as from USB to micro-USB. As this is supposed to be a Universal Converter Box, there are many connections.

The humour from this comic comes from the sheer number of [[927: Standards|different standards]] that all claim to be the universal way to connect two devices, in their target market, as well as the progressively ridiculous conversions that this box is capable of doing, for example, converting audio from a 1/8 inch / 3.5 mm headphone jack, into a variety of fuel suitable for running your car.

A connector is capable of making a connection to another connector only if the connectors are of the same style and the opposite gender ("male" connector is plug, "female" connector is socket), except for rare "genderless" connectors, such as the token ring mentioned above. Gender changers are devices with two connectors of the same gender. The "circular center pin DC adapter tips" in the title text are barrel jack power plugs. There are a large number of these style connectors, and many of these devices look the same, leading to frustration.

===Different connectors===
The plugs are numbered from top to bottom and incremented for every wire that comes directly out of the converter box.

====Left side====
#{{w|VGA connector|VGA}} (Video Graphics Array): This a video connector (standard is blue) that connects computers and monitors or projectors. It has fifteen pins in a D-shell. It's still one of the common type of video connectors.
#{{w|Digital Visual Interface|DVI}} (Digital Visual Interface): This a video connector (standard is white) that uses a D-shell with flat pins. DVI is not compatible with VGA ports,
#{{w|HDMI}} (High Definition Multimedia Interface): This is an audio video connector that supports high definition video and audio.
#{{w|Thunderbolt (interface)|Thunderbolt}}: Thunderbolt can transfer both video signals to a monitor, audio signals to speakers, and send and receive data at the same time, over the same port.
#{{w|IEEE 1394|Firewire}} (IEEE 1394): A bidirectional data transfer connector, similar to USB, Firewire is used for networking computers, and connecting audio/video equipment to computers.
#{{w|Component video|Component}} and {{w|RCA connector|RCA}}: Both component video and RCA are ways of transmitting video and audio signals. RCA is the name of the connector type. RCA uses one plugs per audio channel (e.g. left and right channels). RCA (composite) uses one plug for video where component uses three: Y (luma), Pb (Blue - Y), Pr (Red - Y).
#{{w|Phone connector (audio)|1/8" audio/video}} (3.5 mm phone connector): Best known as a headphone plug, but also used for other audio equipment and for some video equipment.
#{{w|Parallel port}}: A port that used to be used to connect printers to PCs.
#{{w|S-Video (analog video standard)|S-video}}: A video with the video signal split in Y (luma) and C (chroma).
#{{w|In-flight entertainment#History|Airline pneumatic tube audio}}: The seat would contain the loudspeaker, and the headphone connected to this unit with a pneumatic tube to conduct the sound.
#{{w|PS/2 port|PS/2}}, PS/3 and PS/4: The PS/2 connector was used for mouse and keyboard connections in older computers; it has been superseded by USB. There are no PS/3 or PS/4 connectors. This is a play on the {{w|PlayStation}} line of video game consoles, which have recently seen their second, third, and fourth generations abbreviated to PS2, PS3, and PS4.
#{{w|NEMA connector|120V AC}}: This style of plug is used for domestic power outlets in the US, Canada, Mexico, and some other parts of the Americas. The pin marked "removable" is the ground pin. Not every device requires a ground pin, and some lower power sockets do not have a hole for it.
#{{w|Floppy disk|Floppy}}, {{w|Parallel ATA|IDE}}, {{w|Hard disk drive|2.5"}}, {{w|SCSI connector|SCSI}}: These are {{w|Insulation-displacement connector|IDC connectors}} for connecting to media drives to processors using different numbers of pins, and hence different widths of {{w|Ribbon cable|cable}}. Despite this similarity, real plugs would not work with break-away parts as the pinout has no similarities and the connectors are keyed differently.

====Right side====
#{{w|USB#Connectors and plugs|USB}}: Also known as USB-A. USBs are used for connecting various devices to computers, each other, and to power supplies and chargers. The USB standard has multiple connectors. Some of the others are below.
#USB (weird other end): Also known as USB-B.
#mini-USB/micro USB: Alternate smaller connections for USB communication.
#macro USB: A joke about a larger version of USB.
#{{w|F connector}}: A type of coaxial plug used for various television signals and for cable modems.
#{{w|Optical fiber connector|Fiber}}: Optical fiber cables are used for various data transmission purposes and are often connected to devices with only a connector on the device, and none on the cable.
#{{w|Registered jack#RJ11, RJ14, RJ25 wiring|RJ11}}/{{w|Ethernet over twisted pair|Ethernet}}: Ethernet connections, which use a {{w|TIA/EIA-568|TIA/EIA-568 connector}} (often mistakenly called RJ45 because of its visual similarity), are the most common fixed wire connection for computer networking. The RJ11 connector is used for land-line telephones.
#{{w|Token ring}}: The token ring was a late-80s competitor to Ethernet for fixed-wire network connections. Its connectors were large and boxy, but were unique in that they were genderless.
#{{w|MagSafe}}: Magnetically-attached power connectors used on Apple devices. The original MagSafe (introduced in 2006) was later replaced by MagSafe 2 (introduced in 2012); both come in "L" and "T" shapes as shown here for MagSafe and MagSafe 2, respectively, but are incompatible. MagSafe 3 and 4 do not actually exist yet (and probably never will, now Apple is using {{w|USB-C}} to charge its laptops). The MagSafe 3 charger appears to resemble the Apple Watch charger, interestingly. Also, the MagSafe 4 "connector" appears to be broken this is a joke about the {{w|MagSafe#Defects|poor quality}} of the original MagSafe 1 cables.
#{{w|Bluetooth#Communication and connection|Bluetooth dongle}}: A USB device that allows the converter to connect via the {{w|Bluetooth}} wireless networking standard to accessories like phones and computers for audio, general purpose file transfer, mouse and keyboard interaction and a wide variety of other uses.
#{{w|SCART}}: An audio/video connector mostly used in Europe; it replaced other connectors like component video, but has itself been superseded by HDMI.
#{{w|Tin can telephone|String}}: For connecting to a "tin can telephone", an analogue device for transmitting sound through a physical connection rather than electronically or via radio waves. Probably also a reference to {{w|CAN bus}}.
#{{w|Fuel dispenser#Nozzles|Fuel nozzle}}, with a switch to choose between different {{w|octane rating}}s and {{w|diesel fuel}}: Dispensers for fossil fuels used to power internal combustion engines. Presumably, this would be the gasoline/petrol tip [see trivia].

===Trivia===
For some interfaces, such as USB, the female side is standard to the device while the male side is standard to the cable. For other interfaces, such as the RS-232 serial port, the conventions vary or there is no convention.

The "universal" connector here doesn't support the proper RS-232, with the closest surrogate available being RJ-11. The other nearest analog would be the parallel port, available in Centronix and D-25-pin connectors.

The SCSI connectors have been available as the "internal" connectors (see the "break-away" above) of 2 different widths, Centronix, 2 widths of the mini-D connectors with the easily bendable pins, 3 widths of the more reliable pin-less mini-connectors, and high-speed serial.

Not only is there gender and connector type, but there are also different standards on what data/power is connected on each pin of the connector. Building a working connection often involved getting 3 or 4 adapters connected in a sequence to produce the right connector, gender and pin-out.

Barrel jack power plugs were developed in the 1980s. The "barrel" has an inner diameter an outer diameter, and different style pins.

A D-shell is a trapezoidal metal skirt that protects the pins, prevents the connector from being plugged in the wrong way, and makes the physical connection more secure.

A VGA was developed in 1987, and with new versions being developed since then.

DVI can be configured to support multiple modes such as DVI-D (digital only), DVI-A (analog only), or DVI-I (digital and analog).

HDMI has slowly been replacing DVI and VGA ports on newer devices due to the simplicity and the smaller footprint and overall dimensions.

Thunderbolt is far faster than almost any connector on the market for transferring data. However, the limited adoption by manufacturers, the higher costs of the hardware, and the security concerns inherent to the interface have limited the adoption by consumers.

Because Firewire is designed to allow {{w|backplane}} access and {{w|direct memory access}} (DMA) to devices, there are additional conversion and security issues with it.

The phone connector diameter of 1/8" is only an approximation using {{w|Imperial units}}. The standard actually specifies a size in the {{w|Metric system}} of 3.5 mm. The video plug has 3 contacts (Tip, Ring and Sleeve) and the audio has 4 contacts (Tip, Ring, Ring and Sleeve).

While no longer common in homes or offices, parallel connections are still used in some {{w|embedded system}}s.

Airline pneumatic tube audio was used by in-flight entertainment systems manufactured from 1963 until 1979.

Note that while AC adapters are necessary—and widely available—to suit sockets in other countries, this "universal" converter does not feature any other AC power plugs, but this could be accommodated using adapters.

{{w|Cheater plug}}s exist to connect a NEMA grounding-type plug (three prongs) to a NEMA non-grounding receptacle (two slots), but the use of such an adapter can be hazardous if the grounding tab is not connected to electrical ground. A safer alternative is to replace the outlet with a {{w|Residual-current device|Ground Fault Circuit Interrupter (GFCI)}} breaker outlet.

The computer media drive connectors are unlike the motherboard-powering connectors from the Power Supply Unit of a PC, which may involve multiple additional 4, 6 and 8-pin 'breakout' supply cables that have this feature and specially 'keyed' pin-sheaths as well to allow forward/backward compatibility between various versions of PSU and motherboard that could be used (and power-hungry GPUs of various kinds, as well).

Note that some embedded systems such as cash registers actually do use larger USB connectors to include 12V and/or 24V power connections. These are not, however, called "macro-USB", and are not as large.

Other countries often use RJ11-ended cables with locally-specific adapter-ends, e.g. the BS 6312 in Britain. Broadband microfilters may make use of this difference by splitting a relevant telephone plug standard into the local non-RJ11 style of telephone plug for an "audio-only" pass-through socket and an RJ11 for the router/modem to be cabled up to for the abstracted "data-only" signal — making an adapter for this will be nearly impossible.

There are two common systems for showing octane numbers on fuel pumps; the numbers shown (87, 91, 93) most closely map to {{w|Octane rating#Anti-Knock Index (AKI) or (R+M)/2|Anti-Knock Index}} values which is used for the North American market and a number of other countries, the other system used in the rest of the world is Research Octane Number. In the AKI system; 87 octane (91 RON) is regular US, 91 octane (95 RON) is regular European, 93 octane (98 RON) is premium European, and in US both 91 and 93 are considered premium/super depending on the regulations of a particular state. Some states, such as California, forbid the sale of the gasoline above 91 octane. Only very rarely could both 91 and 93 be found at the same gas station. The typical line-up is "regular" (87), "plus" (89), and "premium"/"super" (depending on the state and on the fuel brand, 91, 92 or 93 octane). A standard diesel nozzle (24mm) is slightly larger diameter than a standard petrol nozzle (21mm) so you cannot tank diesel into a petrol car but if this nozzle has the petrol nozzle diameter you are still able to tank with it into some diesel cars. Some manufacturers such as Volkswagen fit a misfueling guard and fuel filler neck cap or have redesigned the fuel filler to prevent a petrol nozzle being used in a diesel car.

Since the release of this comic, Apple has created a magnetic charging cable for its Apple Watch, which functions in the same manner as the current MagSafe 1 & 2 by using a magnet to connect to the device. This new charger looks identical to the fictional MagSafe 3 in the comic.

==Transcript==
:[Universal converter box with wires to connectors:]
:VGA
:DVI
:HDMI
:Thunderbolt
:Firewire
:Component
:[sharing connectors with Component:]
:RCA
:1/8" Audio
:1/8" Video
:Parallel Port
:S-Video
:Airline Pneumatic Tube Audio
:PS/2/3/4
:120V AC
::[pointing to ground pin:]
::Removable
:Floppy/IDE/2.5"/SCSI
::[pointing to sections in IDC connector:]
::Break here
:USB
:USB (weird other end)
:Mini-USB
:Micro USB
:Macro USB
:F Connector
:Fiber
:RJ11
:Ethernet
:Token Ring
:MagSafe
:MagSafe 2
:MagSafe 3
:MagSafe 4
:Bluetooth Dongle
:SCART
:String (fits most cans)
:[Fuel nozzle with selector for:]
:87/91/93/Diesel

{{comic discussion}}
[[Category:Computers]]

1168: tar

2017-10-02T19:34:22Z

Tbodt: /* Explanation */

{{comic
| number = 1168
| date = February 1, 2013
| title = tar
| image = tar.png
| titletext = I don't know what's worse--the fact that after 15 years of using tar I still can't keep the flags straight, or that after 15 years of technological advancement I'm still mucking with tar flags that were 15 years old when I started.
}}

==Explanation==
{{w|Tar (computing)|tar}} ("tape archive") is a {{w|Unix|Unix}} application that creates (and extracts) archives in the ".tar" format. It is typically used through the text-based terminal, using cryptic single-letter arguments such as "<code>tar -cvf archive.tar *</code>". The comic alludes to the fact that despite years of use of the command, it's still hard to remember the arguments without searching for them, such as with Google.

The title text points out that while much of computing changes very quickly, the tar program, which is very old (originating ca. 1975), is still around and heavily used. And yet, [[Randall]] complains he still cannot type out a line of tar command with correct flags without having to look the flags up. Tar is a very common command that Unix users will come across regularly, much like Windows users will come across .zip files. Depending on the flavor of Unix, the order of the flags, or the lack or inclusion of a '-' could render the command incorrect. Most true Unixes (AIX, HPUX, Solaris) not using the GNU utilities would give an error on the above tar example. For such a simple command, it is one that most people need to look up references to use.

The joke here is that a "tar" command with perfect syntax on the first try without outside help is such a daunting task that even [[Rob]] can't overcome it with confidence, and apologizes for not being able to prevent their imminent death.

The fact that [[Megan]] and [[White Hat]] assume that Rob can disarm the {{w|nuclear bomb}} because he uses Unix can be referring to an over-generalization fallacy that a partaker in a practice is an expert of a practice. Not all people who use Unix necessarily know how to use tar commands. Then again, since he's the only person nearby who knows ''any'' Unix and thus their only hope, their fallacy is pretty justified.

There is probably also a pun on "{{w|tarbomb}}," a poorly created tar archive that, when extracted, dumps a load of files into the current directory that the user has to clean up. And although the bomb looks more like {{w|Fat Man}}, the type of bomb that was used over {{w|Nagasaki}}, at least size-wise, it may also be a pun on the name of the largest ever {{w|hydrogen bomb}} which was called the {{w|Tsar Bomba}} (translation: "emperor bomb").

In [[208: Regular Expressions]] [[Cueball]] saves the day by knowing {{w|regular expression}}s, although in the title text it is alluded to how easy these may also miss a character.

Rob may refer to {{w|Rob Pike}}, who was a member of the team at AT&T who created Unix.

==Transcript==
:[Megan and White Hat stand next to a nuclear bomb. The bomb has a hatch open on top, and a small blinking screen. The two people are shouting off-screen.]
:Megan: Rob! You use Unix!
:White Hat: Come quick!

:[Megan, White Hat, and Rob look at the screen on the bomb. Rob peers closely. The screen is on the bomb, but is shown at the top of the panel in black with white letters, except "tar" and the last underscore which is in gray and "ten" which is black but written in a white box. The text reads:]
:{| class="wikitable"
|style="background-color:black;"|To disarm the bomb, simply enter a valid tar command on your first try. No Googling. You have <code>ten</code> seconds. ~# _
|}
:[They all stand in the same position, but without the text displayed. Beat panel.]

:[Still in the same position but White Hat becomes impatient.]
:White Hat: ...Rob?
:Rob: I'm so sorry.

{{comic discussion}}

[[Category:Comics featuring White Hat]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Rob]]
[[Category:Computers]]
[[Category:Programming]]

Talk:713: GeoIP

2017-09-17T00:13:06Z

Tbodt:

The title text is more than hyperbole: In the United States, if someone is "living in their mom's basement", it implies they can not or will not get a job allowing them to move out. i.e.: they are a loser. The resultant weak response "Screw you, GeoIP" seems to push that depiction even further. [[Special:Contributions/173.245.56.186|173.245.56.186]] 23:11, 16 July 2014 (UTC)
: I don't get this. The title text goes "Meet hot young singles in your mom's basement today?" Not their. Isn't this another "yo' mama" joke, simply implying that your mama has hot young singles in her basement?[[User:Mumiemonstret|Mumiemonstret]] ([[User talk:Mumiemonstret|talk]]) 08:02, 20 October 2014 (UTC)
:: I think it just means that you can do the same trick on *your* IP, just replacing the string "low earth orbit" with "your mom basement". [[User:MGitsfullofsheep|MGitsfullofsheep]] ([[User talk:MGitsfullofsheep|talk]]) 17:12, 24 October 2014 (UTC)
:: I think this means that your mum is the hot young single in her basement... [[Special:Contributions/141.101.98.241|141.101.98.241]] 12:27, 18 February 2015 (UTC)
:::Yes nothing hyperbole here. It is just another of Randall's many your mom jokes and can be insulting in almost anyway you think about the sentence. Have tried to change the explanation of the title text according to this. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:28, 13 February 2016 (UTC)
::::I don't think this is a "Your Mom" joke. I agree with the first comment. It is simply that GeoIP has gotten so accurate that it can now pinpoint the user's location to his Mom's basement. An adult living in his parent's house is termed shameful in US as it means that the adult does not have a job and cannot support himself/herself. That is why he's hiding in the basement in the first place, instead of it just being 'Mom's house'. The ad is usually like this -- "Meet hot young singles in <user's location>" where the <user's location> part is filled in from GeoIP. Clearly, there are no "hot young singles" in his Mom's basement and it feels like GeoIP is unknowingly shaming the user by reminding him that he is in his mom's basement, and hence the "Screw you" response. [[Special:Contributions/199.27.130.216|199.27.130.216]] 00:54, 14 February 2016 (UTC)
:::::But it's ''your'' mom's basement, so that suggests you are online dating with a close relative? I don't understand it. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 20:30, 12 December 2016 (UTC)
:::::: No that is simply GeoIP being fooled just like the ISS entry being put in. If someone living his his/her mom's basement got that ad, they already know there is no hot young girls in that area otherwise he would not be online trying to find close hot young girls. [[Special:Contributions/108.162.216.166|108.162.216.166]] 13:38, 3 August 2017 (UTC)

Is it just me or do the girls look like they're floating in zero gravity? [[User:Tbodt|Tbodt]] ([[User talk:Tbodt|talk]]) 00:13, 17 September 2017 (UTC)

401: Large Hadron Collider

2017-08-23T02:11:01Z

Tbodt:

{{comic
| number = 401
| date = March 26, 2008
| title = Large Hadron Collider
| image = large_hadron_collider.png
| titletext = When charged particles of more than 5 TeV pass through a bubble chamber, they leave a trail of candy.
}}

==Explanation==
The {{w|Large Hadron Collider}} (LHC) is the world's largest particle accelerator, used in physics research, and particularly for finding the {{w|Higgs Boson}}. The Higgs Boson is one quantum excitation of the Higgs Field, in the same way as the photon is a quantum of the electromagnetic field. Interaction between particles and the Higgs field can explain why other particles have mass. The Higgs Boson was first detected in 2012, and confirmed to exist in March 2013. It was the last particle of the {{w|Standard Model}} of Physics to be experimentally confirmed.

At the time of this comic's writing, the LHC was nearing completion, and the comic imagines experimental physicists starting up the LHC for the first time. It has taken many years to complete, and its purpose is mainly to prove the Higgs Boson exists - but in the comic it turns out the experiment does not show the boson. Since they can't see the Higgs Boson, they can only wait for the theorists to determine what actually happened - and maybe they would then come up with an even more expensive way to find it. In reality, experiments ran for many years and were analyzed for a very long time (4–5 years) before the scientists could conclude that the particle did exist. But imagine the opposite - and you have the scenario of this comic with a five-year delay between panel 3 and 4.

After the experiment failed the bored physicists try frying pigeons with the proton stream and instead end up giving a helicopter cancer. Both of which are impossible. This is because the stream is contained within the LHC, and non-organic entities can't get cancer. However, the proton stream could cause considerable damage to pigeons or humans, if it could hit any, as the U-70 synchrotron did to {{w|Anatoli Bugorski}} in 1978.

At that time there was also a big concern by some people that the LHC could produce {{w|Micro black hole|microscopic black holes}}. However, {{w|Cosmic ray|cosmic rays}} regularly strike Earth's atmosphere with particles at higher energies; thus, if the proposed doomsday scenario were possible it should have already happened. Many jokes were published like this video [http://www.youtube.com/watch?v=INodNZY5ytE "LHC End of The World Black Hole"].

The title text makes another joke about the effects of highly energetic particles, claiming that when they pass through a {{w|bubble chamber}} (an older particle detection device) they leave a trail of candy. TeV means {{w|Tera-}}{{w|Electronvolt}} and it equals 10^12 eV. 5 TeV is {{w|Electronvolt#Energy comparisons|about the energy}} of the LHC. It is of the order of the energy of a flying mosquito and would never be able to convert a liquid to candy or anything macroscopic.

==Transcript==
:The Large Hadron Collider, CERN...
:Megan: Okay, moment of truth. "click"
:Large Hadron Collider: "VVVVVRRMMMMMM"
:Cueball: Do you see the Higgs Boson?
:Megan: Nope.
:Cueball: Huh.
:Megan: Well, then.
:Cueball: Until the theorists get back to us, wanna try hitting pigeons with the proton stream?
:Megan: Already on it. Cool! I just gave a helicopter cancer.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Physics]]