explain xkcd - User contributions [en]

Talk:2955: Pole Vault

2024-07-07T07:50:31Z

Tier666:

The contrast/similarity with the conceipt of [[2952: Routine Maintenance]] is fairly clear, which might mean a similar train of thought inspired it, but I chose instead to append the suggestion that Randall was inspired by the upcoming Olympics, based upon close observation of the 'pop-zone' on the whole-Earth view. But the other link maybe could be said (instead?) if someone wants to write an appropriate paragraph. [[Special:Contributions/172.70.162.186|172.70.162.186]] 11:30, 6 July 2024 (UTC)

"This does not normally happen during a pole vault,[citation needed]". LOL @ "citation needed" [[Special:Contributions/172.68.64.213|172.68.64.213]] 13:23, 6 July 2024 (UTC)
:How do you cite a negative? [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 13:56, 6 July 2024 (UTC)
::<code><nowiki><etic>...</etic></nowiki></code> [[Special:Contributions/172.69.43.185|172.69.43.185]] 17:38, 6 July 2024 (UTC)

Just a thought - the shape of what's left made me think of a Prince Rupert's drop. [[Special:Contributions/172.70.178.58|172.70.178.58]] 21:22, 6 July 2024 (UTC)

Am I the only one reminded of Men without Hats: Pop Goes The World? https://www.youtube.com/watch?v=3zUUtf7gOe8 [[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 07:50, 7 July 2024 (UTC)

Talk:2946: 1.2 Kilofives

2024-06-16T12:57:19Z

Tier666:

== Challenge: Come up with a way like this to say the comic number #2946. ==

Challenge: Come up with a way like this to say the comic number #2946. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 03:00, 15 June 2024 (UTC)
:How about 4.91 hectosixes? [[Special:Contributions/172.69.33.190|172.69.33.190]] 04:19, 15 June 2024 (UTC)
:A kibitwo, four decascore, four score and eighteen. Two octooctotwentythrees and two. A gross-score, three score and 6. [[User:Jordan Brown|Jordan Brown]] ([[User talk:Jordan Brown|talk]]) 05:00, 15 June 2024 (UTC)
:A semidozen tetrahectaenneacontahena. [[User:Xkcd machine guy|Xkcd machine guy]] ([[User talk:Xkcd machine guy|talk]]) 08:25, 15 June 2024 (UTC)
:A decapentagross minus a semiennea. [[User:Xkcd machine guy|Xkcd machine guy]] ([[User talk:Xkcd machine guy|talk]]) 10:10, 15 June 2024 (UTC)
:A gross score and half a dozen elevenses[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 12:57, 16 June 2024 (UTC)
Interestingly, four score and seven is exactly how you say 87 in French (quatre-vingt sept) and Basque (laurogeita zazpi). Both count on base 20. [[Special:Contributions/172.70.90.138|172.70.90.138]] 05:16, 15 June 2024 (UTC)

== Comic discussion ==

Fun fact: libqalculate and the "Qalculate"/"qalc" programs can just deal with the title text:
qalc "50milli score"
50 × (10^−3) × score = 1
But it fails on the main part, the best that works is:
qalc "1.2kilo 5"
1.2 × 10³ × 5 = 6000
"five" gets interpreted as Euler's number × imaginary unit × unknown "f" × unknown "v". On my old laptop, I must have some other configuration or maybe an old version, because there it gets interpreted as 0×i×e=0, so you can enter "five plus five" and get 0. Maybe another challenge would be to get arbitrary misleading results out from equations like this. [[User:Fabian42|Fabian42]] ([[User talk:Fabian42|talk]]) 05:59, 15 June 2024 (UTC)

Perhaps East Hills NY, but their "Welcome" boards don't mention population, https://www.google.co.uk/maps/@40.7805262,-73.632634,3a,15y,25.75h,92.88t/data=!3m6!1e1!3m4!1sf5guvv2tETuyn0f_lSFh7A!2e0!7i16384!8i8192?hl=en&coh=205409&entry=ttu so this might just be a random name that R. came up with[[User:Zeimusu|Zeimusu]] ([[User talk:Zeimusu|talk]]) 07:40, 15 June 2024 (UTC)

In the comic *fives* does not stand for the number five alone, but for five people. So using it with a prefix is more valid. Sebastian --[[Special:Contributions/172.68.110.4|172.68.110.4]] 10:15, 15 June 2024 (UTC)
: Five kilopeople would be valid.
: [[Special:Contributions/172.70.91.63|172.70.91.63]] 10:34, 15 June 2024 (UTC)

I think it would have made more sense to say "half a kilodozen". --[[Special:Contributions/141.101.69.45|141.101.69.45]] 11:54, 15 June 2024 (UTC)
:It's just slightly off a gross of ultimate answers. [[Special:Contributions/172.70.162.186|172.70.162.186]] 16:30, 15 June 2024 (UTC)

I wonder why Randall chose to make Cueball the character saying that and not Black Hat/classhole. [[User:Turquoise Hat|Turquoise Hat]] ([[User talk:Turquoise Hat|talk]]) 15:35, 15 June 2024 (UTC)
:Live long enough to become the villain.
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 17:14, 15 June 2024 (UTC)

I realized that kilofives can be abbreviated as **k5**, as in "the population is 1.2 k5". Or if you're a roman, as **D**. [[Special:Contributions/172.71.22.92|172.71.22.92]] 16:30, 15 June 2024 (UTC)

Wouldn't CIↃ have been rendered as <nowiki></nowiki>?
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 17:22, 15 June 2024 (UTC)

I like it. I'm gonna start using this technique more. [[User:Psychoticpotato|P?sych??otic?pot??at???o ]] ([[User talk:Psychoticpotato|talk]]) 20:04, 15 June 2024 (UTC)

The weird thing is, this wasn't a weird way to say a number, it was just an old way to say it. See Psalm 90:10 in the King James Bible more examples. [[Special:Contributions/172.70.162.17|172.70.162.17]] 20:51, 15 June 2024 (UTC)

Y2K isn't really a nonce, it's rather common to shorten e.g. "123 thousand" to 123K or 123k. From my 00's online gaming days, I even remember kk, kkk and so on having been used to refer to millions, billions and progressively higher powers of 1000 respectively, but that might've been more niche. [[Special:Contributions/172.70.242.38|172.70.242.38]] 22:09, 15 June 2024 (UTC)

I'd also like to see the source for the claim "they're not ordinarily added to number words to modify their magnitude". For example, in Czech it is very common to say "mega" instead of "million(s)" (similar way as "thousand" is substituted with "K" in "Y2K") when talking about money and I've seen this usage also in English. --[[Special:Contributions/172.68.213.148|172.68.213.148]] 22:26, 15 June 2024 (UTC)

Y2K should be Y2k - the SI prefix for 1,000 is k to distinguish it from the unit abbreviation K, for Kelvin. [[Special:Contributions/172.68.210.22|172.68.210.22]] 23:18, 15 June 2024 (UTC)

Talk:2943: Unsolved Chemistry Problems

2024-06-10T09:54:43Z

Tier666:

P stands for poncentration, SMH my head 😒 --[[Special:Contributions/172.70.162.211|172.70.162.211]] 21:22, 7 June 2024 (UTC)
:You may find this helpful: [https://en.wikipedia.org/wiki/RAS_syndrome RAS syndrome] [[User:Trogdor147|Trogdor147]] ([[User_talk:Trogdor147|talk]]) 22:25, 8 June 2024 (UTC)
::Oh, that was intentional, my friend. (Also, I believe you meant {{w|RAS syndrome}}.) --[[Special:Contributions/162.158.74.48|162.158.74.48]] 07:34, 10 June 2024 (UTC)
I think p stands for "pitch", because people start pitching random numbers when they are supposed to calculate a pH (or even an pOH) from given concentrations.[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 09:54, 10 June 2024 (UTC)

Is 'depolymerization' in this context referring to means of chemically recycling plastics? As I understand it, we basically just do recycling of thermoplastics at the moment by physically melting them, whereas being able to split a plastic apart into its component monomers would in principle enable a completely closed loop lifecycle for plastics, easing the strain on dwindling oil reserves and landfills and whatnot. Since these are supposed to be important unsolved problems, I feel like it probably is a reference to this, but I'm not a chemist and there may be something else which makes more sense. [[Special:Contributions/162.158.33.134|162.158.33.134]] 22:37, 7 June 2024 (UTC)
:In a chemistry context, depolymerization is simply the process of breaking down polymers into monomers. Plastic recycling is one potential application. Another is production of biofuels. It's a well understood process (usually just heat it up enough and/or apply the proper chemical treatment). Getting the desired outputs in an efficient manner is, in some cases, an unsolved problem. [[Special:Contributions/172.69.246.150|172.69.246.150]] 16:05, 8 June 2024 (UTC)

i've always been taught that the p stood for "parts". [[user talk:lettherebedarklight|youtu.be/miLcaqq2Zpk]] 04:01, 8 June 2024 (UTC)

:In chemistry, I was taught that it was "potential". I didn't even know this was in dispute. [[User:L-Space Traveler|L-Space Traveler]] ([[User talk:L-Space Traveler|talk]]) 04:54, 8 June 2024 (UTC)

P does not stand for anything. Originally, it was contrasted with q. Sørensen was performing electrochemical experiments and contrasted the reference electrode q with the hydrogen electrode p. Using p and q like this is common, like using x and y, u and v, or m and n. It's not an abbreviation, just a variable name. He recommended normalizing the concentration of hydrogen ions (i.e. dividing it by 1 mol/l) and calling the result Cₚ or C_q (depending on the electrode). Then each of these tends to be a small number, which we could write as 10^(-p) or 10^(-q). The number p⁺_H then represented the negative log of the normalized concentration of hydrogen cations at the hydrogen electrode. You can read about it in "The origin and the meaning of the little p in pH" by Jens G. Nørby, published in Cell. The associations with words like "power" and "potential" are now widely considered urban legends. [[Special:Contributions/172.70.134.39|172.70.134.39]] 04:55, 8 June 2024 (UTC)

My chemistry teacher at school taught us that pH stands for Latin "pondus hydrogenii", meaning "weight of hydrogen". I never questionned this, until today. [[Special:Contributions/162.158.111.178|162.158.111.178]] 19:20, 8 June 2024 (UTC)

Added some stuff concerning the biochem part, since that's my field of expertise. I recently personally felt the problem of the protein folding problem trying to get supercomputer time to simulate a protein I was studying! Also, given that antibody-antigen generation is still extremely faulty I highly highly doubt arbitrary enzyme design will be solved anytime soon, even though great leaps in protein folding have been made. [[Special:Contributions/172.70.39.40|172.70.39.40]] 02:13, 9 June 2024 (UTC) caffeinated biochemist

THe issue with loose protons is not ib being or not being atoms. Loose protons have no electrons at all, and thus cannot do Pauli repulsion, and thus cannot do regular chemistry - "should" burrow too much into electron density. The former, however, is not true, because loose protons attach themselves to lone pairs and thus get eletrons and thus can do regular chemistry. This duality is the source of the "proton controversy". In water, for instance, lone H+ do not exist and form H3O+ and H5O2+ /(H2O--H--OH2)+. [[Special:Contributions/162.158.172.4|162.158.172.4]] 09:25, 9 June 2024 (UTC)

== "ρ operator" ==

I'm not finding any mention of the "ρ operator" in a Google search. Is this section just fiction? The author has no prior contributions to this wiki. [[User:BunsenH|BunsenH]] ([[User talk:BunsenH|talk]]) 22:42, 9 June 2024 (UTC)
:As this operator isn't even mentioned in the comic the section is irrelevant, fiction or not. Trivia at best. I removed that part [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 09:52, 10 June 2024 (UTC)

Talk:2925: Earth Formation Site

2024-04-28T09:52:09Z

Tier666:

The title text is only true for geocentric latitude and longitude, not geodetic (which is what is commonly used). [[Special:Contributions/172.69.58.125|172.69.58.125]] 18:32, 26 April 2024 (UTC)

I'm impressed that whatever distant body that sign is placed upon, has actually developed plant life. Especially since it would need to be parked in place relative to the rest of the observable cosmos, & thus seems unlikely to have a suitably close star making regular appearance overhead...
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 19:11, 26 April 2024 (UTC)
:👍[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 09:52, 28 April 2024 (UTC)
::Magrathea? [[User:L-Space Traveler|L-Space Traveler]] ([[User talk:L-Space Traveler|talk]]) 14:46, 27 April 2024 (UTC)
: Hi Proph! I just wanted to say that I enjoy reading your comments here and in the SMBC comment page, if you are in fact ProphetZarquon in both places. [[Special:Contributions/172.70.175.28|172.70.175.28]] 21:46, 26 April 2024 (UTC)
::If there's another Prophet Zarquon out there - wait, nope, looks like that's me, too...
::[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 03:25, 27 April 2024 (UTC)

:The spatial location of a famous person's birth is technically not where the Solar System now is, also. If you're going to be picky about that. If you do allow the Earth's worldline to be accounted for, then it's broadly true that Earth formed (looks out of window at home) here. I think the principle concern there is whether Earth formed in the collision of planets named Ear and Theia, or whether Earth was Earth before Theia came along, which either way seems to be why there is such a large Moon beside it - made of material from both of the previous planets. And it probably counts as a change of course from the previous situation, although the apparent likelihood that Theia formed in Earth's orbit in originally a Trojan relationship may bear on that - if one planet just caught up with the other in orbit, like tailgating in traffic. Robert.Carnegie@gmail.com [[Special:Contributions/141.101.98.184|141.101.98.184]] 17:35, 27 April 2024 (UTC)

The ridiculously specific date may be a reference to how real historical markers frequently get dates incorrect [[Special:Contributions/172.70.127.135|172.70.127.135]] 23:29, 26 April 2024 (UTC)

The other side of the sign says, "At this exact point in space, 13.7878693 billion years ago, the Big Bang took place." That's true of every point in space, according to the current model. The Big Bang implies that all of space was a single point, and space itself expanded outward from that point. [[User:Nitpicking|Nitpicking]] ([[User talk:Nitpicking|talk]]) 03:07, 27 April 2024 (UTC)

The explanation needs to be rewritten. It is missing the point and far to detailed for just saying: The marker could be standing at any point of earth's surface, as reinforced by the title text. The whole discussion about galaxies and solar systems moving is just a matter of the reference system and does not contribute to the understanding of the comic.--[[Special:Contributions/172.70.243.32|172.70.243.32]] 07:28, 27 April 2024 (UTC)
* I disagree. The section is saying that it could not have reasonably happened on Earth itself due to the fact the Earth and the Solar System itself move around through space. [[User:SomeoneIGuess|someone, i guess]]([[User talk:SomeoneIGuess|talk i guess]]|[[Special:Contributions/SomeoneIGuess|le edit list]]) 13:25, 27 April 2024 (UTC)
::Randall was once a physicist. He's aware of the fact that there is no absolute system of measurements, and that locations on Earth are always relative to Earth coordinates, not some sort of galactic map. [[User:Nitpicking|Nitpicking]] ([[User talk:Nitpicking|talk]]) 14:10, 27 April 2024 (UTC)

Can the Earth's core even have a latitude and a longitude? Aren't those all referring to the surface? --[[Special:Contributions/162.158.90.198|162.158.90.198]] 11:47, 27 April 2024 (UTC)
:You're right. That is the joke, in fact. [[User:Nitpicking|Nitpicking]] ([[User talk:Nitpicking|talk]]) 14:10, 27 April 2024 (UTC)
:Well, 162.158... is 'right' except that you ''can indeed'' have a latitute, longitude and also ''altitude/depth'' on top, not just restricting yourself to the surface (or Mean Sea Level or whatever other geometric surface you consider as your default).
:As to whether the (centre of the) core can have latitude and longitude, it's a very similar argument as that of whether the (coordinate) poles can have longitudes as well as ±90° latitude.
:If you are asking what either pole's longitude is, it would depend upon the what the algorthm was specified (or fails to have been) for the situation, as you could be told 'undefined', 'NaN', given a placeholder constant (e.g. zero), an effectively random value, a value determinate upon what led to this (you were at <location>, 10 miles south of the north pole, and modified that by 10 miles direct northwards travel, so maintain the same longitude as <location> had), a value that would normally be out of range (e.g. for silently passing on, to do the error-catching/checking later on) or several other options.
:If you're ''specifiying'' the longitude of a pole (for use in an onward algorithm) then it may well (or may not!) be possible to provide any/all of these, but perhaps ultimately ignored/chucked away as meaningless. (Unless you have it doing something like "go ten miles south from north pole, what's the <location> now?", intentionally or otherwise disambiguating via the 'arbitrary but definite' polar longitude.)
:So, similarly, if you're asking "What lat/long is the location of the core", the chances are that you're going to get to go through a different manner of deriving a result from that of requesting information such as "This is my lat/long. Is this (above) where the core is?".
:...though, yes, this still ''is'' very much the joke. Including all the ambiguity as to the rationale involved in however it apparently became disambiguated. [[Special:Contributions/172.69.195.122|172.69.195.122]] 21:59, 27 April 2024 (UTC)

Talk:2891: Log Cabin

2024-02-08T10:15:00Z

Tier666:

:: "''The odd part about it is the bottom right corner, which appears to be infinitely recursive copies..''"
The whole right side is the left side, shrunk and recursed. Each iteration rotated 90 degrees. The 'shrink' is about 1.616 by my squint, a lot like a "[https://en.wikipedia.org/wiki/Golden_ratio Golden Ratio]" LOGarithmic spiral, as NickM says. [[User:PRR|PRR]] ([[User talk:PRR|talk]]) 19:49, 7 February 2024 (UTC)

::This is a LOGarithmic spiral [[Special:Contributions/172.70.210.103|172.70.210.103]] 19:52, 7 February 2024 (UTC)NickM

:: It is precisely the golden ratio, assuming the left side is a square [[User:Terdragontra|Terdragontra]] ([[User talk:Terdragontra|talk]]) 22:09, 7 February 2024 (UTC)

Assuming a standard 36" wide front door, then the next "front" door would be 22.27 inches, then 13.78 inches, then 8.53 inches, at which point I doubt the inspector could squeeze through it, though I guess they could still take a peek inside the next recursion. [[Special:Contributions/172.68.34.58|172.68.34.58]] 20:57, 7 February 2024 (UTC)

Infinite bedrooms, infinite baths, close to schools and shopping. [[Special:Contributions/172.69.247.48|172.69.247.48]] 21:00, 7 February 2024 (UTC)
::Government: Your property tax comes up to infinite dollars. --[[Special:Contributions/172.71.26.160|172.71.26.160]] 21:45, 7 February 2024 (UTC)

Interesting comparison with the archetypal "labyrinth". It's actually a fractal version that only avoids being unicursal-with-no-dead-ends due to the off-living-room private spaces being quite trivial offshoots. Which arguably makes it ''fairly'' classical in nature. [[Special:Contributions/172.70.90.114|172.70.90.114]] 21:18, 7 February 2024 (UTC)

Should there be a mention that due to the limitations of the image format, it only actually achieves eight iterations? Which makes sense given that construction materials also have limits, and is still enough that the inspectors might be a bit confused if they don't pay close enough attention. [[Special:Contributions/172.69.60.216|172.69.60.216]] 23:21, 7 February 2024 (UTC)

Write it [https://www.explainxkcd.com/wiki/index.php?title=2891:_Log_Cabin&diff=prev&oldid=334498 how you want], I just wanted to avoid calling a room with no bath (but a shower) as a "bathroom", especially when I was mentioning a 'bathroom' with an actual bath in it so soon after. Not that there's a completely unambiguous term for the room with the toilet/lavatory/whatever in it. (For reference, for me it's "the toilet", despite that also being the porceline item itself, and even that is derived from a hairdressing cloth, through a string of euphemisms. But knew that wouldn't be accepted by the wider readership.) [[Special:Contributions/172.70.85.26|172.70.85.26]] 01:49, 8 February 2024 (UTC)
:In the USA, any room with a toilet and sink is typically called a "bathroom" whether or not there is a literal bath within. [[Special:Contributions/172.70.131.3|172.70.131.3]] 09:33, 8 February 2024 (UTC)
::Don't think it's particularly a US/UK thing - it's pretty commonly called a 'bathroom' in the UK too. I think the point of the editor above was the potential for confusion between the ''two'' 'bathrooms', and how to avoid it.[[Special:Contributions/172.69.43.243|172.69.43.243]] 09:44, 8 February 2024 (UTC)
:Using a language that allows to say "Sh*thouse" in a nice way (praised be the diminutive!) helps in such cases...[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 10:15, 8 February 2024 (UTC)

Talk:2833: Lying

2023-09-28T17:32:46Z

Tier666:

Why the heck is the image so biiiiig? {{unsigned ip|172.69.135.23|03:54, 26 September 2023}}
:well, looks like he accidentally published the source file for the comic... [[Special:Contributions/141.101.100.205|141.101.100.205]] 04:06, 26 September 2023 (UTC)
::Good. People should be using HD monitors by now. (EDIT: I didn't realize it was 8k, but still, don't most browsers let you resize images anyway?) [[Special:Contributions/172.70.126.188|172.70.126.188]] 08:41, 26 September 2023 (UTC)
:::Why do I have to lug around an HD monitor as well as my smart-tablet?
::::Why doesn't your smart-tablet have an HD screen? My phone is 2960 x 1440 and it still fits in my pocket. [[Special:Contributions/172.70.127.168|172.70.127.168]] 00:29, 27 September 2023 (UTC)
:::::Nobody said HD ''screen''. It is the suggested additional monitor that is impractical. Including a suitable power supply and of course the appropriate dongles/etc. [[Special:Contributions/172.71.242.63|172.71.242.63]] 01:53, 27 September 2023 (UTC)
::::::Why do you need an additional monitor? Why can't your tablet display in HD by default? [[Special:Contributions/172.71.254.46|172.71.254.46]] 19:22, 27 September 2023 (UTC)
:::(Actually, it's not width that's the problem, for me, but height. As using in portrait orientation makes text too small for browsing, and I hate sites that 'mobile optimise' assuming I'll turn my device that way.)
::::Most mobile browsers have a button for "show desktop version". I just hate when people assume vertical videos are okay. Even when I'm using my phone, landscape is better. [[Special:Contributions/172.70.100.65|172.70.100.65]] 00:30, 27 September 2023 (UTC)
:::::Do you know how well the "show desktop version" ''doesn't'' work. It frequently doesn't switch away from the mobile-URL (e.g. "en.m.wikipedia.org" to "en.wikipedia.org", or "/FOO-mobile.htm" to "/FOO.htm") and you still have to make that sort of change manually to the address-bar to fuly jailbreak out of the hard-coded "useful" mobile functionality (which may come back once it forgets your preference and gets redirected to use them all again), and I'm pretty sure that the places that do this detection invisibly (fingerprinting the browser used) to make the changes behind the scenes don't all fully honour the browser setting, perhaps just get over-riden by some more insistent indicator that the site-author has encoded later in the decesion-stack (e.g., at least for me, I ''cannot'' get the non-mobile layout of https://cyclingtimetrials.org.uk/find-events to display on this device, for whatever reason). [[Special:Contributions/141.101.98.174|141.101.98.174]] 01:11, 27 September 2023 (UTC)
:::Note that especially wide images play merry-hell with the rest of the page (when it breaks out of the pixel-limits assumed), and an image that's twice as large (in both dimensions) could be quadruple the data (depending upon image compression ratios), which has data/bandwidth/etc issues that not everyone can easily suck up and laugh off, even in this post dial-up era. It ought to be best not to assume that the best quality image is the 'best' or desired, although that ship has long sailed. [[Special:Contributions/172.71.242.83|172.71.242.83]] 09:08, 26 September 2023 (UTC)
::::Unless I'm misunderstanding, the image is now in the usual size range (590x887 in this case). -- [[User:Dtgriscom|Dtgriscom]] ([[User talk:Dtgriscom|talk]]) 20:32, 26 September 2023 (UTC)
:::::Something changed, yes. I haven't yet investigated if it was softcoded ("imagewidth=" in the template, or whatever it is, but perhaps still serving the full image to scale-down) or the uploaded image reuploaded in the 'friendlier' pixel-sizes. And for me it doesn't matter, but obviously the exact solution may be just as important for others, so I hope it isn't just the fudged one. (I may go and check, though I currently have no power to do anything about it.) [[Special:Contributions/141.101.98.174|141.101.98.174]] 01:11, 27 September 2023 (UTC)
:::::Addendum: Just checked, and it was ''softcoded too large'', originally, with "imagesize = 4422x6653px" for some unknown reason. I don't know why the uploadbot set it like this (incorrect metadata/sidedata at source?) but that definitely 'broke' the original page.
::::::So the imagesize was ''lying'' about the true image size? That reminds me of the title...
:::::Until just now I had only seen the slightly later version or the page where the image now merely strained the page-size (from a revised imagesize=, obviously to deal with the page-rescaling issue), then the latest where it's given the more usual one (but is still the exact same source _2x image behind the scenes).
:::::From all the talk about this, I had assumed that the image (like it sometimes has been) was the 'compositing' version not yet cleaned up by Randall to remove onion-skin 'planning' layers, etc. Instead, we were just given an upscaled correct version, but of course people were still able to dwell upon the details exposed by zooming in. [[Special:Contributions/172.71.178.219|172.71.178.219]] 01:29, 27 September 2023 (UTC)
::::::It was reuploaded to be normal sized later. http://web.archive.org/web/20230926034049/https://imgs.xkcd.com/comics/lying.png [[Special:Contributions/141.101.100.194|141.101.100.194]] 05:20, 27 September 2023 (UTC)
:::::::The initially uploaded explainxkcd version [https://www.explainxkcd.com/wiki/index.php?title=2833:_Lying&oldid=324385 as seen dynamically mis-scaled here] has not been changed, though. Which is different from my original assumption taken from the chatter about it.
:::::::If (perhaps, just looking at the URL above) it's that the _2x was normal _2x but the '1x' was mis-sized (we've seen that happen before) and/or the rough/not-yet-finalised working copy, then this might need better explaining. That'd explain why the _2x was given larger default dimensions. (I think the 'bot currently grabs the _2x but 'suggests' the non-2x size... I could then see how this would have happened.) [[Special:Contributions/172.70.86.179|172.70.86.179]] 05:53, 27 September 2023 (UTC)
::::::::Yup. That is what happened. —[[User:Theusaf|theusaf]] ([[User talk:Theusaf|talk]]) 15:01, 27 September 2023 (UTC)

The rhythm of the title text calls to mind Spock's words to Kirk as he's dying at the end of Wrath of Khan: "I have been, and always shall be, your friend." This can't be a coincidence. {{unsigned ip|172.70.210.182|08:06, 26 September 2023}}

I'm the same. Can't stand these games. I have a hard enough time with jokes that people refuse to explain; if I have to _intentionally_ mislead people, who know my tics to start, where's the line? What's real, what's fake, what's important, what's just another joke?

I need to lighten up? No, the world needs to be comprehensible. I can't just choose to know what's real and what isn't. Other people can very easily make it clear to me, if they so desire.
[[Special:Contributions/162.158.2.39|162.158.2.39]] 06:35, 26 September 2023 (UTC)
:i, uh, good for you. [[user talk:lettherebedarklight|youtu.be/miLcaqq2Zpk]] 07:04, 26 September 2023 (UTC)
:Simple answer: Don't play those games.
:Non-simple answer: Learn how to play those games with your advanced hyper-analytical abilities being used to your advantage (or as a "non-optional social convention") in which the reality is the game you're in and thus you are fulfilling the role of your existence.
:Meta-answer: I think you're a Joker (winning condition is to be lynched). Or maybe one of a number of other player-types which demands that you play differently from either mainstrean Mafia or vanilla Villager. Which, in a four-player game (very short of practical assignments!) makes it a bastard-setup of some sort. (Rather than single mafia/werewolf and all the rest vanilla village, or ''possibly'' one cop/special-role of some kind.) [[Special:Contributions/172.71.242.83|172.71.242.83]] 09:08, 26 September 2023 (UTC)
::Solution? Just reshuffle if a "I can't lie - person" would get to be a mafioso/vampyre or werewolf... But yeah, I hope they have more players in the background[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 17:32, 28 September 2023 (UTC)

How do you even play Mafia with four people? Under standard rules, you have one moderator (Alice), one mafioso (Bob) and two civilians (Charlotte and Dave). Bob kills Dave in the first night, then there are only one mafioso and one civilian left, and the mafia wins, game over. Does anybody know a mod that would make it work with so few players? [[User:Comsmomf|Comsmomf]] ([[User talk:Comsmomf|talk]]) 11:16, 26 September 2023 (UTC)
:It's a Mafia-''style'' game, apparently. It could be moderatorless (or with a playing-controller who manages the gameplay outwith whatever role they have) and streamlined.
:How about four (playing?)cards, one designating the villain. Cards are dealt randomly an all close their eyes for the night phase, only the villain gets to open them and 'tap out' their choice of villager (some subtle way, like a feather on a stick ((not shown in comic!)) that everyone has, that can be used at will to silently reach anyone - reverse the stick to tap the centre of the table to signal completion?).
:Because that leaves little logic for the Town to follow, just blindly moving towards "lynch or lose" by luck, you can afford (maybe) a Cop role (from a different card) who then operates after that, at 'night'. They use ''their'' stick to ask a given player to thumbs up/down their status, with the and/or you even could do a Blocker that way (tell a victim to ignore being night-killed), etc. Or even mix things up with a role-giving role, whatever you need to balance play in the right way. 'Dead' night-role players could just 'tap completion' without having done anything, if there's no lynch-reveal (beyond town/scum, if even that before the sole scum announces this game is over and they won/lost).
:It'd have to be on the honour-system, and I could see mistakes and accidental reveals, but the post-mortem of a few such games might suggest refinements and precautions that haven't occured to me.
:...though it'd be easier (even 'player led') with maybe a minimum of six participants (could afford to have two villains, subtly gesturing ideas to each other, and a more complete set of "power townies" than just the one. [[Special:Contributions/172.71.134.192|172.71.134.192]] 12:51, 26 September 2023 (UTC)

I guess I just assumed every comic out there by anyone was printed with Comic Sans but when I was skimming through the source image I noticed the letters are unique and he hand-writes them. [[Special:Contributions/172.70.179.43|172.70.179.43]] 12:09, 26 September 2023 (UTC)

: Yes that's always been noticable from the kerning. His habit of tucking the left-hand vertical of an "H" under a preceding "T" - and shortening the left side of a "T" after an "I" (to pick just two examples)...is not something that any automated text rendering system that I'm aware of can produce. --[[Special:Contributions/172.71.167.135|172.71.167.135]] 12:25, 26 September 2023 (UTC)
::Also, his O's are quite noticably different from one another. Perfect repetition of loop sizes is a dead giveaway of a "handwritten" font. [[Special:Contributions/172.69.247.44|172.69.247.44]] 14:22, 26 September 2023 (UTC)
:::Also 'I', the pronoun, is serifed, whereas the letter i elsewhere, whether upper or lowercase, is not.[[Special:Contributions/172.71.178.5|172.71.178.5]] 09:00, 28 September 2023 (UTC)

The published image appears the correct size on xkcd.com now. It seems it would be nice to preserve the larger one (edit: it also didn't look upscaled to me, it looked source dimensioned). I'm not sure how to upload an image. [[Special:Contributions/172.71.254.248|172.71.254.248]] 14:28, 27 September 2023 (UTC)
:You (and I) cannot upload it, but if an established named editor cares to grab the archive.org and do so... (Or just rely upon the archive link, and the image link behind it, being available directly for long enough.) [[Special:Contributions/172.70.91.203|172.70.91.203]] 16:13, 27 September 2023 (UTC)

Is there any actual difference between Mafia and Werewolf, beyond what the killers are called? [[User:GreatWyrmGold|GreatWyrmGold]] ([[User talk:GreatWyrmGold|talk]]) 22:47, 27 September 2023 (UTC)
:Aside from thematic differences, I think any 'baseline' differences are probably swamped by the variations seen within each gametype (number of players, spread of roles, additional further tweaks to rebalance/unbalance according to taste). And things can often progress more differently between SpeedMafia ('live' chatroom play) and a Mafia run through a persistent forum/BBS than could be seen between SpeedMafia and a Werewolf game 'in the round' (in person, chairs in a circle).
:But I couldn't immediately recite the numbers of 'standard' roles (e.g. "for X players, there should be Y mafia/werewolves, 1 doctor, <etc>"), it could be that the ratios are actually different and the 'special role mix' (by whatever name, cop/seer, etc) a bit different, but it's all subject to the whim of the game moderators anyway, and there's usually a personalisations or two by them, just to mix things up (sometimes tending towards Bastard setup, whether the players know to start with or not; and not all 'work', but an experienced mod will at least leave it entertaining). [[Special:Contributions/172.71.178.13|172.71.178.13]] 07:44, 28 September 2023 (UTC)

Talk:2801: Contact Merge

2023-07-13T08:32:33Z

Tier666:

Same person.
:All three of them...[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 08:32, 13 July 2023 (UTC)

Why is he only using John's first name when talking about him, as if Surf King should know who that is, when it's clear they've "never met"?
Shouldn't it be: My phone keeps wanting to merge you with my friend John Smith? [[Special:Contributions/172.71.178.30|172.71.178.30]] 07:46, 13 July 2023 (UTC)
: Because he's spectacularly unaware, and assumes that everyone that he 'knows' also know each other?[[Special:Contributions/172.70.90.110|172.70.90.110]] 08:16, 13 July 2023 (UTC)

Talk:2772: Commemorative Plaque

2023-05-06T07:31:36Z

Tier666: I do not know!

Any bets on how many copies of this plaque people send him? [[User:Jordan Brown|Jordan Brown]] ([[User talk:Jordan Brown|talk]]) 00:25, 6 May 2023 (UTC)

I do not understand the plaque... If the test is correct, shouldn't there be an order button for not that expensive commemorative plaques on xkcd.com/2772? Questions over questions...[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 07:31, 6 May 2023 (UTC)

Talk:2768: Definition of e

2023-04-27T09:15:53Z

Tier666:

This is of course one way of arriving at the value of e: https://en.wikipedia.org/wiki/E_(mathematical_constant)#Compound_interest [[User:Trimeta|Trimeta]] ([[User talk:Trimeta|talk]]) 03:55, 27 April 2023 (UTC)

I do not know who said that Miss Lenhard is after a dollar - but that is so not her![[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 09:15, 27 April 2023 (UTC)

2768: Definition of e

2023-04-27T09:14:23Z

Tier666: /* Explanation */ I personally do not think that Miss Lenhart really wants to charge a dollar, but lets leave open the possibility, even if it totally seems not her...

{{comic
| number = 2768
| date = April 26, 2023
| title = Definition of e
| image = definition_of_e_2x.png
| imagesize = 571x186px
| noexpand = true
| titletext = Yeah, my math teacher back in high school set up the system to try to teach us something or other, but the 100% rate was unbelievably good, so I engineered a hostile takeover of his bank and now use it to make extra cash on the side.
}}

==Explanation==
{{incomplete|Created by 2.718 BANKERS - Please change this comment when editing this page. Do NOT delete this tag too soon.}}
The mathematical constant ''{{w|e (mathematical constant)|e}}'' (also known as Euler's constant) is typically demonstrated in terms of compound interest. Here, Miss Lenhart seems to be setting up such an example, but is actually asking her student to deposit money.

The constant ''e'' can be described {{w|E (mathematical constant)#Compound interest|in the context of compound interest}}. For a bank account that pays interest at a rate of 100% per year, and that interest is paid ''n'' times a year and compounded, then a $1 deposit will grow to $1 * (1 + 100%/n)^n after a year. As ''n'' approaches infinity (continuous compounding), the amount approaches ''e'' dollars. In the comic, minutely compounding is used as an approximation of continuous compounding; here ''n'' = 365 * 24 * 60 = 525,600, and the resulting amount would be $2.718279.

As such, one would expect Miss Lenhart to say in panel 4 something like "you'll have ''e'' dollars in a year". It is not clear if Miss Lenhart sees the growth of the deposited amount as answer enough to explain ''e'' or if she's just charging $1 for answering the question of what ''e'' is. The supposed interest rate the teacher can earn off this deposit is so high that the $1 principal will grow to over $22,000 in ten years, $485 million in twenty years, or $10.6 trillion in thirty years.

In the title text, a {{w|Takeover#Hostile|hostile takeover}} is an acquisition of a company against its management's wishes, by simply buying up its shares from its shareholders. A bank offering accounts with an {{w|APY}} of 172% is certain to go bankrupt almost immediately, making it a very bad investment. Banks earn money by lending at a higher rate than they pay on deposits, but it is illegal to charge such high interest rates on loans, and no one would take them anyway. Therefore the bank will lose huge amounts of money on deposits while earning essentially no revenue. The speaker is effectively buying out the bank in order to drain it of its own funds, which is both illegal and financially pointless. Alternatively, their plan may be to buy 51% of the stock, then attempt to extract a majority of the bank's reserve funds through huge high-interest deposits, which is still not profitable, since banks hold only a small fraction of deposits in reserve, and their market capitalizations (the cost of buying all the stock) are much higher than their total reserves. Even if for some reason this bank had a very high reserve ratio, and this tactic could somehow be profitable, it would still be illegal, effectively robbing the other 49% ownership of its equity through deliberately bad management.

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

:[Hairy is seated at a classroom desk, with Miss Lenhart standing in front of him, and a chalkboard behind her.]
:Hairy: Can you explain what the constant ''e'' actually ''means''?
:Miss Lenhart: Sure.

:Miss Lenhart: I have a bank account that pays 100% annual interest, compounded every minute.

:Miss Lenhart: If you deposit $1 now,

:Miss Lenhart: I will answer your question.

[[Category:Comics featuring Hairy]]
[[Category:Comics featuring Miss Lenhart]]
[[Category:Math]]

{{comic discussion}}

Talk:2761: 1-to-1 Scale

2023-04-11T08:04:49Z

Tier666:

Really want an explanation for this one. [[User:JobbieJimmies|Melomaniac]] ([[User talk:JobbieJimmies|talk]]) 03:23, 11 April 2023 (UTC)

My comment got deleted by a bot!!! [[User:Unreliable Connection|2659: Unreliable Connection]] ([[User talk:Unreliable Connection|talk]]) 03:23, 11 April 2023 (UTC)
:RIP... [[User:JobbieJimmies|Melomaniac]] ([[User talk:JobbieJimmies|talk]]) 03:25, 11 April 2023 (UTC)
:No, UC, it just got overwritten by the 'bot, when it did its job and (re)created the wholeinitial state of the various pages to depict the new comic coming out. (Noting that you'd not set them all up fully/correctly.)
:That you had spotted it already and had ''just'' gotten in ahead of the 'bot clearly isn't something it was prepared to handle. But as someone spotting it can usually wait a short while for the 'bot to catch up, I don't think it's a problem. In fact, you could have just copied your old contributions into the now receptive page(s), with nary any comment. Too late now. [[Special:Contributions/172.70.90.101|172.70.90.101]] 03:44, 11 April 2023 (UTC)

:: This may have broken the next link on the previous page. --[[Special:Contributions/172.71.160.36|172.71.160.36]] 06:41, 11 April 2023 (UTC)

The lines represent the surfaces of the planets I think, so it's basically all the planets overlaid on top of each other. [[Special:Contributions/172.71.142.35|172.71.142.35]] 03:28, 11 April 2023 (UTC)

:Yup, I think it's what he meant - but I find it unlikely that the gas giants would have this clear cutoff of a "surface". [[Special:Contributions/162.158.189.241|162.158.189.241]] 03:34, 11 April 2023 (UTC)
::If there is a gas - liquid phase transition (and I think at least the gas giants have them): Why not? OK, you could see "rain" as blurring a clear cutoff, but wouldn't that also apply to Earth, then?[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 08:04, 11 April 2023 (UTC)

I’d think the same citation as stands for ridiculously large would also cover larger than currently exists on earth, and his that citation is not in fact needed? [[Special:Contributions/162.158.174.186|162.158.174.186]] 06:53, 11 April 2023 (UTC)

:It seems like the gas-covered worlds are explicitly those with clearly cutoff "surfaces," so maybe in those cases the cutoff is some specific gas density -- which occurs at a consistent radius throughout the planet, thus creating a flat surface. While for rocky worlds (except Venus, which is treated like a gas planet here), a density cutoff can lead to bumpiness due to terrain. [[User:Trimeta|Trimeta]] ([[User talk:Trimeta|talk]]) 03:57, 11 April 2023 (UTC)

On Twitter there seems to be concern that all planets are depicted flat. This may make this a contribution/mockery of the ongoing [https://en.wikipedia.org/wiki/Flat_Earth Flat Earth] discussions in some corners of the internet. --[[Special:Contributions/198.41.242.132|198.41.242.132]] 06:49, 11 April 2023 (UTC)

The display for an uncropped version of the image would not only be larger than any display on earth. It would be larger than earth. [[Special:Contributions/162.158.86.243|162.158.86.243]] 06:59, 11 April 2023 (UTC)

Talk:2755: Effect Size

2023-03-29T17:03:42Z

Tier666:

Wow, it looks like I'm first![[Special:Contributions/162.158.146.40|162.158.146.40]] 16:40, 27 March 2023 (UTC)

;Wasn't something like this actually done?
Robert Sapolsky mentions an obscure paper that actually did something like this. They did a meta-analysis of the average reported error throughout various disciplines in order of the physical size of the objects being studied (e.g., from cells to organs to etc.), and found no correlation between them. The conclusion was that this was evidence that philosophical reductionism was flawed. [[User:Fephisto|Fephisto]] ([[User talk:Fephisto|talk]]) 22:45, 27 March 2023 (UTC)
: Did you manage to find it? [[Special:Contributions/172.70.57.203|172.70.57.203]] 08:49, 28 March 2023 (UTC)
:: [https://www.youtube.com/watch?v=_njf8jwEGRo Here] is the talk. He talks about the paper around 1:26:00. The figure is 1:26:50. [[User:Fephisto|Fephisto]] ([[User talk:Fephisto|talk]]) 13:18, 29 March 2023 (UTC)
:: Maybe [https://muse.jhu.edu/pub/1/article/401203/summary LINK] Titled "Reductionism and Variability in Data: A Meta-Analysis" Sapolsky, R.; Balt S.; Perspectives in Biology and Medicine 39(2), 1996[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 16:21, 29 March 2023 (UTC)

But does the meta-analysis include itself? Technically, it too is part of Science...
Artinum [[Special:Contributions/172.70.91.151|172.70.91.151]] 13:06, 28 March 2023 (UTC)
: It's SCIENCE all the way Down! [[User:Kev|Kev]] ([[User talk:Kev|talk]]) 18:39, 28 March 2023 (UTC)

scroll box location is ~25.5% down track: scroll box is 10px high, scrollbar is 290px high, 54px above box, 226px below = center of scrollbox is 59/231 = 25.541..% = ~209,815 pages of total studies. Adjusted to 210,000 to account for rounding errors. (Plus the scroll box might not even move a pixel for a number of pages).[[Special:Contributions/162.158.146.41|162.158.146.41]]

Did anyone notice the asterisk next to one of the graph elements? There's got to be a lot of those... Not all scientific studies (I would say very few) can be boiled down to a single numerical output.[[Special:Contributions/162.158.146.41|162.158.146.41]]

Unless I misunderstand this, there's also an aspect of this that's due to sign - because some studies of some outcomes expect negative results, and some expect positive, mixing even results that are overall statistically significant may cause the effects to cancel out.
[[User:Mattwigway|Mattwigway]] ([[User talk:Mattwigway|talk]]) 15:32, 28 March 2023 (UTC)
:I think that could be squared[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 17:03, 29 March 2023 (UTC)

meta-analyses are also referenced in [[1477: Meta-Analysis]] [[Special:Contributions/172.71.26.104|172.71.26.104]] 16:18, 28 March 2023 (UTC)Bumpf
: 1477 Is [[1477|Star Wars]]? [[User:Kev|Kev]] ([[User talk:Kev|talk]]) 18:39, 28 March 2023 (UTC)
:: sorry, I meant [[1447: Meta-Analysis]] :) [[Special:Contributions/172.71.166.248|172.71.166.248]] 13:04, 29 March 2023 (UTC)Bumpf
:Would this meta-analysis of all science satisfy Life Goal #28 (assuming it's rejected, as it probably should be)? [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 15:29, 29 March 2023 (UTC)

Talk:2755: Effect Size

2023-03-29T16:21:57Z

Tier666: Added closest paper...

Wow, it looks like I'm first![[Special:Contributions/162.158.146.40|162.158.146.40]] 16:40, 27 March 2023 (UTC)

;Wasn't something like this actually done?
Robert Sapolsky mentions an obscure paper that actually did something like this. They did a meta-analysis of the average reported error throughout various disciplines in order of the physical size of the objects being studied (e.g., from cells to organs to etc.), and found no correlation between them. The conclusion was that this was evidence that philosophical reductionism was flawed. [[User:Fephisto|Fephisto]] ([[User talk:Fephisto|talk]]) 22:45, 27 March 2023 (UTC)
: Did you manage to find it? [[Special:Contributions/172.70.57.203|172.70.57.203]] 08:49, 28 March 2023 (UTC)
:: [https://www.youtube.com/watch?v=_njf8jwEGRo Here] is the talk. He talks about the paper around 1:26:00. The figure is 1:26:50. [[User:Fephisto|Fephisto]] ([[User talk:Fephisto|talk]]) 13:18, 29 March 2023 (UTC)
:: Maybe [https://muse.jhu.edu/pub/1/article/401203/summary LINK] Titled "Reductionism and Variability in Data: A Meta-Analysis" Sapolsky, R.; Balt S.; Perspectives in Biology and Medicine 39(2), 1996[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 16:21, 29 March 2023 (UTC)

But does the meta-analysis include itself? Technically, it too is part of Science...
Artinum [[Special:Contributions/172.70.91.151|172.70.91.151]] 13:06, 28 March 2023 (UTC)
: It's SCIENCE all the way Down! [[User:Kev|Kev]] ([[User talk:Kev|talk]]) 18:39, 28 March 2023 (UTC)

scroll box location is ~25.5% down track: scroll box is 10px high, scrollbar is 290px high, 54px above box, 226px below = center of scrollbox is 59/231 = 25.541..% = ~209,815 pages of total studies. Adjusted to 210,000 to account for rounding errors. (Plus the scroll box might not even move a pixel for a number of pages).[[Special:Contributions/162.158.146.41|162.158.146.41]]

Did anyone notice the asterisk next to one of the graph elements? There's got to be a lot of those... Not all scientific studies (I would say very few) can be boiled down to a single numerical output.[[Special:Contributions/162.158.146.41|162.158.146.41]]

Unless I misunderstand this, there's also an aspect of this that's due to sign - because some studies of some outcomes expect negative results, and some expect positive, mixing even results that are overall statistically significant may cause the effects to cancel out.
[[User:Mattwigway|Mattwigway]] ([[User talk:Mattwigway|talk]]) 15:32, 28 March 2023 (UTC)

meta-analyses are also referenced in [[1477: Meta-Analysis]] [[Special:Contributions/172.71.26.104|172.71.26.104]] 16:18, 28 March 2023 (UTC)Bumpf
: 1477 Is [[1477|Star Wars]]? [[User:Kev|Kev]] ([[User talk:Kev|talk]]) 18:39, 28 March 2023 (UTC)
:: sorry, I meant [[1447: Meta-Analysis]] :) [[Special:Contributions/172.71.166.248|172.71.166.248]] 13:04, 29 March 2023 (UTC)Bumpf
:Would this meta-analysis of all science satisfy Life Goal #28 (assuming it's rejected, as it probably should be)? [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 15:29, 29 March 2023 (UTC)

Talk:2298: Coronavirus Genome

2020-04-25T23:21:38Z

Tier666:

Epigenetics is a pun, right? I think it's a pun but I don't know what and it's maddening. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 23:03, 24 April 2020 (UTC)
:...{{w|Epigenetics}} is a real thing—the study of how changes in things other than the genome itself can be passed down between generations. An example is conditioning a mouse to be scared of the smell of oranges/cherries/almonds by having them associate the scent of acetophenone with an electric shock, then testing whether its pups also have the same fear of that smell: they do, but this obviously can't be by the genome itself changing (no component of this has a lot of ionizing radiation{{Citation needed}}). Whatever causes this is the topic of actual epigenetics. --[[User:Volleo6144|Volleo6144]] ([[User talk:Volleo6144|talk]]) 00:12, 25 April 2020 (UTC)
::I know that, I added the link to the article. But afaik that has nothing to do with how the genome is formatted in Word, and I think it's a pun. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 00:31, 25 April 2020 (UTC)

since when does notepad have spellcheck? [[Special:Contributions/172.68.226.46|172.68.226.46]] 23:05, 24 April 2020 (UTC)
: Word does, so maybe she is using Word instead? Kind of contradictory. [[Special:Contributions/172.69.34.46|172.69.34.46]] 23:14, 24 April 2020 (UTC)

True Story: In the 1980s, as part of the Work Experience initiative at my school, I was assigned to one of my local council's offices (I'd applied for their computer department, but someone else got that). I don't ''think'' the word-processor I used at home (Psion Exchange) had spellcheck, but the one the office used (Lotus? Can't actually recall, but it, like most things, was DOS-based) definitely had, and it was very easy to edit in new words. Inspired by the chemistry lessons I'd recently had, and some 'reports' I was asked to write (keeping the kid busy, more like!) that dealt with chemical degradation of concrete under the action of salt and suchlike, I of course added "NaCl" then absolutely any other chemical formulae I could think of. "H2SO4" was an early one (partial subscript formatting wasn't relevent to the spill-chucker) but I eventually got round to CH4, C2H6, C3H8, etc, and then as many of the derived alcohols, alkenes, alkynes, etc that I could be bothered to type in. Which were a lot. By the end I was 'confident' that nobody would ever type ''any'' correct chemical formula into that machine (no network-shared resources!) and have to worry about false-positive typo alerts. Yeah, well, I was still at school and thought I knew ''everything''. [[Special:Contributions/162.158.159.70|162.158.159.70]] 23:37, 24 April 2020 (UTC)

Can confirm: virus genomes are looked at in notepad. I worked at one of the national laboratories for a summer, experimenting with ways to check for the length of a gene and strength of genetic expression in various circumstances in E. coli. We used notepad because even old computers can open very large files without difficulty, and all our scripts were in Perl, which can easily output to .rtf or .txt file formats. These files are huge, by the way. If you hold down on the scroll bar so it's zooming to the bottom, you could be waiting 20 minutes to reach the end depending on the number of kilobase pairs in your microbe. And epigenetics is not a pun. It's a real word. [[Special:Contributions/172.68.143.192|172.68.143.192]] 00:15, 25 April 2020 (UTC)

Concurrent to the work in the medical community, work is underway in various open source software communities to fix bugs and other issues with software (eg genome analysis tools) that is useful to the scientists combatting COVID-19. These include the Debian "biohackathon" (https://lwn.net/Articles/816280/) as well as support from Mozilla (https://lwn.net/Articles/816386/). Parallel to these efforts, the FSF (Free Software Foundation) has focused on the shortage of medical equipment: https://lwn.net/Articles/816392/ [[Special:Contributions/108.162.242.5|108.162.242.5]] 00:34, 25 April 2020 (UTC)

I’m suddenly inspired to write a DNA-edit-mode for Emacs (if it doesn’t have it already) which would allow for the virus spell check as described in this comic. [[Special:Contributions/172.69.63.153|172.69.63.153]] 04:16, 25 April 2020 (UTC)

- the dna-mode for emacs does exist. Google for it. It is not very useful for real work, though.

Derek Lowe has some insights about actual coronavirus mutations [https://blogs.sciencemag.org/pipeline/archives/2020/04/21/watching-for-mutations-in-the-coronavirus here], if you are interested.

Given coronavirus has an RNA genome, shouldn't all the 'T's be replaced by 'U's?
:
UNSIGNED COMMENT: PLEASE SIGN WITH "<nowiki>~~~~</nowiki>"

- It is standard practice no to use U's in public sequence database. It simplifies things.

The sequence in the transcript does not actually appear on the [https://www.ebi.ac.uk/ena/data/view/MT344963&display=text site] mentioned in the explanation. In fact, when I google for 'TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA' I only get this particular site.
:
UNSIGNED COMMENT: PLEASE SIGN WITH "<nowiki>~~~~</nowiki>"
:To find this (or any) sequence go to [[https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome|Nucleotide Blast]] and paste the query into the box. You will receive a list of a number of best matches (10, 50 or 100 in standard search), this should look like [[https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastSearch&VIEW_SEARCH=on&UNIQ_SEARCH_NAME=A_SearchOptions_1jST3G_gRB_dgzLunnk2EC_23turP_1HUFpP|this]]
Interestingly, this is an US-specific strain of the virus (top result currently is "Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/NC_0025/2020").[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 23:21, 25 April 2020 (UTC)
:Well, ''obviously'' it's a new variant, yet unknown to other clinical studies. Of RNA that has switched to looking like DNA, so this is a hot discovery! [[Special:Contributions/162.158.159.142|162.158.159.142]] 12:05, 25 April 2020 (UTC)

- The site shows several views into the public database entry that are easier to understand by humans than the raw sequence. Click the link at 'View: TEXT'. and scroll down. The relevant lines look like this:

aatccagtaa tggaaccaat ttatgatgaa ccgacgacga ctactagcgt gcctttgtaa 26220

gcacaagctg attagtacga acttatgtac tcattcgttt cggaagagac aggtacgtta 26280

As you can see, these are not meant to be search for and compared in "a notepad". For the same reason, google does not index DNA sequence database entries. There are specialised tools for that.

The sequnces were published this month, so they are available only in the most recent sequence database updates.
:
UNSIGNED COMMENT: PLEASE SIGN WITH "<nowiki>~~~~</nowiki>"

I have had trouble opening .txt files of even a hundred KB in Notepad! Sometimes it even crashes... It's one of the reasons I started using Notepad++. Notepad++ also happens to have a very extensible spellcheck, & language-specific formatting options. Since I often need to use Windows machines, it's one of my most frequently installed apps, after 7Zip.
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 18:03, 25 April 2020 (UTC)

The Grammar Checker concept only has a {{w|Colorless_green_ideas_sleep_furiously|limited analytical sophistication}}, though I don't doubt it'd still be enough to get a Nobel given the complexity of the task of deriving trivially feasible sequences from total codswallop. I also added the "next step" (probably much more than a single step), when I revised things, but that might actually be overstepping the explanation of the comic and removable. [[Special:Contributions/162.158.155.122|162.158.155.122]] 20:32, 25 April 2020 (UTC)

Talk:2296: Sourdough Starter

2020-04-22T09:48:25Z

Tier666:

Symbiosis is good for the species involved in that relationship, but it may still be harmful to other organisms. What Randall is suggesting is that humans are collateral damage. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 21:37, 20 April 2020 (UTC)

Is there controversy around covid-19 coming from cave bats rarely visited by humans, or would the bats be part of the convoluted lifecycle? [[Special:Contributions/162.158.74.211|162.158.74.211]] 22:02, 20 April 2020 (UTC)

Is this comic suggesting the yeast would allow the virus to survive without a human host, and when we later swap sourdough starters the virus could then find a new human host to infect? [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 01:05, 21 April 2020 (UTC)
:The virus and yeast can have working symbiosis without ever coming into physical contact. It's just that the lockdown probably ends before the virus will be actually eradicated, so large meetings just after end of lockdown is not good idea. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 22:19, 21 April 2020 (UTC)

That is not a theory in the caption. It has no evidence and makes no testable predictions, at least as far as I can tell. It is just a hypothesis. [[User:Nutster|Nutster]] ([[User talk:Nutster|talk]]) 01:56, 21 April 2020 (UTC)
:Maybe not a theory in the real world, but this isn't the real world. Perhaps in the world of this comic there is evidence and there were predictions that have been tested, making it a theory to Cueball. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 02:17, 21 April 2020 (UTC)
:With a bit of reading online, I've discovered that your definition of "theory" is but one of many different definitions of the word. In some contexts, theory is synonymous with hypothesis, according to Merriam-Webster. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 02:31, 21 April 2020 (UTC)
: Theory: This comic is the same category as "My hobby". Aka: It's a joke. [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 07:21, 21 April 2020 (UTC)
: "theory - noun - an idea used to account for a situation or justify a course of action" - that seems to describe how Randall used the word [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 14:03, 21 April 2020 (UTC)

In the UK at least, it's been too successful. You can't get flour in the shops most times. Apparently, most flour goes into big sacks for bakeries and the like. The mills haven't been able to gear up their production of small bags for domestic use. [[Special:Contributions/162.158.159.56|162.158.159.56]] 09:24, 21 April 2020 (UTC)

My pet theory, before Boris Johnson got a bit better and ''didn't'' relax measures, was that COVID had deliberately infected half the Cabinet in order to gain the authority to infect everyone else, like common Pod People tropes would have happen. (That didn't happen, but maybe it's just being more clever. Like causing the PPE supply chains to break under the strain.) [[Special:Contributions/162.158.34.210|162.158.34.210]] 10:46, 21 April 2020 (UTC)

Isn't "swapping starters" a Pokemon reference? You know, getting together and trading starter Pokemon until everyone has all 3. [[User:Daevin|Daevin]] ([[User talk:Daevin|talk]]) 14:53, 21 April 2020 (UTC)

I assumed this was a continuation of the previous comic: precise number + garbage = garbage; perfectly good flour + sourdough starter = garbage that tastes so bad not even microbes want to eat it.
: Bakers gonna bake, Haters gonna hate... [[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 09:48, 22 April 2020 (UTC)

Have to confess: The yeasts (and lactobacilli) got me - still waiting for the virus. [[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 09:48, 22 April 2020 (UTC)

Talk:2292: Thermometer

2020-04-13T15:01:42Z

Tier666:

First non-Covid post other than April fools?[[Special:Contributions/162.158.107.167|162.158.107.167]]
23:04, 10 April 2020 (UTC)
:Since a fever is a common symptom of Covid-19, I'd say this is as much about Covid-19 as all the previous comics on the topic. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 02:59, 11 April 2020 (UTC)
::I'd disagree. Fevers aren't inherently related to COVID-19, and while it's certainly easy to draw a connection based on current events, at no point is the connection made explicit. [[Special:Contributions/172.69.34.104|172.69.34.104]] 10:29, 11 April 2020 (UTC)
:::Seriously? Fever is associated with 88% of COVID-19 cases! I'd say that's inherently related, and I'm drawing a connection based on that fact. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 12:59, 11 April 2020 (UTC)
::::Fevers are associated with almost all infectious diseases. By that logic, this could be about the flu, mono, or a hundred other conditions. [[User:Shamino|Shamino]] ([[User talk:Shamino|talk]]) 17:24, 11 April 2020 (UTC)
:::::I, too, think calling this a Covid-19 comic is excessive. Sure, thermometers for measuring body temperature are sold out at my local drugstore, and pandemic likely inspired the comic, but if it had been published a year ago, we wouldn't infer any connection to a specific disease or global epidemic. - Ada in New Hampshire, USA [[Special:Contributions/172.69.6.22|172.69.6.22]] 07:56, 12 April 2020 (UTC)
::::::I would assume anything that can be linked, even loosely, is probably part of this chain. I have been assuming since the 6th one that Randel would aim for 19 of these just because. Though perhaps he will keep going till the hype is over. Either way, requiring that it directly mentions the topic it was inspired by would be way overkill. Mentioning things that likely inspired a comic is something we have done for a long time, and the virus seems like the most likely inspiration, especially when taking the full comic chain into account[[Special:Contributions/172.69.198.52|172.69.198.52]] 21:33, 12 April 2020 (UTC)
::The comic doesn't mention a fever. For all we know Cueball is trying to measure the outside air temperature, or how hot his coffee is. We can rule out the idea that he is trying to measure the temperature of some liquid helium only because he skipped past the kelvin scale. [[User:Jeremyp|Jeremyp]] ([[User talk:Jeremyp|talk]]) 18:39, 12 April 2020 (UTC)

A common practice in schools and the like prior to quarantine was temperature taking upon arrival. So it's like that this comic continues that to the home setting. [[Special:Contributions/162.158.78.112|162.158.78.112]] 23:19, 10 April 2020 (UTC)

A pessimist would guess that this means someone in Randall's household has a fever. [[Special:Contributions/108.162.219.52|108.162.219.52]] 23:26, 10 April 2020 (UTC)

> The Physician Ducks[[Special:Contributions/172.69.62.94|172.69.62.94]] 23:32, 10 April 2020 (UTC)

Personally I'd welcome a home thermometer marked off in Kelvin, avois all the "twice as cold" sort of confusion you can get with an arbitrary zero as used in Celsius and Fahrenheit. [[Special:Contributions/162.158.34.210|162.158.34.210]] 23:21, 10 April 2020 (UTC)

I might have enjoyed a "Degrees of Kevin Bacon" joke in this comic somewhere. :-) [[Special:Contributions/172.69.68.143|172.69.68.143]] 23:42, 10 April 2020 (UTC)

Double-plus-dissapointed we didn't get the Delisle measure referenced at all... [[Special:Contributions/162.158.34.202|162.158.34.202]] 01:17, 11 April 2020 (UTC) ...and now added. It would be better in any Trivia section, but we don't have one so hoping it's no more out of place in the explanation as Fahrenheit. [[Special:Contributions/162.158.34.202|162.158.34.202]] 02:02, 11 April 2020 (UTC) ...''aaaand'' someone removed it (as pure trivia, of course), fair enough. Anticipated. Anyone still interested in what I put just needs to check this IP, at about this timestamp, in Page History, though, so not going to argue the point. [[Special:Contributions/162.158.34.202|162.158.34.202]] 02:08, 11 April 2020 (UTC)

No temperature scale is defined using melting or boiling points of water anymore. Since 2019 Kelvin is defined via the Boltzmann constant, and all other temperature scales have been (re-)defined relative to the Kelvin scale for quite a while. --[[Special:Contributions/172.69.63.103|172.69.63.103]] 01:24, 11 April 2020 (UTC)

Randall forgot the Réaumur scale.[[Special:Contributions/162.158.123.97|162.158.123.97]] 03:00, 11 April 2020 (UTC)

I'm not sure why some people seem to look for any opportunity to take a dig at the US, but I removed the line in the explanation about US-based readers not being familiar with the Celsius temperature scale. I'm sure most Americans are familiar with it but prefer the Fahrenheit scale instead. I don't understand why anyone holds that against us. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 03:04, 11 April 2020 (UTC)
:Hey, let's assume good faith. Chances are, some rando just genuinely had no idea how that kind of stuff works here. [[Special:Contributions/172.69.34.104|172.69.34.104]] 10:22, 11 April 2020 (UTC)

Regarding USA Fahrenheit and non-USA Celsius preference, I was in Niagra Falls a few years back, listening to a Canadian station on the radio (ok, more than a few years ago...) and the DJ gave a weather report, saying “The current temperature is 25 degrees, that’s 77 on the understandable scale.” [[Special:Contributions/173.245.54.201|173.245.54.201]] 04:22, 11 April 2020 (UTC)

I guess if you wanted to use the Newton scale you'd need to have Newton's original "degrees of heat" measuring device. [[Special:Contributions/108.162.250.67|108.162.250.67]] 04:31, 11 April 2020 (UTC)

Nitpicking alert : the correct writing is "kelvin", not "Kelvin".

100°F is "really hot"? Maybe on a stripper... [[Special:Contributions/162.158.190.106|162.158.190.106]] 13:00, 11 April 2020 (UTC)

:Also nitpicking: "Kelvin" is correct, as it is a name like Fahrenheit (https://en.wikipedia.org/wiki/William_Thomson,_1st_Baron_Kelvin or https://en.wikipedia.org/wiki/River_Kelvin as you like...)[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 14:59, 13 April 2020 (UTC)

Randall, as a physicist, should know about the equipartition theorem. It states that all degrees of freedom will carry the same average amount of energy in thermal equilibrium, not only the translational kinetic ones (but also rotational, and potential energies). It is technically not false to exclude some of these, but an arbitrary choice. I guess he just wanted to include the terms “translational” and “kinetic” to make sure it sounds ridiculously over-specific (which works well). [[Special:Contributions/162.158.91.213|162.158.91.213]] 15:07, 11 April 2020 (UTC)
:No, it's still an important distinction. Many Thermometers can only 'measure' the average Translational energy and the rotational and elastic energy is just assumed to match that. (The only Thermometers that measure rotational and elastic Energy are the ones who only measure their own temperature... which is 99.5 of all consumer Thermometers.) And it probably does except in some very specific cases with ultra high speed pressure changes.

+Using the average Translational Energy would would sidestep all the problems with the different units of temperature and would also eliminate the necessity of using the Boltzmann constant, simplyfying a lot of physics. But nobody wants to make the transition since most everyday temperatures would be between 5 and 8zJ, with 5 being freezing, six being tolerable and seven a desert at noon. The Unit, Zeejays would sound cool though.[[Special:Contributions/162.158.92.70|162.158.92.70]] 09:30, 13 April 2020 (UTC)
:Alternatively, use molar mean disordered translational kinetic energy per mole, making the numbers nicer by a factor of Avogadro's number, and bringing the scale to 2-3kJ/mol. Or add in a factor of 1.5 as well to make the gas K.E. formula simpler. [[User:Sqek|Sqek]] ([[User talk:Sqek|talk]]) 10:27, 13 April 2020 (UTC)

Well, it has Fahrenheit after a fashion. Just substract 460 from Rankine. It's even easier than converting Kelvin to Celsius!
:I find it much quicker to subtract 0.01C° 27,315 times than to subtract 0.01F° 45,967 times, personally. I think you're quite barmy to suggest otherwise, Unsigned... :P [[Special:Contributions/162.158.34.222|162.158.34.222]] 16:17, 11 April 2020 (UTC)
::Now that I, the formerly Unsigned, think of it, I must agree with you - but for an entirely different reason. 273.15 in binary is a nice, round 100010001.001(00101) with 3 1's in the integer and 4+2n 1's for every 3+5n fractional digits, whereas 459.67 is much messier: 111001011.10110001111110... , with 6 1's in the integer alone. The more 1's there are in a number, the more operations you have to do for each addition or subtraction. So in binary, Kelvin-to-Celsius is much easier to convert than Rankine-to-Fahrenheit. Yet another point in favor of the glorious metric master system, da? [[User:Osato|Osato]] ([[User talk:Osato|talk]]) 19:57, 11 April 2020 (UTC)

I removed the weasel words, indicating that Fahrenheit is "generally appreciated" because 0 means very cold and 100 very hot. I adjusted it to "some claim" and adjusted the text to fit.

Make the scale in Celsius 0 to 200, and I think you would have a system much more relatable to Fahrenheit users.

I can imagine a worse scaling system! Base it on Cat-Scratch-Fever, Hot-Blooded, Yellow Snow, SpringTime in Alaska, Beds are Burning, Burning Down the House . (not in that order) [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 12:49, 13 April 2020 (UTC)

Talk:2292: Thermometer

2020-04-13T14:59:37Z

Tier666: Nitpicking with Nitpickers...

First non-Covid post other than April fools?[[Special:Contributions/162.158.107.167|162.158.107.167]]
23:04, 10 April 2020 (UTC)
:Since a fever is a common symptom of Covid-19, I'd say this is as much about Covid-19 as all the previous comics on the topic. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 02:59, 11 April 2020 (UTC)
::I'd disagree. Fevers aren't inherently related to COVID-19, and while it's certainly easy to draw a connection based on current events, at no point is the connection made explicit. [[Special:Contributions/172.69.34.104|172.69.34.104]] 10:29, 11 April 2020 (UTC)
:::Seriously? Fever is associated with 88% of COVID-19 cases! I'd say that's inherently related, and I'm drawing a connection based on that fact. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 12:59, 11 April 2020 (UTC)
::::Fevers are associated with almost all infectious diseases. By that logic, this could be about the flu, mono, or a hundred other conditions. [[User:Shamino|Shamino]] ([[User talk:Shamino|talk]]) 17:24, 11 April 2020 (UTC)
:::::I, too, think calling this a Covid-19 comic is excessive. Sure, thermometers for measuring body temperature are sold out at my local drugstore, and pandemic likely inspired the comic, but if it had been published a year ago, we wouldn't infer any connection to a specific disease or global epidemic. - Ada in New Hampshire, USA [[Special:Contributions/172.69.6.22|172.69.6.22]] 07:56, 12 April 2020 (UTC)
::::::I would assume anything that can be linked, even loosely, is probably part of this chain. I have been assuming since the 6th one that Randel would aim for 19 of these just because. Though perhaps he will keep going till the hype is over. Either way, requiring that it directly mentions the topic it was inspired by would be way overkill. Mentioning things that likely inspired a comic is something we have done for a long time, and the virus seems like the most likely inspiration, especially when taking the full comic chain into account[[Special:Contributions/172.69.198.52|172.69.198.52]] 21:33, 12 April 2020 (UTC)
::The comic doesn't mention a fever. For all we know Cueball is trying to measure the outside air temperature, or how hot his coffee is. We can rule out the idea that he is trying to measure the temperature of some liquid helium only because he skipped past the kelvin scale. [[User:Jeremyp|Jeremyp]] ([[User talk:Jeremyp|talk]]) 18:39, 12 April 2020 (UTC)

A common practice in schools and the like prior to quarantine was temperature taking upon arrival. So it's like that this comic continues that to the home setting. [[Special:Contributions/162.158.78.112|162.158.78.112]] 23:19, 10 April 2020 (UTC)

A pessimist would guess that this means someone in Randall's household has a fever. [[Special:Contributions/108.162.219.52|108.162.219.52]] 23:26, 10 April 2020 (UTC)

> The Physician Ducks[[Special:Contributions/172.69.62.94|172.69.62.94]] 23:32, 10 April 2020 (UTC)

Personally I'd welcome a home thermometer marked off in Kelvin, avois all the "twice as cold" sort of confusion you can get with an arbitrary zero as used in Celsius and Fahrenheit. [[Special:Contributions/162.158.34.210|162.158.34.210]] 23:21, 10 April 2020 (UTC)

I might have enjoyed a "Degrees of Kevin Bacon" joke in this comic somewhere. :-) [[Special:Contributions/172.69.68.143|172.69.68.143]] 23:42, 10 April 2020 (UTC)

Double-plus-dissapointed we didn't get the Delisle measure referenced at all... [[Special:Contributions/162.158.34.202|162.158.34.202]] 01:17, 11 April 2020 (UTC) ...and now added. It would be better in any Trivia section, but we don't have one so hoping it's no more out of place in the explanation as Fahrenheit. [[Special:Contributions/162.158.34.202|162.158.34.202]] 02:02, 11 April 2020 (UTC) ...''aaaand'' someone removed it (as pure trivia, of course), fair enough. Anticipated. Anyone still interested in what I put just needs to check this IP, at about this timestamp, in Page History, though, so not going to argue the point. [[Special:Contributions/162.158.34.202|162.158.34.202]] 02:08, 11 April 2020 (UTC)

No temperature scale is defined using melting or boiling points of water anymore. Since 2019 Kelvin is defined via the Boltzmann constant, and all other temperature scales have been (re-)defined relative to the Kelvin scale for quite a while. --[[Special:Contributions/172.69.63.103|172.69.63.103]] 01:24, 11 April 2020 (UTC)

Randall forgot the Réaumur scale.[[Special:Contributions/162.158.123.97|162.158.123.97]] 03:00, 11 April 2020 (UTC)

I'm not sure why some people seem to look for any opportunity to take a dig at the US, but I removed the line in the explanation about US-based readers not being familiar with the Celsius temperature scale. I'm sure most Americans are familiar with it but prefer the Fahrenheit scale instead. I don't understand why anyone holds that against us. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 03:04, 11 April 2020 (UTC)
:Hey, let's assume good faith. Chances are, some rando just genuinely had no idea how that kind of stuff works here. [[Special:Contributions/172.69.34.104|172.69.34.104]] 10:22, 11 April 2020 (UTC)

Regarding USA Fahrenheit and non-USA Celsius preference, I was in Niagra Falls a few years back, listening to a Canadian station on the radio (ok, more than a few years ago...) and the DJ gave a weather report, saying “The current temperature is 25 degrees, that’s 77 on the understandable scale.” [[Special:Contributions/173.245.54.201|173.245.54.201]] 04:22, 11 April 2020 (UTC)

I guess if you wanted to use the Newton scale you'd need to have Newton's original "degrees of heat" measuring device. [[Special:Contributions/108.162.250.67|108.162.250.67]] 04:31, 11 April 2020 (UTC)

Nitpicking alert : the correct writing is "kelvin", not "Kelvin".

100°F is "really hot"? Maybe on a stripper... [[Special:Contributions/162.158.190.106|162.158.190.106]] 13:00, 11 April 2020 (UTC)

Also nitpicking: "Kelvin" is correct, as it is a name like Fahrenheit (https://en.wikipedia.org/wiki/William_Thomson,_1st_Baron_Kelvin or https://en.wikipedia.org/wiki/River_Kelvin as you like...)[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 14:59, 13 April 2020 (UTC)

Randall, as a physicist, should know about the equipartition theorem. It states that all degrees of freedom will carry the same average amount of energy in thermal equilibrium, not only the translational kinetic ones (but also rotational, and potential energies). It is technically not false to exclude some of these, but an arbitrary choice. I guess he just wanted to include the terms “translational” and “kinetic” to make sure it sounds ridiculously over-specific (which works well). [[Special:Contributions/162.158.91.213|162.158.91.213]] 15:07, 11 April 2020 (UTC)
:No, it's still an important distinction. Many Thermometers can only 'measure' the average Translational energy and the rotational and elastic energy is just assumed to match that. (The only Thermometers that measure rotational and elastic Energy are the ones who only measure their own temperature... which is 99.5 of all consumer Thermometers.) And it probably does except in some very specific cases with ultra high speed pressure changes.

+Using the average Translational Energy would would sidestep all the problems with the different units of temperature and would also eliminate the necessity of using the Boltzmann constant, simplyfying a lot of physics. But nobody wants to make the transition since most everyday temperatures would be between 5 and 8zJ, with 5 being freezing, six being tolerable and seven a desert at noon. The Unit, Zeejays would sound cool though.[[Special:Contributions/162.158.92.70|162.158.92.70]] 09:30, 13 April 2020 (UTC)
:Alternatively, use molar mean disordered translational kinetic energy per mole, making the numbers nicer by a factor of Avogadro's number, and bringing the scale to 2-3kJ/mol. Or add in a factor of 1.5 as well to make the gas K.E. formula simpler. [[User:Sqek|Sqek]] ([[User talk:Sqek|talk]]) 10:27, 13 April 2020 (UTC)

Well, it has Fahrenheit after a fashion. Just substract 460 from Rankine. It's even easier than converting Kelvin to Celsius!
:I find it much quicker to subtract 0.01C° 27,315 times than to subtract 0.01F° 45,967 times, personally. I think you're quite barmy to suggest otherwise, Unsigned... :P [[Special:Contributions/162.158.34.222|162.158.34.222]] 16:17, 11 April 2020 (UTC)
::Now that I, the formerly Unsigned, think of it, I must agree with you - but for an entirely different reason. 273.15 in binary is a nice, round 100010001.001(00101) with 3 1's in the integer and 4+2n 1's for every 3+5n fractional digits, whereas 459.67 is much messier: 111001011.10110001111110... , with 6 1's in the integer alone. The more 1's there are in a number, the more operations you have to do for each addition or subtraction. So in binary, Kelvin-to-Celsius is much easier to convert than Rankine-to-Fahrenheit. Yet another point in favor of the glorious metric master system, da? [[User:Osato|Osato]] ([[User talk:Osato|talk]]) 19:57, 11 April 2020 (UTC)

I removed the weasel words, indicating that Fahrenheit is "generally appreciated" because 0 means very cold and 100 very hot. I adjusted it to "some claim" and adjusted the text to fit.

Make the scale in Celsius 0 to 200, and I think you would have a system much more relatable to Fahrenheit users.

I can imagine a worse scaling system! Base it on Cat-Scratch-Fever, Hot-Blooded, Yellow Snow, SpringTime in Alaska, Beds are Burning, Burning Down the House . (not in that order) [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 12:49, 13 April 2020 (UTC)

2251: Alignment Chart Alignment Chart

2020-01-07T23:56:28Z

Tier666: Added a reference to the use of the soil erosion chart in what-if 83 / Star sand...

{{comic
| number = 2251
| date = January 6, 2020
| title = Alignment Chart Alignment Chart
| image = alignment_chart_alignment_chart.png
| titletext = I would describe my personal alignment as "lawful heterozygous silty liquid."
}}

==Explanation==
{{incomplete|Created by a [[User:DgbrtBOT|TRUE NEUTRAL BOT template]]. Needs explanations of each alignment chart, and probably some editing for clarity.}}

"Alignment" and "alignment charts" come from the the tabletop game ''{{w|Dungeons & Dragons}}''. Every character has an {{w|Alignment (Dungeons & Dragons)|alignment}}, which very roughly identifies their tendencies. The most widely used alignment system was introduced in the ''{{w|Dungeons & Dragons Basic Set}}'' in 1977 and has been reused in many (but not all) subsequent editions of the game. This system uses two perpendicular axes, each divided into three levels (for a total of nine categories). The two axes are:
* Lawful/neutral/chaotic: this axis says whether a character is strongly devoted to, indifferent about, or categorically opposed to following established rules.
* Good/neutral/evil: this axis says whether a character is generally inclined to commit good deeds or evil deeds.

In this system, the "lawful" attribute is independent from the "good" attribute. Lawful alignment means that a character is committed to a set of rules, which can refer to actual established laws, or to something like a rigid personal code, a set of traditions, or a chain of command, while a chaotic alignment means that a character has no interest in those, and may actively oppose them. The good vs evil scale is generally based on a character's concern for the lives and well-being of others, a good character will actively seek to help others and prevent harm, while an evil character will have no such concern and may actively harm others. Being 'good' is assumed to be independent of being 'lawful'. For example, a character who actively breaks laws to help those who are unjustly imprisoned or oppressed would be be considered to be "chaotic good". In both cases, a neutral alignment can indicate a character's indifference to a concept, or that their commitment is conditional, or that they consciously seek to balance both sides. A character with the "neutral neutral" alignment is called a true neutral.

An alignment chart is a grid that divides the alignments, usually for the purpose of putting descriptions or particular characters on it. Alignment charts are frequently used as a [https://knowyourmeme.com/memes/mcdonalds-alignment-chart meme template], where humorous or absurdist things are organized into different alignments. In addition to the "classic" Dungeons and Dragons alignment chart, there are a number of variant alignment charts in use as meme templates. Many keep the three-by-three grid structure but replace the lawful-neutral-chaotic and good-neutral-evil axes with descriptions.

This comic claims to be a meta-alignment chart, where nine "alignment charts" are themselves sorted into the nine Dungeons and Dragons alignments, following the use of alignment charts to humorously classify abstract concepts. However, these "alignment charts" are mostly diagrams used in academic classifications, which are being treated as if they were blank meme templates. There are two levels of absurdity here: first, the idea of using these diagrams to classify things they were never intended for, and second, the conflation of chaos as a physics concept and an assigned moral weights as it applies to each of these classification systems.

The title text describes Randall's alignment as "lawful heterozygous silty liquid" which references the true neutral, neutral good, lawful good, and lawful neutral charts in the Alignment Chart Alignment Chart. Lawful is the left side of an alignment chart, heterozygous is the top right or bottom left of a Punnet Square, silty is the bottom right of a soil chart, and liquid is the top right of a phase diagram. As such, the title test describes Randall's alignment as between Lawful Neutral and Neutral Good on this chart.

{| class="wikitable"
!Alignment
!Chart
!Explanation
|-
|Lawful Good
|{{w|Soil texture|Soil chart}}
|This chart shows the USDA classification of soil types by their relative proportions of sand, clay and silt. The chart is a ternary diagram (very common in geology), so soils with more clay plot towards the upper corner, soils with more sand to the bottom left, and soils with more silt to the bottom right. This chart has been used humorously as an alignment chart ([https://www.reddit.com/r/PrequelMemes/comments/8wakd4/anakin_soil_reference_chart/ for example]) and may have been the inspiration for Randall to use scientific diagrams as alignment charts. In addition to being Lawful Good, this grid cell is also the upper left cell of the chart and will be read first, making it a good place to put this chart as a "jumping off point". [https://what-if.xkcd.com/83/ What If 83 "Star Sand"] cites Randall as "...very satisfied with this chart, it's like the erosion geology edition of the electromagnetic spectrum chart..."
|-
|Neutral Good
|{{w|Punnett square}}
| Punnet squares are a visual method of determining what traits an organism might have based on the traits of the organism's parents. It relies on the principle that a trait is either dominant (indicated with capital letters) or recessive (indicated with lowercase letters). The exact combination of dominant or recessive genes that a child organism receives from their parents determines their traits. Heterozygous and homozygous refers to the pairs of alleles in an organism’s genotype, indicating mixed or same alleles, respectively. Randall later uses "heterozygous" in the title text. Note that it is possible for a phenotype to be expressed the same between some heterozygotes and homozygotes, e.g., persons with genotypes heterozygous "Aa" and homozygous "AA" will both express blood type A.
Therefore, the Punnett Square is a good chart because it is both a simple and true geometric predictor of inheritance, but it tends to be neutral because of complicating factors such as polygenic inheritance; these and other factors will cause genotypic frequency to deviate from expected 1:2:1 patterns.
|
|-
|Chaotic Good
|{{w|IPA vowel chart with audio|IPA vowel chart }}
|This chart shows the relationship between different vowels according to the {{w|International Phonetic Alphabet}}. The position of the vowel on the chart serves roughly as an indicator of the position of the tongue in the mouth of the speaker. As different vowel sounds are created by changes in different parts of the mouth, including lip roundness which is expressed in the chart implicitly as an invisible third dimension, vowel identification is qualitative and often up to interpretation, and vowel expression can change dramatically from region to region or even person to person within the same language, the categories described by the chart might be considered chaotic.
|-
|Lawful Neutral
|{{w|Phase diagram}}
|A phase diagram shows the equilibrium phases of matter present for a particular temperature, pressure, and composition. The diagram included is a unary phase diagram of a typical material that has a solid, liquid, and gas phase depending on the temperature and pressure for a fixed composition. Phase diagrams are useful for understanding how a material may change as its conditions change. For example, the air pressure of Mars is such that there is no temperature at which liquid water can exist in equilibrium on its surface. Water exists as ice until the temperature reaches a point where it sublimates directly into steam.

This phase diagram does not specify what material is depicted, but it is certainly ''not'' the phase diagram of water. On this diagram, compressing the liquid phase will transform the material into a solid, which is how most materials behave, but the solid/liquid phase line for water tilts the opposite direction. This is why water ice floats on liquid water, for example.

Phase diagrams follow the laws of thermodynamics and concern themselves with the order in which things ''should'' be, so they are inherently lawful.
|-
|True Neutral
|Alignment chart
|All alignment charts are neutral unless humans contaminate them.
|-
|Chaotic Neutral
|CIE chromaticity diagram
|The {{w|chromaticity}} diagram is a chart of colors. Visible colors form a shape like a triangle with two bulging sides in the diagram. The curved line within the diagram shows the chromaticities of {{w|Black body|black bodies}} over a range of color temperatures. The chromaticity diagram shows colors independent of luminance.
The chart is not a simple geometric shape, so it is labeled as chaotic. Points on the diagram can be specified as combinations of three underlying iluminants (the colors of which may not all be visible). It can also be described in polar form with angle and radial distance from some central point, where the maximum radial distance depends on the angle.
|
|-
|Lawful Evil
|Political compass
|[https://www.politicalcompass.org/ Political Compass] separates ideas about governance into economic and social political thought. For example, Gandhi and Stalin supposedly both had similar economic perspectives (collectivist) but radically different social perspectives (libertarian vs authoritarian).

As politics is how laws are made, this is inherently lawful. Attempting to represent all politics in terms of two very general axes is a gross oversimplification, which is likely why it is listed as evil.

Like the USDA soil chart, the political compass has actually been [https://knowyourmeme.com/memes/political-compass used as an alignment chart], largely to mock the original political compass chart.
|-
|Neutral Evil
|{{w|QAPF diagram|QAPF rock diagram}}
|This diagram is used to classify coarse-grained felsic (low magnesium and iron) igneous rocks by the relative volumes of the minerals quartz, alkali feldspars, plagioclase feldspars, and feldspathoids in the rock. It consists of two ternary diagrams - quartz and feldspathoid minerals cannot coexist (they will react to form feldspars) so only three of these components will be in any given rock. Rocks in the upper triangle of the diagram contain quartz, with rocks with more quartz plotting closer to the top, while rocks in the lower triangle contain feldspathoids, with rocks with more feldspathoids plotting lower. Rocks closer to the left corner of the diagram contain more alkali feldspar and rocks closer to the right corner contain more plagioclase feldspar. The field on the diagram for granite is labeled in the comic, but each area outlined on the diagram has it's own rock name (monzonite, syenite, granodiorite, etc.). All the rocks that the QAPF diagram is used to classify look superficially like granite, but their chemistry, mineralogy, and origin differ.
The QAPF diagram and the names of the more obscure rock types on it can be somewhat arcane, which may be why it is considered evil here.
|-
|Chaotic Evil
|Omnispace classifier
|The other eight diagrams shown in this comic, squished together into one, with the shapes of the diagrams corresponding to those of the originals. The diagram is labeled chaotic, since it does not have a simple geometrical shape. Probably self-referential humour, in that the diagram created for this comic is considered to be chaotically evil.
|}

==Transcript==
{{incomplete transcript|Do NOT delete this tag too soon.}}

{{comic discussion}}



[[Category:Charts]]
[[Category:Biology]]
[[Category:Chemistry]]
[[Category:Physics]]
[[Category:Geology]]
[[Category:Language]]
[[Category:Fiction]]
[[Category:Politics]]

Talk:2251: Alignment Chart Alignment Chart

2020-01-06T17:57:08Z

Tier666:

OK, hope someone will now explain it after I created this page. I'm lost on this one ;-) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 10:49, 6 January 2020 (UTC)

Arrgh, edit conflict! [[User:Kev|Kev]] ([[User talk:Kev|talk]]) 11:55, 6 January 2020 (UTC)

I think the Omnispace Classifier is meant to be a horrific Frankenstein amalgamation of the other 8 kinds of chart. Theoretically it can "classify anything" since it can classify anything the other 8 can, but practically it would obviously be totally useless, or at least a lot less useful than just using the specific chart that works for the situation. [[User:Pureawes0me|Pureawes0me]] ([[User talk:Pureawes0me|talk]]) 12:09, 6 January 2020 (UTC)

I vaguely remember Randall to refer to the clay-sand diagram (or whatever it is called) as his all time favorite diagram on what-if somewhere. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 12:35, 6 January 2020 (UTC)
:You vaguely remember "Starsand" from https://what-if.xkcd.com/83/ with the quote "Fortunately, there's a wonderful chart by the US Geologic Survey that answers all these questions and more. For some reason, I find this chart very satisfying—it's like the erosion geology edition of the electromagnetic spectrum chart." directly applicabe to this chart[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 17:57, 6 January 2020 (UTC)

I fear any attempt to "explain" the CIE chromaticity diagram will devolve into arguments about why Randall chose it. I have found that folks outside the world of optics or neurooptical studies have a hard time understanding why the raw colors available in single wavelengths comprise that short curvy line inside the full colorspace. The way our brain processes the relative signal strengths from the different types of retinal cones is quite amazing. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 12:57, 6 January 2020 (UTC)

I'm only familiar with 4th and 5th edition, but should the "Good/neutral/evil:" axis eplanation be changed to "selfless deeds or selfish deeds"? Good and evil are highly subjective ("One person's 'freedom fighter' is another person's 'terrorist'.") but at least in 5e the axis is explained as risking/sacrificing yourself for the benefit of others (Good) vs. sacrificing others for your own benefit (Evil). Also, the explanation of the CN character may benefit from dividing which parts of the explanation are "chatoic" vs "neutral". Finally the "lacking rhyme or reason" part of chaotic is highly debated within D&D circles. There are certainly people who play that way, but there are also others who feel that chaotic characters have just as much motivation and goals as a lawful or neutral character just that part of their motivation is to act contrarily to Tradition/Authority. [[Special:Contributions/162.158.186.54|162.158.186.54]] 14:37, 6 January 2020 (UTC)

I am not sure the phase diagram is for Water - that has nine solid phases. Surely it is merely a simple example.
[[User:Arachrah|Arachrah]] ([[User talk:Arachrah|talk]]) 16:52, 6 January 2020 (UTC)
: It seems from this page that even nerds tend to interpret the alignment system by the ‘common sense’ meaning of the names instead of the detailed explanation. I once simply went through the Wikipedia article, which cited the second edition IIRC: ‘lawful’ means sticking to ''some'' code of conduct, whereas ‘chaotic’ is a pure opportunist or behaves randomly. ‘Good’ and ‘evil’ indeed mean selfless vs selfish deeds, but afaik in one of the official explanations ‘evil’ meant exercising authority over others—so all managers would be ‘evil’ automatically. [[User:Aasasd|Aasasd]] ([[User talk:Aasasd|talk]]) 16:42, 6 January 2020 (UTC)

As an interesting note, this comic's alt-text also ends with a period inside of a quote. This was discussed at length in the previous comic. [[User:Agrasin|Agrasin]] ([[User talk:Agrasin|talk]]) 16:52, 6 January 2020 (UTC)

Talk:2159: Comments

2019-06-05T17:49:00Z

Tier666: Deleted all Buttegieg Comments. This will take a while...

Talk:2159: Comments

2019-06-05T17:47:38Z

Tier666:

It seems the news article in this comic is doing exactly what it says is causing outraged user comments - presenting a narrative that is based on a few random comments from outraged readers! [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 17:21, 5 June 2019 (UTC)
:...and none of the comments for the article appear to be from outraged users, contradicting the arbitrary narrative of the article that is based on what must be assumed are random comments! [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 17:28, 5 June 2019 (UTC)
Sources:
There is https://www.npr.org/sections/publiceditor/2016/08/17/489516952/npr-website-to-get-rid-of-comments?t=1559755447034 to tell you that NPR moves to Twitter and Facebook because they found that 491,000 comments came from only 19,400 commenters[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 17:31, 5 June 2019 (UTC)

Have you guys heard about Pete Buttigieg? He's a really interesting, trustworthy presidential candidate. [[Special:Contributions/172.68.141.52|172.68.141.52]] 17:46, 5 June 2019 (UTC)

I'm definitely a Buttigieg supporter! Did you hear how he got a standing ovation by the audience of Fox News. [[Special:Contributions/172.68.141.52|172.68.141.52]] 17:46, 5 June 2019 (UTC)

BOOT EDGE EDGE [[Special:Contributions/172.68.141.52|172.68.141.52]] 17:46, 5 June 2019 (UTC)

If elected, Pete Buttigieg would be the first gay president, a major step forward for LGBTQ+ rights in the United States! [[Special:Contributions/172.68.141.52|172.68.141.52]] 17:46, 5 June 2019 (UTC)

This joke would probably be funnier if Pete Buttigieg had any relation whatsoever to the comic subject. Anyway, now he's on your radar. [[Special:Contributions/172.68.141.52|172.68.141.52]] 17:46, 5 June 2019 (UTC)

This message is sponsored by Pete Buttigieg for America. [[Special:Contributions/172.68.141.52|172.68.141.52]] 17:46, 5 June 2019 (UTC)

No, it's not. [[Special:Contributions/172.68.141.52|172.68.141.52]] 17:46, 5 June 2019 (UTC)

Talk:2159: Comments

2019-06-05T17:31:42Z

Tier666:

Talk:1490: Atoms

2015-02-23T15:23:11Z

Tier666:

I believe that the "Too Much Zinc?" - is an answer to what might be wrong with him, not a retort to Megan's tone. In fact, zinc is linked to eyesight, see for instance https://www.nei.nih.gov/news/pressreleases/101201 and other sources, and this "zinc overdose" might be believed by white beret guy to relate to his "super-human" eyesight? [[Special:Contributions/141.101.80.53|141.101.80.53]]

"My dad FORM the dog"? Typo in the actual comic or just the wiki?
[[Special:Contributions/199.27.128.240|199.27.128.240]] 05:47, 23 February 2015 (UTC)Anonymous
: The actual comment, the wiki just grabs what the website has listed.--[[Special:Contributions/108.162.216.24|108.162.216.24]] 05:56, 23 February 2015 (UTC)
plutonium = radiation exposure, or pacemaker?
: Radiation exposure wouldn't give you plutonium, maybe the byproducts of its fission. I'm thinking that, whatever it is, it mutated Beret Guy in the womb, hence why he has this strange superpower.--[[User:Druid816|Druid816]] ([[User talk:Druid816|talk]]) 06:52, 23 February 2015 (UTC)
: Referencing Pink Floyd's 1970 album 'Atom Heart Mother' I think.--[[Special:Contributions/108.162.225.122|108.162.225.122]] 07:25, 23 February 2015 (UTC)
this guy sees by which elements are contained, not by which visible light?
--[[Special:Contributions/199.27.128.172|199.27.128.172]] 06:14, 23 February 2015 (UTC)

Are the elements actually representing their atomic symbols? Be, O, S, Z? Not sure what the metal-in-the-face comment is about.

--[[Special:Contributions/108.162.250.156|108.162.250.156]] 07:47, 23 February 2015 (UTC)

: A deliberate BeOS reference? [[Special:Contributions/141.101.99.4|141.101.99.4]] 14:12, 23 February 2015 (UTC)

: Metal in the face might be a comment on braces, and how uncomfortable people are about having noticable ones. --
[[Special:Contributions/141.101.104.41|141.101.104.41]] 08:37, 23 February 2015 (UTC)
: (Dental) fillings are explicitly mentioned as a possible source of metal. --[[Special:Contributions/188.114.102.75|188.114.102.75]] 09:26, 23 February 2015 (UTC)
Perhaps the plutonium is coming from his mother smoking? [[Special:Contributions/141.101.99.102|141.101.99.102]] 08:51, 23 February 2015 (UTC)

http://en.wikipedia.org/wiki/Unethical_human_experimentation_in_the_United_States#Plutonium_experiments [[User:Andries|Andries]] ([[User talk:Andries|talk]]) 09:02, 23 February 2015 (UTC)

I read it as both his mother and him beeing a robot or cyborg, which she never told him. [[Special:Contributions/141.101.75.77|141.101.75.77]] 09:30, 23 February 2015 (UTC)

: Yes, I rather thought it might be a Terminator 2 reference (based on the scene in which the T-1000 replaces John Connor's mother.) [[Special:Contributions/141.101.99.4|141.101.99.4]] 14:12, 23 February 2015 (UTC)

-- did the radiation give him those superpowers? [[Special:Contributions/108.162.222.204|108.162.222.204]] 11:05, 23 February 2015 (UTC)

He can't distinguish Dad and Dog, so he wasn't a genious back then. So what if the Plutonium wasn't a super complex mysterium, just one of the most important things for an infant, her breasts (in this case maby big ons).
[[Special:Contributions/141.101.92.108|141.101.92.108]] 11:44, 23 February 2015 (UTC) Pietro

I agree with 141.101.80.53. Beret Guy is answering Megan's question about what is wrong with him, not being arrogant. Arrogant would be out of character for Beret Guy, but giving an unusual answer to a rhetorical question would be true to character. [[User:Mwburden|mwburden]] ([[User talk:Mwburden|talk]]) 12:42, 23 February 2015 (UTC)

Perhaps too oddball a theory, but maybe his mom was actually a spacecraft powered by plutonium (e.g. [[Wikipedia:Galileo (spacecraft)#Electrical_power | Galileo(spacecraft)]]), making his father a planet and the dog a moon.
[[Special:Contributions/173.245.56.182|173.245.56.182]] 12:43, 23 February 2015 (UTC)
:Wouldn't the dog need to be a dwarf planet? :) [[Special:Contributions/108.162.250.156|108.162.250.156]] 12:54, 23 February 2015 (UTC)

When I read the alt text the first time around, I read it as platinum and figured Randall meant an IUD... perhaps that was a typo on his part as well (much like the "form" typo mentioned above)? Can't figured out another reasonable plutonium explanation. --[[User:Canned Soul|Canned Soul]] ([[User talk:Canned Soul|talk]]) 14:28, 23 February 2015 (UTC)

I like the plutonium experiments reverence, but are strongly against the suggestion in the explanation that Pu is not found in nature: http://en.wikipedia.org/wiki/Plutonium#Occurrence Do NOT diss Oklo! Oklo is badass! [[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 15:23, 23 February 2015 (UTC)

Talk:1426: Reduce Your Payments

2014-09-26T08:15:52Z

Tier666:

It's a chemical reduction. Here's the wiki link: http://en.wikipedia.org/wiki/Reducing_agent[[Special:Contributions/199.27.133.109|199.27.133.109]] 04:25, 26 September 2014 (UTC)

This needs more help by a professional chemist... And I need to go to work... So if anyone continues clarification work - thanks, else I'll do a little more after work/afterwards[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 05:21, 26 September 2014 (UTC)

I tried to clear up some things, but I am not a chemestry expert either.. --[[User:Flai|Flai]] ([[User talk:Flai|talk]]) 06:31, 26 September 2014 (UTC)

Hints (just looked into lit a little bit): NaBH4 would not really reduce the paper (make it vanish by reducing the cellulose to something like http://en.wikipedia.org/wiki/Sorbitol ) but may reduce (and so "vanishing") the ink: http://www.jeb.co.in/journal_issues/200911_nov09/paper_05.pdf http://www.deepdyve.com/lp/de-gruyter/degradation-of-cellulose-by-sodium-borohydride-b1EI17tyhs --> You can use a little bit of NaBH4 to make whiter paper[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 08:15, 26 September 2014 (UTC)

1426: Reduce Your Payments

2014-09-26T05:23:48Z

Tier666:

{{comic
| number = 1426
| date = September 26, 2014
| title = Reduce Your Payments
| image = reduce_your_payments.png
| titletext = I tried oxidizing them, but your bank uses some really weird paper and it wouldn't light.
}}

==Explanation==
In this comic [[Black Hat]] walks into a room were Cueball is sitting in an armchair. Blackhat says to Cueball that he can reduce his mortgage bills, while holding a docket of paper presumable Cueball's bill.
Black Hat uses the same formulation many internet advertisements use: "Discover this (strange/new/amazing...) trick to (lose weight/reduce your mortgage bills/meet amazing women)" to gather clicks.
Cueball wants to know how and Blackhat responses by mentioning {{w|http://en.wikipedia.org/wiki/Sodium_borohydride|NaBH4}}. Cueball then says I hate you.
Now to reduce mortgage payments is something high on many peoples minds but as with Blackhat's personality his method is rather unorthodox. Sodium Borhydride is a strong reducing agent. A reducing agent is a chemical that takes electrons from another chemical (in inorganic chemistry). When a chemical is reduced another one has to become oxidized.
The title text inferres that Blackhat has attempt to oxidise the paper mortgage bill in the chemical sense by burning it (reacting it with atmospheric oxygen) but the paper would not light.

==Transcript==
[Cueball siting on sofa Blackhat walks into frame from behind]

Blackhat: I discovered this weird trick for reducing your mortgage payments!

Cueball: What?

Blackhat: Sodium Borohydride.

Cueball: ...I hate you.

I tried to oxidize them, but your bank uses some really weird paper and it wouldn't light.

{{comic discussion}}

Talk:1426: Reduce Your Payments

2014-09-26T05:21:01Z

Tier666:

1426: Reduce Your Payments

2014-09-26T05:17:30Z

Tier666:

{{comic
| number = 1426
| date = September 26, 2014
| title = Reduce Your Payments
| image = reduce_your_payments.png
| titletext = I tried oxidizing them, but your bank uses some really weird paper and it wouldn't light.
}}

==Explanation==
In this comic [[Black Hat]] walks into a room were Cueball is sitting in an armchair. Blackhat says to Cueball that he can reduce his mortgage bills, while holding a docket of paper presumable Cueball's bill.
Black Hat uses the same formulation many internet advertisements use: "Discover this (strange/new/amazing...) trick to (lose weight/reduce your mortgage bills/meet amazing women)" to gather clicks.
Cueball wants to know how and Blackhat responses by mentioning Sodium Borohydride NaBH4. Cueball then says I hate you.
Now to reduce mortgage payments is something high on many peoples minds but as with Blackhat's personality his method is rather unorthodox. Sodium Borhydride is a strong reducing agent. A reducing agent is a chemical that takes electrons from another chemical (in inorganic chemistry). When a chemical is reduced another one has to become oxidized.
The title text inferres that Blackhat has attempt to oxidise the paper mortgage bill in the chemical sense by burning it (reacting it with atmospheric oxygen) but the paper would not light.

==Transcript==
[Cueball siting on sofa Blackhat walks into frame from behind]

Blackhat: I discovered this weird trick for reducing your mortgage payments!

Cueball: What?

Blackhat: Sodium Borohydride.

Cueball: ...I hate you.

I tried to oxidize them, but your bank uses some really weird paper and it wouldn't light.

{{comic discussion}}

1426: Reduce Your Payments

2014-09-26T05:09:27Z

Tier666:

{{comic
| number = 1426
| date = September 26, 2014
| title = Reduce Your Payments
| image = reduce_your_payments.png
| titletext = I tried oxidizing them, but your bank uses some really weird paper and it wouldn't light.
}}

==Explanation==
In this comic [[Black Hat]] walks into a room were Cueball is sitting in an armchair. Blackhat says to Cueball that he can reduce his mortgage bills, while holding a docket of paper presumable Cueball's bill.
Black Hat uses the same formulation many internet advertisements use: "Discover this (strange/new/amazing...) trick to (lose weight/reduce your mortgage bills/meet amazing women)" to gather clicks.
Cueball wants to know how and Blackhat responses by mentioning Sodium Borohydride NaBH4. Cueball then says I hate you.
Now to reduce mortgage payments is something high on many peoples minds but as with Blackhat's personality his method is rather unorthodox. Sodium Borhydride is a strong reducing agent. A reducing agent is a chemical that takes electrons from another chemical (in inorganic chemistry). When a chemical is reduced it is becomes oxidized. It is then inferred that Blackhat has attempt to reduce the paper mortgage bill in the chemical sense but as it is fairly obvious this has failed. The text title reinforces this.

==Transcript==
[Cueball siting on sofa Blackhat walks into frame from behind]

Blackhat: I discovered this weird trick for reducing your mortgage payments!

Cueball: What?

Blackhat: Sodium Borohydride.

Cueball: ...I hate you.

I tried to oxidize them, but your bank uses some really weird paper and it would light.

{{comic discussion}}

Talk:1422: My Phone is Dying

2014-09-17T16:27:31Z

Tier666:

The dying of Beret's phone is similar to the dying of the sun.

The Sun does not have enough mass to explode as a supernova. Instead it will exit the main sequence in approximately 5.4 billion years and start to turn into a red giant. It is calculated that the Sun will become sufficiently large to engulf the current orbits of the solar system's inner planets, possibly including Earth. (via http://en.wikipedia.org/wiki/Sun) [[User:Oicebot|Oicebot]] ([[User talk:Oicebot|talk]]) 04:43, 17 September 2014 (UTC)

I thought, this might be a TARDIS reference. --[[Special:Contributions/141.101.93.210|141.101.93.210]] 07:03, 17 September 2014 (UTC)

----

The main page of this explanation mentions White Hat... he's not even in this comic, only Beret Guy and Cueball. Not sure about editing policies/things here yet, so figured I'd mention this on the talk page :P Hope this helps! [[User:Tanos|Tanos]] ([[User talk:Tanos|talk]]) 06:43, 17 September 2014 (UTC)
:Fixed. --[[User:DaB.|DaB.]] ([[User talk:DaB.|talk]]) 10:55, 17 September 2014 (UTC)
::And anyone is welcome to edit the comic. Thanks for the input! [[User:Nealmcb|Nealmcb]] ([[User talk:Nealmcb|talk]]) 16:06, 17 September 2014 (UTC)
:::Sorry - t'was me. Note to self: Do not edit in the morning[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 16:27, 17 September 2014 (UTC)
----

Reference to the iPhone (and may be other smartphones) which becomes bigger and bigger with every release. At the same time iPhone becomes less popular and it is 'dying' this way. So - the bigger iPhone becomes the closer it is to 'death'. And it was like a star among other smartphones.
In the title text it may be a jesting prophesy - one on future generation of iPhone will be like a set of some separate devices.

[[Special:Contributions/108.162.246.229|108.162.246.229]] 07:42, 17 September 2014 (UTC)

----

The first paragraph assumes that the phone is going to become a white dwarf and the supernova is not mentioned until lower down. Personally, I read the "collapse in a violent explosion" comment from the fourth panel as implying that it was already on its way to becoming a supernova(-analog) and the charger would speed it up. Unless red dwarfs actually explode and leave white dwarfs (which I didn't think they did, but maybe I'm wrong there) concluding that it's analogous to the white dwarf doesn't make sense to me, at least. Thoughts? [[Special:Contributions/199.27.128.86|199.27.128.86]] 08:42, 17 September 2014 (UTC)
:A red giant will have its outer layers blown away (though not in anything like the violent way of a supernova) and the core that remains is a white dwarf. A much larger star that goes supernova will often leave behind a neutron star or, if the star was really massive, a black hole. [[Special:Contributions/141.101.98.190|141.101.98.190]] 12:57, 17 September 2014 (UTC)

----

There is a conspiracy theory that Apple allegedly kills iPhones just before the release of a new model. This comic seems to make a play on that. {{unsigned ip|141.101.104.193}}
-Unusual conspiracy. Presumably it's to make sure old customers buy the new iPhone, but wouldn't most Apple fans do that anyways? [[Special:Contributions/108.162.216.109|108.162.216.109]] 12:37, 17 September 2014 (UTC)

----

Lol, I didn't even notice the phone was getting bigger until the last panel. Derp. [[User:Zowayix|Zowayix]] ([[User talk:Zowayix|talk]]) 14:20, 17 September 2014 (UTC)

----
The two way pager in title text might be a reference to black holes, under the assumption that they act as worm holes to other regions in spacetime. It could explode and leave behind a slowly fading PalmPilot
(netron star), Calculator(brown dwarf), Two way pager (blackhole). [[Special:Contributions/108.162.217.125|108.162.217.125]] 15:14, 17 September 2014 (UTC)BK

1422: My Phone is Dying

2014-09-17T05:24:22Z

Tier666:

{{comic
| number = 1422
| date = September 17, 2014
| title = My Phone is Dying
| image = my_phone_is_dying.png
| titletext = When it explodes, it will cast off its outer layers, leaving behind nothing but a slowly fading PalmPilot, calculator, or two-way pager.
}}

==Explanation==
The phone in question appears to "die" in a way analogous to the {{w|Stellar_evolution|life and death}} of a star: expending its fuel while heating up and expanding before ultimately losing its outer layers and becoming a white dwarf or similar "lesser" star. Once extra mass is added to the dying star, analogous to "charging", the process only accelerates. The phone seems to have an certain mass - because [[White Hat]] expects the phone to go {{w|Supernova|(super)nova}}. Charging the phone may lead to a {{w|Nova|type 1a nova}}.
The comic also plays on the release of two new {{w|IPhone|iPhone models}} with {{w|IPhone_6|bigger}} screens, planned for 2 days after the release of the comic.

==Transcript==
{{incomplete transcript}}

{{comic discussion}}

1360: Old Files

2014-09-14T09:04:27Z

Tier666:

{{comic
| number = 1360
| date = April 25, 2014
| title = Old Files
| image = old_files.png
| titletext = Wow, ANIMORPHS-NOVEL.RTF? Just gonna, uh, go through and delete that from all my archives real quick.
}}

==Explanation==
{{incomplete|Still need work, grammar. Other comics being referenced need to be included.}}
This comic came out the day after [http://news.sky.com/story/1248397/andy-warhol-originals-found-on-floppy-disk Sky News published the story] of original {{w|Andy Warhol}} artwork, created in 1985 on an {{w|Amiga 1000}}, was recovered from recently found floppy disks.

Cueball is digging through a pile of old files, which the comic represents as digging with a shovel into the depths of his file-system. These layers are arranged much like geological rock formations where older strata is deeper down than younger layers. The files are in concentric layers because each directory is imbedded in the previous directory. Therefore the "Documents" folder contains an "Old Desktop" which contains a folder with files recovered from an older system, which contains a "My Documents" folder, which contains a folder with files copied from a {{w|Zip Disk}} in high school. The result is that files from high school have survived in his present-day machine. The formats and systems are meant to be analogous to the fossils and artifacts found in lower, older rock layers.

Notice how file-sizes get larger the newer they are. Older systems and smaller files are found in lower layers, as they are hadn't been developed yet; AOL, NYET, Kazaa are older than Facebook, and MP3s. In the days of AOL, 94 MB was reasonable disk space whereas current computers require larger file storage, hence 47 GB. In other words, digital artifacts have the same structural hierarchy as physical, geological ones.

He discovers several files he is embarrassed about, including a poetry file that surprises him, since he does not remember writing poetry, and an "{{w|Animorphs}} Novel" mentioned in the title text, most likely a fan fiction of the Animorphs series, although possibly a copy of one of the original books.

The {{w|Animorphs}} at the title text refers to a fiction series released between 1996 and 2001. This is also content more than ten years old.

See also [[1380: Manual for Civilization]] for other references to Animorphs.

See also [[286: All Your Base]] for other references to AYB.

See also [[512: Alternate Currency]] for references to 4 chan.

See also [[107: Snakes on a Plane! 2]] for references to James.

===Files and Folders===
The folders and files in detail:

'''Documents''' (47 GB): A large folder containing many of [[Cueball]]'s personal files.
*''misc.txt'': A miscellaneous {{w|text file}} of unknown and unknowable content.
*''Video projects'': As video files can take up a lot of space this likely makes up portion of the 47 GB.

'''Old desktop''' (12 GB): A backup from a former computer.
*''{{w|Facebook}} pics'': Pictures that were intended to be added to Facebook.
*''Pics from other camera'': Unknown pictures from a second camera.
*''Temp'': Temporary folders generally contain cashed files and files that are used temporarily to install programs.
*''Misc {{w|Portable Document Format|PDF}}s'': PDFs are often used for documentation, but could be any collection of digitized books or other documents.
*''{{w|MP3}}'': MP3 is a widely-used format for digital audio files.

'''Recovered from drive crash''' (4 GB): When a {{w|Hard disk drive|hard drive}} crashes some or all data may be recovered.
*''Temp'': Temporary files.
*''Work misc'': Unknown work related projects.
*''{{w|Audiobook|Audio books}}'': Recordings books being read out loud.

'''My Documents''' (570 MB): This is a typical folder created by {{w|Microsoft Windows}} for personal documents.
*''Downloads'': A default location for downloaded files in the Windows OS.
*''{{w|Kazaa}} shared'': Kazaa is a defunct peer-to-peer file sharing program. The "shared" folder shared with other members.
*''AYB'': {{w|All your base are belong to us|ALL YOUR BASE are belong to us}} is an internet {{w|Meme|meme}} inspired by a bad translation from ''{{w|Zero Wing}}''.
*''{{w|Escape Velocity Override|EV Override}}'': An {{w|Apple Macintosh}} video game, released in 1998.
*''[http://rephial.org/ Angband]'': A game named after a fictional stronghold created by {{w|J. R. R. Tolkien}}.
*''{{w|GIF}}s'': A image format widely used for transparent or animated images.
*''{{w|Fight Club}}.wmv'': A movie. As feature movies are typically compressed to 700 megabyte, and this folder only contains 570 MB, it must be of low quality or a small screen size.
*''{{w|Elasto Mania}}'': A physics-simulation game that claims to show real physics.
*''{{w|AOL Instant Messenger|AIM}} Direct Connect files'': Files transferred via AOL Instant Messenger.
*''{{w|4chan}}'': An image-board where users can upload pictures anonymously. Randall impulsively saves pictures from there.
*''{{w|ICQ}} logs'': Logs from an instant messaging program introduced in 1996. It is no longer commonly used in North America.

'''High school {{w|Zip drive|Zip disk}}''' (94 MB): The most popular form of {{w|superfloppy}}, introduced in 1994 with a capacity of 100 MB.
*''{{w|Korn}} MIDI'': Korn is an American {{w|nu metal}} band formed in 1993. {{w|MIDI}} is a protocol for communication with electronic musical instruments. The result tends to be sounds of low quality.
*''Photos3'': This is a folder of old photos.
**''{{w|Prom}}'': Pictures taken at prom.
*''lovenote.txt'': An old text file of a {{w|love letter}}, probably to a classmate in high school.
*''{{w|Gorillas (video game)|Gorillas}}.bas'': A game written in {{w|BASIC}}, to be run on {{w|QBasic}}, and supplied with MS-DOS .
*''Dream.txt'': Some private dreams.
*''James.txt'': Perhaps [[James]] is a friend of Randall, and the same as the one who came up with [[107|xkcd #107]].
*''{{w|AOL}}'': A early online and internet service, founded in 1985 and popular in the 1990s.
**''{{w|Citadel (software)|Citadel}}'' - A {{w|BBS}} and email platform that was widely used in the 1980s and early '90s.
*''{{w|QBasic}}'': An {{w|Integrated development environment|IDE}} released by {{w|Microsoft}} in 1991, which was used to write and run computer programs in the BASIC language.
*''NYET'': ''NYET'' was a {{w|Tetris}}-like game for MS-DOS, released in 1988.
*''Jokes.txt'': An old text file of jokes.

'''AAAFILES''' (9.4 MB): Some of [[Cueball]]'s oldest documents, likely prefixed with "AAA" to put the folder at the top of an alphabetically-sorted list.

'''TXT''' (850 K): Old text files, which include poetry he didn't remember writing.

==Transcript==

:Megan (on top of stack of files): You OK down there?

:'''Documents''' (47 GB)
::misc.txt
::Video projects
:'''Old desktop''' (12 GB)
::Facebook pics
::Pics from other camera
::Temp
::Misc PDFs
::MP3
:'''Recovered from drive crash''' (4 GB)
::Temp
::Work misc
::Audio books
:'''My Documents''' (570 MB)
::Downloads
::Kazaa shared
::AYB
::EV Override
::Angband
::GIFs
::FIGHT CLUB.wmv
::Elasto Mania
::AIM Direct Connect files
::4chan
::ICQ logs
:'''High school Zip disk''' (94 MB)
::Korn MIDI
::Photos3 (Prom)
::lovenote.txt
::Gorilla.bas
::Dream.txt
::James.txt
::AOL (Citadel)
::QBasic
::NYET
::Jokes.txt
:'''AAAFILES''' (9.4 MB)
:'''TXT''' (850 K)
:Cueball (deep inside the AAAFILES section looking at his txt files): Oh my god. I wrote '''poetry'''.

{{comic discussion}}
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Animorphs]]
[[Category:Comics featuring James]]

1420: Watches

2014-09-14T08:49:20Z

Tier666:

{{comic
| number = 1420
| date = September 12, 2014
| title = Watches
| image = watches.png
| titletext = Old people used to write obnoxious thinkpieces about how people these days always wear watches and are slaves to the clock, but now they've switched to writing thinkpieces about how kids these days don't appreciate the benefits of an old-fashioned watch. My position is: The word 'thinkpiece' sounds like a word made up by someone who didn't know about the word 'brain'.
}}

==Explanation==
{{incomplete|More details.}}
This comic coincides with the announcement of a new [https://www.apple.com/watch/ smart watch] by Apple earlier in the week (9th Sept 2014), along with a large emphasis on smartwatches at IFA 2014 (Sept 5-10), particularly 'Android Wear' .

The timeline shows a period from 2005 to 2015 where our wrists were liberated from the tethers of wearing a watch, likely attributed to the fact that many instead used a mobile 'smart' phone to tell the time.

Whilst other smart watches have been released in the past, Randall predicts that the typical widespread interest following Apple product releases (combined with many other new releases by other companies) will result in our wrists again being shackled in the grip of watches from 2015. The wording of the label suggests that Randall is pre-emptively mourning the imminent loss of freedom of his and others' wrists, though may be humorous hyperbole/sarcasm, as his position has generally been of apathy, such as in this [http://xkcd.com/1215/ piece].

The title text refers to how 'old people' tend to express derision towards change (generally most widely accepted by 'young people') as not being like it was 'in the good old days', even if this means they contradict themselves. Initial wearing of watches was viewed negatively by the older generation, but now 'not' wearing a watch is instead negative. The second part of the title text starts as if Randall is going to express an opinion on wearing a watch, but then veers off to mock the word '{{w|think piece|thinkpiece}}', due to its (particularly [http://www.merriam-webster.com/dictionary/think%20piece recent]) connotation for lacking factual content and expressing biased opinions. For more details on ''thinkpiece'' see this [http://www.slate.com/blogs/browbeat/2014/05/07/thinkpiece_definition_and_history_roots_of_the_word_show_it_has_long_been.html article]. By equating ''thinkpiece'' with ''brain'', Randall is making a reference to the fact that this compound word does not follow the convention of the compound word ''timepiece'', which is a synonym for ''watch''.

==Transcript==
:[A timeline shows the following years but extends further in both direction:]
:1990 2000 2010 2020 2030
:[A grey box extends from the left border to approximately 2005 and another grey box begins approximately at 2015 and continues to the right border. They are labeled:]
:Regular watches
:Smart watches
:[An arrow points up to the empty period between 2005 and 2015. Below the arrow is written:]
:Brief, glorious period in which our wrists were free

{{comic discussion}}

1420: Watches

2014-09-12T10:21:36Z

Tier666:

{{comic
| number = 1420
| date = September 12, 2014
| title = Watches
| image = watches.png
| titletext = Old people used to write obnoxious thinkpieces about how people these days always wear watches and are slaves to the clock, but now they've switched to writing thinkpieces about how kids these days don't appreciate the benefits of an old-fashioned watch. My position is: The word 'thinkpiece' sounds like a word made up by someone who didn't know about the word 'brain'.
}}

==Explanation==
{{incomplete|More details.}}
This comic coincides with the announcement of a new [https://www.apple.com/watch/ smart watch] by Apple earlier in the week (9th Sept 2014).

The timeline shows a period from 2005 to 2015 where our wrists were liberated from the tethers of wearing a watch, likely attributed to the fact that almost everybody instead used a mobile phone to tell the time.

While there are other smart watches available and planned, the typical widespread adoption of any product by Apple means Randall predicts that from 2015 our wrists will again become shackled in the grip of watches. The wording of the label suggests that Randall is pre-emptively mourning the freedom of his and others wrists.

The title text refers to how 'old people' tend to express derision anything that the younger generation does as not being as good as how things used to be in the good old days, even if this means they contradict themselves. At first wearing a watch was negative according to the older generation, but now all of a sudden ''not'' wearing an old-fashioned watch is instead negative. The second part of the title text starts as if Randall is going to express an opinion on wearing a watch, but then veers off to mock the word '{{w|think piece|thinkpiece}}' as sounding like a made up word for brain. For more details on ''thinkpiece'' see this [http://www.slate.com/blogs/browbeat/2014/05/07/thinkpiece_definition_and_history_roots_of_the_word_show_it_has_long_been.html article].

==Transcript==
: [An axis from left to right with the dates 1990 - 2000 - 2010 - 2020 - 2030]
: A grey box labeled "REGULAR WATCHES" from the left border to approximately 2005 and a grey box starting approx. 2015 and continuing to the right border labeled "SMART WATCHES"
: An arrow pointed at the empty period between 2005 and 2015 in the line above with the text "Brief, glorious period in with our wrists were free"

{{comic discussion}}

1420: Watches

2014-09-12T09:42:25Z

Tier666:

{{comic
| number = 1420
| date = September 12, 2014
| title = Watches
| image = watches.png
| titletext = Old people used to write obnoxious thinkpieces about how people these days always wear watches and are slaves to the clock, but now they've switched to writing thinkpieces about how kids these days don't appreciate the benefits of an old-fashioned watch. My position is: The word 'thinkpiece' sounds like a word made up by someone who didn't know about the word 'brain'.
}}

==Explanation==
{{incomplete|More details.}}
This comic coincides with the announcement of a new [https://www.apple.com/watch/ smart watch] by Apple earlier in the week (9th Sept 2014).

The timeline shows a period from 2005 to 2015 where our wrists were liberated from the tethers of wearing a watch, likely attributed to the fact that almost everybody instead used a mobile phone to tell the time.

While there are other smart watches available and planned, the typical widespread adoption of any product by Apple means Randall predicts that from 2015 our wrists will again become shackled in the grip of watches. The wording of the label suggests that Randall is pre-emptively mourning the freedom of his and others wrists.

The title text refers to how 'old people' tend to express derision anything that the younger generation does as not being as good as how things used to be in the good old days, even if this means they contradict themselves. At first wearing a watch was negative according to the older generation, but now all of a sudden ''not'' wearing an old-fashioned watch is instead negative. The second part of the title text starts as if Randall is going to express an opinion on wearing a watch, but then veers off to mock the word '{{w|think piece|thinkpiece}}' as sounding like a made up word for brain.

==Transcript==
: [An x-axis from left to right with the dates 1990 - 2000 - 2010 - 2020 - 2030]
: A grey box labeled "REGULAR WATCHES" from the left border to approximately 2005 and a grey box starting approx. 2015 and continuing to the right border labeled "SMART WATCHES"
: An arrow pointed at the empty period between 2005 and 2015 in the line above with the text "Brief, glorious period in with our wrists were free"

{{comic discussion}}

User:Tier666

2014-09-10T13:03:56Z

Tier666:

Tier666 is a xkcdophile from {{w|Austria|Austria}}. The {{w|Pseudonym|alias}} refers to {{w|Number_of_the_beast|the number of the beast}}.
This seems fitting, as the given first name of the user appears in {{w|Classification_of_demons#Michaelis.27_classification_of_demons|Michaelis' classification of demons}} (although in the French form, the user's passport states the name in the English form...).
This fact has only become apparent to the user because of extensive reading to contribute to this page...

I like to insert links to {{w|Wikipedia|wikipedia}} and to correct minor spelling {{w|Mistake|mitsakes}}. My specialties are a little bit of {{w|Chemistry|chemistry}} and related fields in the {{w|Life_sciences|life sciences}}. I mostly work for pharmaceutical companies helping with {{w|Verification_and_Validation|Qualification and Validation}} as a {{w|Mercenary|hired sword}}.

Forgiveness is asked for the occasional bad joke.

User:Tier666

2014-09-10T12:52:50Z

Tier666:

Tier666 is a xkcdophile from {{w|Austria|Austria}}. The {{w|Pseudonym|alias}} refers to {{w|Number_of_the_beast|the number of the beast}}.
This seems fitting, as the given first name of the user appears in {{w|Classification_of_demons#Michaelis.27_classification_of_demons|Michaelis' classification of demons}} (although in the French form, the user's passport states the name in the English form...).
This fact has only become apparent to the user because of extensive reading to contribute to this page...

I like to insert links to {{w|Wikipedia|wikipedia}} and to correct minor spelling {{w|Mistake|mitsakes}}.

Forgiveness is asked for the occasional bad joke.

User:Pudder

2014-09-10T12:36:33Z

Tier666:

Name: Peter

Gender: Male

Age: >25

Occupation: Mechanical Engineer (with some electrical & programming)

Formal Education: Mechcanical Engineering with Composites degree

Political Views: Vaguely liberal

Religious Views: I am personally an {{w|Atheism|atheist}}, however having grown up in a christian family I respect each persons religious beliefs. That comes with the caveat that those beliefs do not have any negative impact on other people, whether individually or as a group.

Words to live by:
*Never attribute to malice that which is adequately explained by stupidity - Robert J. Hanlon
*The majority of people you will encounter in your life are good, do not let the others taint your view of the majority

User:Tier666

2014-09-10T12:31:58Z

Tier666:

Tier666 is a xkcdophile from {{w|Austria|Austria}}. The alias refers to {{w|Number_of_the_beast|the number of the beast}}.
This seems fitting, as the given first name of the user appears in {{w|Classification_of_demons#Michaelis.27_classification_of_demons|Michaelis' classification of demons}} (although in the French form, the users passport states the name in the English form...).
This fact has only become apparent because of extensive reading to contribute to this page...

Forgiveness is asked for the occasional bad joke.

User:Tier666

2014-09-10T12:30:07Z

Tier666: Created page with "Tier666 is a xkcdophile from {{w|Austria|Austria}}. The alias refers to {{w|Number_of_the_beast|the number of the beast}}. This seems fitting, as the given first name of the u..."

Talk:1419: On the Phone

2014-09-10T12:12:48Z

Tier666:

It seems to me that the off-panel character is most likely [[Cueball]]. The way he says 'Haha. I'm so absentminded' makes me think that the obelisk is intentional, and hes trying to dismiss it lightly having been found out. --[[User:Pudder|Pudder]] ([[User talk:Pudder|talk]]) 09:43, 10 September 2014 (UTC)

I can relate to this, and for what I've heard, I'm not the only one: it seems it's rather common for people to wander around the house rearranging stuff while on the phone. [[Special:Contributions/141.101.99.210|141.101.99.210]] 10:35, 10 September 2014 (UTC) AK
----
This seems to refer {{w|The_Magical_Number_Seven,_Plus_or_Minus_Two|Miller's Law}} again, like #1417. Maybe Randal is looking for his car keys or something else he has put down somewhere while doing something else...
[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 12:12, 10 September 2014 (UTC)

1419: On the Phone

2014-09-10T12:06:43Z

Tier666:

{{comic
| number = 1419
| date = September 10, 2014
| title = On the Phone
| image = on_the_phone.png
| titletext = 'No idea what I was thinking! Haha! But anyway, maybe we should check out what this Ba'al guy has to say.'
}}

==Explanation==
{{incomplete|More detail required}}
Megan is wandering around the house, and discovers things which have been left in strange places, or arranged in piles.
On questioning an out-of-panel person (presumably [[Cueball]]), he responds that he tends to pick things up and fiddle with them while on the phone.

Fiddling with objects, doodling on the nearest surface, or otherwise getting distracted are fairly common habits which many people can probably relate to.

The final panel takes this to the extreme, where an obelisk inscribed with worrying prayers to 'Ba'al, The Soul-Eater' has been erected in the garden.
Ba'al the Soul-Eater is also in the title-text of [[1246: Pale Blue Dot]]. Ba'al may refer to a range of supernatural beings, starting with {{w|Baal#Baal-zebub|Ba'al Zebub}} that gave rise to Belzebub (one of the {{w|Classification_of_demons#Binsfeld.27s_classification_of_demons|seven princes of hell}}).

==Transcript==
[Megan is standing looking off-panel in one direction and pointing in the other.]
: Megan: Why is there a teapot in the bathroom?
: Off-panel voice: Sorry. When I'm on the phone I always zone out and pick stuff up and carry it around.
[Megan is in front of an open fridge. She holds a hammer.]
: Megan: There's a hammer in the fridge.
: Off-panel voice: Another phone call. I was just fidgeting.
[Megan walks through small, curious towers of household objects:
first tower have lightbulb on one book,
second tower have blender on three books,
third tower have uh six books ?,
last tower have two tennis ball on three books]
: Megan: Did you put all our stuff in weird stacks?
: Off-panel voice: Long call. Sorry.
[Megan, outside, looks up at a large straight-sided object]
: Megan: ...Why is there a giant obelisk in the backyard?
: Off-panel voice: Phone again. My bad.
: Megan: It's carved with prayers to "Ba'al, the Soul-Eater."
: Off-panel voice: Haha! I'm so absentminded.

{{comic discussion}}

Talk:1418: Horse

2014-09-10T11:39:52Z

Tier666:

*May the horse be with you Luke.
*The horse is strong with this one.
*I felt a tremor in the horse.
Why did he forget SW. That is not like Randall ;) [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 08:50, 8 September 2014 (UTC)

----

Following up on the title text... "Why was he suspended?" "Due to allegations of excessive horse."

[[Special:Contributions/173.245.56.201|173.245.56.201]] 09:01, 8 September 2014 (UTC) Siuntio

So I linked it to the old substitutions page - gjgfuj [[Special:Contributions/108.162.250.219|108.162.250.219]] 10:05, 8 September 2014 (UTC)

Like the "Clouds-to-butts" plugin for Chrome. {{unsigned ip|108.162.249.231}}
:More information in Reddit [http://www.reddit.com/r/OutOfTheLoop/comments/24odjt/cloud_to_butts_extension/]. [[Special:Contributions/108.162.221.201|108.162.221.201]] 14:16, 8 September 2014 (UTC)

----

Would it be funny the other way?
*The force population has been in decline sine the industrial revolution
*Rules of polo: You need a force.
*People do not like it when there is force in their beef.
I do ;) —[[User:Artyer|Artyer]] ([[User talk:Artyer|talk]]) 18:33, 8 September 2014 (UTC)

----
Correctforcebatterystaple [[Special:Contributions/173.245.56.163|173.245.56.163]] 22:18, 8 September 2014 (UTC)

I originally (earlier today) read it as "Iraqi Air [FH]orse grow'''l'''ing"... Which made less sense than I'd have expected, but I couldn't unread it until just now. Still surreal, but at least not outright Dada[[Special:Contributions/141.101.98.233|141.101.98.233]] 00:21, 9 September 2014 (UTC)

"A police horse is a constituted body of persons empowered by the state to enhorse the law, protect property, and limit civil disorder. (...) Law enhorsement, however, constitutes only part of policing activity." --[[Special:Contributions/141.101.104.161|141.101.104.161]] 07:21, 9 September 2014 (UTC)

maybe the officer suspended from horse was a reference to the police officer who shot a black person? [[Special:Contributions/108.162.254.106|108.162.254.106]] 07:39, 9 September 2014 (UTC)

Aqua teen hunger horse. [[Special:Contributions/108.162.246.226|108.162.246.226]] 00:54, 10 September 2014 (UTC)

----

Please remember that the discussion section is to be used for discussing the explanation. Before you add what you believe is the most hilarious and original force-->horse substitution, have a little chuckle to yourself, and then move on without clogging up this section. --[[User:Pudder|Pudder]] ([[User talk:Pudder|talk]]) 07:58, 10 September 2014 (UTC)

----
Explanation Quarks:
Sorry, could not resist... [[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 11:39, 10 September 2014 (UTC)

1418: Horse

2014-09-10T11:37:54Z

Tier666:

{{comic
| number = 1418
| date = September 8, 2014
| title = Horse
| image = horse.png
| titletext = Officer suspended from horse.
}}

==Explanation==
[[Cueball]] has set his browser to auto-replace the word "force" with the word "horse." Some of the humorous resulting news headlines are shown.

*Ukranian town threatened by pro-Russian horses - At the time this comic was published, there is civil unrest in Ukraine, mostly framed as pro-European vs pro-Russian.
*Governor appoints task horse - A {{w|Task force}} is a unit or formation established to work on a single defined task or activity, which makes it quite comical to picture a horse instead of a unit.
*Iraqi Air Horse growing - The Air ''Force'' of Iraq may indeed be being up-armed, especially in light of the threat, at this time, of ISIS/ISIL/Islamic State forces across swaths of both Iraq and Syria.
*Quarks, which are bound together by the strong nuclear horse - {{w|Quark|Quarks}} are elementary particles. They form bound states e.g. the {{w|Proton|proton}} (two up + one down-quark) mediated by the {{w|Strong interaction|strong force}}, similarly as atoms are bound states of {{w|Electron|electrons}} and charged {{w|Nucleon|nucleons}} held together by the {{w|Electromagnetism|electromagnetic horse}}.
*Officer suspended from horse (title text) - Being suspended from a police force (i.e. usually being forced upon mandatory leave pending resolution of the issue at hand; paid, part-paid or unpaid) is a common practice where culpable wrongdoing of sufficiently serious nature is suspected of the individual concerned. A person could literally be suspended from a horse if he fell off the horse but got stuck in the stirrups.

This is probably a parody of the Cloud to Butt Chrome Extension [https://chrome.google.com/webstore/detail/cloud-to-butt-plus/apmlngnhgbnjpajelfkmabhkfapgnoai?hl=en] (since it says ''new'' favorite browser text replacement).

This comic plays on the same premise (and perhaps is a sequel to one or more of) previous strips: [[1004: Batman]], [[1031: s/keyboard/leopard/]] and [[1288: Substitutions]].

==Transcript==
:[Headlines above the main frame of the comic:]
:New favorite browser text replacement:
:'''Force → Horse'''

:[In the comic frame Cueball is sitting in front of his PC reading the following headlines that are written above him in separate frames:]
:Ukranian towns threatened by pro-Russian horses
:Governor appoints task horse
:Iraqi air horse growing
:Quarks, which are bound together by the strong nuclear horse...

{{comic discussion}}
[[Category:Comics featuring Cueball]]

1418: Horse

2014-09-10T11:29:19Z

Tier666:

{{comic
| number = 1418
| date = September 8, 2014
| title = Horse
| image = horse.png
| titletext = Officer suspended from horse.
}}

==Explanation==
[[Cueball]] has set his browser to auto-replace the word "force" with the word "horse." Some of the humorous resulting news headlines are shown.

*Ukranian town threatened by pro-Russian horses - At the time this comic was published, there is civil unrest in Ukraine, mostly framed as pro-European vs pro-Russian.
*Governor appoints task horse - A {{w|Task force}} is a unit or formation established to work on a single defined task or activity, which makes it quite comical to picture a horse instead of a unit.
*Iraqi Air Horse growing - The Air ''Force'' of Iraq may indeed be being up-armed, especially in light of the threat, at this time, of ISIS/ISIL/Islamic State forces across swaths of both Iraq and Syria.
*Quarks, which are bound together by the strong nuclear horse - {{w|Quark|Quarks}} are elementary particles. They form bound states e.g. the proton mediated by the {{w|Strong interaction|strong force}}, similarly as atoms are bound states of electrons and the nucleus hold together by the {{w|Electromagnetism|electromagnetic force}}.
*Officer suspended from horse (title text) - Being suspended from a police force (i.e. usually being forced upon mandatory leave pending resolution of the issue at hand; paid, part-paid or unpaid) is a common practice where culpable wrongdoing of sufficiently serious nature is suspected of the individual concerned. A person could literally be suspended from a horse if he fell off the horse but got stuck in the stirrups.

This is probably a parody of the Cloud to Butt Chrome Extension [https://chrome.google.com/webstore/detail/cloud-to-butt-plus/apmlngnhgbnjpajelfkmabhkfapgnoai?hl=en] (since it says ''new'' favorite browser text replacement).

This comic plays on the same premise (and perhaps is a sequel to one or more of) previous strips: [[1004: Batman]], [[1031: s/keyboard/leopard/]] and [[1288: Substitutions]].

==Transcript==
:[Headlines above the main frame of the comic:]
:New favorite browser text replacement:
:'''Force → Horse'''

:[In the comic frame Cueball is sitting in front of his PC reading the following headlines that are written above him in separate frames:]
:Ukranian towns threatened by pro-Russian horses
:Governor appoints task horse
:Iraqi air horse growing
:Quarks, which are bound together by the strong nuclear horse...

{{comic discussion}}
[[Category:Comics featuring Cueball]]

1416: Pixels

2014-09-04T22:06:55Z

Tier666:

{{comic
| number = 1416
| date = September 3, 2014
| title = Pixels
| image = pixels.png
| titletext = It's turtles all the way down.
}}
'''NOTE: The above is only a zoomed out version of the this interactive comic.''' For a collection of images that appear when zooming in on this comic, see [[1416: Pixels/Images]].

==Explanation==
{{incomplete|Individual panels need explanations}}
This interactive comic begins with a panel where [[Cueball]] is stacking turtles. This is a reference to the idiom "turtles all the way down," which refers to the problem of infinite recursion: if everything in the universe is "on top of" something else, so to speak, there must be a "bottom." A joking solution to the paradoxical nature of such a bottom is the proposition that {{w|Turtles_all_the_way_down|the world rests on a semi-infinite stack of turtles}}.

As can be read you should "scroll to zoom". This can be done by placing the cursor inside the panel of the comic. When scrolling up (using the mouse wheel) the picture zooms in until the pixels are visible. When you continue to scroll on each pixel then resolves into another comic picture, with black-on-white comic panels making up the white pixels and white-on-black panels making up the black pixels. Scrolling on until you can see the pixels of the comic picture you are now zooming into the process is repeated again and will be so for all subsequent sets of comic panels. Not all white and all black panels are the same; some sets involve more than two different panels, but all involve repetitive tiling.

==Themes==
*Below are all the themes relevant to cover all the images found when zooming in.
*They are sorted in the same order as in the gallery: [[1416: Pixels/Images]].
**Open the gallery in another window - zoom out and then you can see the pictures in this window as you read about them here below:

===Turtles===
Apart from the first image there are two more with a single turtle in them. In one of these the turtle thinks "I am a turtle".
It may say so to the Cueball that is seen standing all alone in another picture.

===What if?===
There is a picture of the book, as it looks and big enough that all text is visible on the front cover. But there is also another version where the authors name is crossed out and replaced with Stephen King and also the word Spooky has been added above the title and below the word xkcd has been crossed and replaced with being afraid.

===Book Launch===
This comic was released on September 3rd, 2014, the day after [[Randall|Randall's]] book ''[http://whatif.xkcd.com/book/ What If]'' was launched. The book is shown and referred to in a number of frames, for example it is [[:File:pixels-upgoer.png|'''literally''' launched]] as a part of an <strike>rocket</strike> [[1133:_Up_Goer_Five|''up goer'']] built by Cueball. There are also a picture with Cueball holding "his book" and telling he is exited about book the launch.

The model ''up goer'' is [[:File:pixels-assembly-1.png|made of Rocket Parts from KSP]]. KSP is the {{w|Kerbal Space Program}}, a spaceflight simulator which was also [[1350: Lorenz#Themes|part]] of the latest interactive comic [[1350: Lorenz]]. Perhaps XKCD's 'parts' refers to KSP's large community of mod developers who contribute 'parts' to the game. The frames showing the book launch use URLs that include the text "upgoer" in reference to the [[Up Goer Five]] comic.

In the end the upgoer leaves the Earth after one orbit and then flies through space.

===Needs More Struts===
{{w|Strut|Struts}} are structural members in engineering, and are are one of the components used in Kerbal Space Program to construct rockets. 'Needs More Struts' seems to be a meme amongst players of Kerbal Space Program, along the lines of 'When in doubt, overengineer'. Megan deems Cueball's rocket to be insufficiently structurally sound, and declares that it "[[:File:pixels-assembly-4.png|Needs More Struts]]"

===The Only Copy===
Cueball & Megan turn to each other having just launched the What-If book rocket into space (construction and launch are seen in other panels). perhaps Megan realises they may have misunderstood the term 'book launch' and that they may have just lost ''[[:File:pixels-upgoer-6.png|the only copy]]'' of the book.

===Space objects===
There are both the Moon, the Sun, Saturn and two images just with stars.

===Sky===
In four pictures Cueball and Megan is sitting below the stars. In the second the following conversation takes place:
:Cueball: Someone once told me the great kings of the past look down on us...
:Megan: From the stars?
:Cueball: Just in general.
The second panel is a reference to Disney's [http://lionking.wikia.com/wiki/The_Great_Kings_of_the_Past The Lion King]. Early in the film, Mufasa tells Simba that the great kings of the past look down on them from the stars. Later on, Simba recalls this to his companions, Timon and Pumba (who don't take him seriously). In the film, the kings of the past literally look down on--and watch over--the characters, which is how Megan interprets Cueball's initial statement. Cueball's reply that they just look down on us in general shows that he means the kings of the past figuratively look down on us (they view us as inferior or beneath them).

In the next image a shooting star is seen above them. The final picture looks to identical to the first?

===Mario===
A series of 8 images are called ''Mario''. One is also called ''entry'' has a picture only of a PC. The next four has Megan in front of the PC (Maybe she is Mario? Or she is playing Mario Brothers? She has a control in her hand so probably the last...) She sits on her knees in the first picture, then she sits on the floor. In the third picture she is laying down in front of the PC. Then there is one picture which is an inverse of the sitting picture. The last three pictures is all with a view of the starlit night sky with the same two clouds in place. During the night (and these three pictures) a giant galaxy rises above the horizon. It does not look like the Milky Way would look anywhere from Earth (also it does not much look like a spiral galaxy like the Milky Way). There is something square protruding into the picture - this could be brick wall hanging in the air. Mario can be seen standing in the bottom left corner. Or it could be part of the roof hanging out from the building Megan is inside. Maybe the rise of the galaxy shows how long Megan plays her game. Maybe this is why Cueball wish to [[#Shut Down the Server|throw water on the server]].

===Shut Down the Server===
Cueball tells an offscreen character that he is going to [[:File:pixels-server-1.png|shut down the server]], while carrying a bucket of water.

Usually shutting down a {{w|Server (computing)|server}} is done via the operating system or software, or (not recommended) turning it off or pulling the power plug. But in this case it appears that cueball is simply going to douse it with water, likely resulting in serious water damage to the hardware.

===Clouds===
In five pictures Megan is floating in the clouds. Only two pictures with Megan, two only with clouds and one only with birds as seen from a distance.

===Cantor Set===
[[:File:pixels-cantor.png|One panel]] contains a number of lines and dots, which are in fact a depiction of the first 5 steps of a {{w|Cantor set|Cantor Ternary Set}}, mirrored about the horizontal centreline. The Cantor ternary set is constructed by repeatedly deleting the open middle thirds of a set of line segments. The Cantor Set is one of the canonical examples of a fractal, a shape whose individual parts resemble the whole. The use of the Cantor Set in this comic is self-referential, in that the comic, itself, is composed of parts of the same shape as the whole.

===Walking===
In two images Cueball and Megan is seen walking. One normal black on white close up, and one inverse seen from afar. These may be relevant to the two next ([[#Time Turners]] and [[#Stockholm Syndrome]]) where they are seen talking while walking.

===Time Turners===
The time turner is a device from the {{w|Harry Potter}} series of novels by {{w|JK Rowling}}. It allows the user to re-live a period of time over again. In the third novel Hermione is given the time-turner to allow her to take extra classes, however it is eventually used to spare Buckbeak the hippogryph from execution. This prompted many questions regarding why time-turners weren’t used on other occasions to save people's lives (among other things).

While J.K Rowling has “[http://pottermore.wikia.com/wiki/Time-Turner solved the problem to her own satisfaction]” she admits that she entered into the subject of time-travel too lightly.

[[:File:pixels-time-turner.png|This panel]] jokes that if the real life JK Rowling had a fictional time-turner which worked, she would have gone back and removed the time-turner plotline from the book, saving her all the hassle of dealing with the resulting time-travel questions. This act would result in a time-travel paradox.

===Stockholm Syndrome===
{{w|Stockholm syndrome}} is the name for a psychological phenomenon, in which hostages develop sympathy, empathy and/or positive feelings towards their captors. These feelings are usually seen as irrational, seeing as the hostage is held against their wishes, usually with the threat of physical harm or death.

[[:File:pixels-stockholm.png|This panel]] asks "How do we know anyone really ''wants'' to live in Stockholm?", questioning whether everyone who lives in the city of Stockholm is in fact held hostage there and only stays because they have developed to like life there (due to Stockholm Syndrome).

===Fire Hydrant===
[[Black Hat]] is talking to a fireman, with a fire engine on fire in the background, he asks "To be fair, what else would you expect to come out of a "[[:File:pixels-fire-hydrant.png|fire hydrant]]"?"

Black Hat appears to have managed to replace the usual water supply to the {{w|fire hydrant}} with actual fire. Thus when the hydrant is used, the result is, quite literally, fire. In Black Hat's logic, a hydrant which delivers water should be called a water hydrant.

===Eeee===
Megan hears a very long stretched ''EEEEEEEEEEEEE'' sound which goes over 6 images. It turns out it is a large letter '''E''' that shouts ''EEEEEEE!!!''. In total there are 64 small E emanating from the big one. There is also a picture with two big white E on black background. Those E are larger than the E that shouts.

===Evolution===
The {{w|March of Progress}} image is a famous and instantly recognisable image showing the stages of human evolution by way of a series of primate figures as if marching in a line. The panel parodies the March of Progress image, with [[:File:pixels-evolution.png|5 ducklings following an adult duck]]. In this case they don’t actually ‘evolve’ into the adult duck however. The comic has some resemblance to [[537: Ducklings]].

===Rope===
Four ropes cross diagonally across this black picture. Looks good when there are many of them in the same place.

===Chess===
There are two chess boards on black and white background with smaller chessboards drawn upon them

===Atom etc===
There is both particles, and atom and a string.

===Holism, Reductionism, Mu===
These three words refer to "A MU offering", an essay by {{w|Douglas Hofstatder}} in his book {{w|Godel, Escher, Bach}} (which was referenced by Randall in [[24: Godel, Escher, Kurt Halsey ]]). It includes a similar multiple level drawing: {{w|Mu (negative)|the word MU}} is composed of copies of the words [[:File:pixels-holism.png|HOLISM]] and [[:File:pixels-reductionism.png|REDUCTIONISM]], each of which are in turn made of smaller copies of the other, which are in turn made of [http://newtonexcelbach.wordpress.com/2011/02/16/two-more-letters/ tiny copies] of the word [[:File:pixels-mu.png|MU]].

===du===
"[[:File:pixels-du.png|du]]" is a {{w|Linux}} command to indicate the "disk usage" of a file or directory.

~$ du -s video/
4170882256

This is a command that shows how large all the files are in this user's "video" directory - presumably where they store their personal videos. The units of the result is probably kilobytes (depending on settings)

This number is clearly large and difficult to parse, and the units are not clear. More appropriate units would be gigabytes rather than bytes. The du command offers an option to display units in "human readable format", which will adapt to use kilobytes, megabytes, gigabytes, terabytes, etc. as appropriate. The next command purports to request the same result in more human-readable form.

~$ du -hs video/
A lot.
~$

It seems that the computer, rather than giving a specific answer, simply says that the size of the video directory is "A lot."

The final line indicates the computer is now ready to accept a new command.

==Transcript==
:[Cueball is stacking turtles, and is about to put the fourth turtle on his pile. At the bottom right there is a small panel. Inside this is written:]
:Scroll to zoom

:[When zooming in there will be several panels with text. The transcript of these may not be possible to complete - but add the transcript of these panels here: [[1416: Pixels/Transcript|interactive transcript]]]

==Trivia==
===Gallery===
[[1416: Pixels/Images|This gallery]] contains the [http://azttm.wordpress.com/2014/09/03/xkcd-com-1416-pixels/ 79 images used in this comic]. The images are related in a [http://www.explainxkcd.com/wiki/images/3/37/1416_Pixels_layout.png directed graph].

===Images Database===
This google sheet describes all possible images, their associated codes, and what possible images can be used as sub-images for each zoom level: https://docs.google.com/spreadsheets/d/1nldKAkeVcK606CY12KI9bah9rDmK9E7CZOyinsEj2Lo/edit?usp=sharing

===Image scraping script===
This gist recursively downloads all possible images:
https://gist.github.com/Aaron1011/d3b56325881cd639506a

===Bugs===
*Doesn't seem to work properly in all browsers (e.g. Firefox and Safari on MacOSX), giving "TypeError: this.data is null" in line 173 of zoom.js: "var item = this.data.get(dims)"
*Doesn't seem to work in IE8, comic is blank, but title text works.
*Does not work on xkcd.org neither www.xkcd.org in Firefox and Chrome. Currently you should visit http://xkcd.com for this comic to work properly.
*Also, it doesn't work on HTTPS.

{{comic discussion}}
[[Category:Interactive comics]]
[[Category:Comics featuring Cueball]]
[[Category:Comics featuring Megan]]
[[Category:Comics featuring Black Hat]]

Talk:1413: Suddenly Popular

2014-08-30T17:28:35Z

Tier666:

N.b. The phrase "Tsunami" is clearly located after 2005 so cannot be referring to the 2004 Indian Ocean tsunami.
[[Special:Contributions/141.101.98.4|141.101.98.4]] 10:53, 27 August 2014 (UTC)

While the actual tsunami did occur in 2004, it was late December, and I would argue that it was by far the most prominent tsunami at that time. Widespread use of the word would have spanned into 2005.
See {{w|List of historical tsunamis|List of Historical Tsunamis}}
--[[Special:Contributions/141.101.99.233|141.101.99.233]] 10:58, 27 August 2014 (UTC)

:You know, you shouldn't argue: BOTH tsunamis obviously took part in the word becoming popular. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 11:03, 27 August 2014 (UTC)

:: I agree, but I also believe that the 2004 tsunami has to be listed in the explanation.--[[Special:Contributions/141.101.99.233|141.101.99.233]] 11:07, 27 August 2014 (UTC)
::: And more important here - the scale is not very clear and he may have meant 2004, but could not fit it in, with the other sentences. [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 09:02, 29 August 2014 (UTC)

Unless someone disagrees and convinces me, I think that something like "Social Engineers" (or perhaps hackers) should be added to the list of people who were aware of and who used metadata prior to the popularization of the term, so I'll add it if I remember next time I come here, or someone else can feel free to do so in my stead -- [[User:Brettpeirce|Brettpeirce]] ([[User talk:Brettpeirce|talk]]) 12:19, 27 August 2014 (UTC)

Drone Desertion... {{w|Skynet_(Terminator)|Skynet}}? [[User:Smperron|Smperron]] ([[User talk:Smperron|talk]]) 13:15, 27 August 2014 (UTC)
:Given that Paradoxical Reaction comes before Drone Desertion, could we assume that because of something done to the AI of drones, presumably to make them "smarter", it has actually led to them deserting on their own? ;) -- I could see how Randall could string a few of the future phrases together to form some logical sequence of events. [[User:Jarod997|Jarod997]] ([[User talk:Jarod997|talk]]) 13:51, 27 August 2014 (UTC)

Amplexus refers to a copulation behavior in frogs. I can only assume Randall chose this word without a hypothetical event in mind. [[Special:Contributions/108.162.219.198|108.162.219.198]] 13:32, 27 August 2014 (UTC)
:Given the theme, I feel there has to be some event that Randall had in mind that would cause humans to adopt this copulation method. [[User:Smperron|Smperron]] ([[User talk:Smperron|talk]]) 13:36, 27 August 2014 (UTC)
::Agreed, consider the title text: "Are Your Teens Practicing Amplexus? Learn These Six Telltale Signs!" --[[Special:Contributions/108.162.216.84|108.162.216.84]] 18:45, 28 August 2014 (UTC)

Rapid hair growth: Global temps drop, prompting the human body to grow thicker body hair? [[User:Smperron|Smperron]] ([[User talk:Smperron|talk]]) 13:36, 27 August 2014 (UTC)

Does anyonr else feel "May be a reference to The God-Empress of Ponykind - a My Little Pony / Warhammer 40,000 fanfic." is a bit of a stretch? [[User:Spaceside|Spaceside]] ([[User talk:Spaceside|talk]]) 13:50, 27 August 2014 (UTC)
:I personally think it's a reference to Homestuck, especially since this page's number is "1413", while "413" is an important number in that webcomic. [[Special:Contributions/141.101.88.219|141.101.88.219]] 19:25, 28 August 2014 (UTC)

Thermohaline circulation-changes predicted due to increased freshwater runoff in the arctic with climate change (melting glaciers and permafrost) and decreased sea ice cover. Whatever the cause, some evidence and speculation that this could lead to the onset of an ice age, possibly explaining "snow blindness". {{unsigned ip|108.162.216.125}}

I think hydroplaning is not the same as aquaplaning... {{unsigned ip|108.162.231.208}}

If we are going so far as to say that 2038 has to do with the 2038 problem, you may notice that each year uses 12 pixels, and therefore the sentence "I Swear Allegiance To The God-Empress In Life And In Death" can be shown to be on April 2038, not on January 19, 2038. [[Special:Contributions/108.162.221.201|108.162.221.201]] 14:59, 28 August 2014 (UTC)

That even adds more credence to the scenario, since it would probably take a few months before the radical change to society was complete, and the phrase "I Swear Allegiance To The God-Empress In Life And In Death" would become well known. ([[User talk:timengler|talk]]) 02:32, 29 August 2014 (UTC)

:I thought you were joking, but then I saw this [http://explainxkcd.com/wiki/index.php?title=1413%3A_Suddenly_Popular&diff=74466&oldid=74464]. You are a living example of the reason of the existence of religions. [[Special:Contributions/108.162.221.201|108.162.221.201]] 13:30, 29 August 2014 (UTC)

Assuming no major mutations, wouldn't human amplexus be "spooning"? [[Special:Contributions/199.27.128.140|199.27.128.140]] 18:59, 28 August 2014 (UTC)
:No - it would be doggy style - but without penetration [[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 08:58, 29 August 2014 (UTC)
It could be the propensity to snuggle for a long time between intermittent sex acts due to it being effing cold all the time.(pun intended) [[Special:Contributions/108.162.228.11|108.162.228.11]] 12:12, 30 August 2014 (UTC)

As there are no known earth crossers, I have an alternate scenario for "earth crosser" - "thermohaline" - "snow blindness": Global warming, creating Hypercanes, these would disrupt oceanic layering (thermohaline) and may go hand in hand with desertification (deserts can also lead to something akin to snow blindness). So, alternatively, Randall may predict that global warming may come much faster and harder than predicted... Just my two cents (and maybe we should think "Dune" with the last entry? not the story - the background... Bene Geserit anyone?) ... wont do any changes before discussed (or people shout "oh no - surely not"!)... [[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 17:28, 30 August 2014 (UTC)

1396: Actors

2014-07-18T08:07:30Z

Tier666: /* Explanation */

{{comic
| number = 1396
| date = July 18, 2014
| title = Actors
| image = actors.png
| titletext = Once again topping the list of tonight's hottest rising stars in Hollywood is ξ Persei!
}}

==Explanation==
The comic uses two different meanings of the word ''hottest''. In the opening question, "Who are today's 10 hottest actors?" the word ''hottest'' could refer to an actor's popularity, success, demand or attractiveness. Cueball and Megan think the word ''hottest'' is asking them to the list the 10 actors who have the highest surface temperature, and we see them measuring Justin's surface temperature using an infrared thermometer. The measured temperature of 81.5 is given (this being the USA) in {{w|Fahrenheit}} and corresponds to 27.5{{w|°C}}

With such a measurement of ''hotness'', the hottest actor on any given day would probably be whoever is having a fever. Or, an animal actor, of a species with a higher body temperature than humans. ({{w|Category:Films_about_birds}})

The title-text references the temperatures of Hollywood's rising stars, this time misunderstanding ''stars'' as actual stars, not famous people. In this case, the star {{w|Xi Persei}} in the Perseus constellation (which is located in, and responsible for the fluorescence of, an object called the California Nebula, a possible joke on the location of Hollywood), one of the hottest stars (35.000 {{w|Kelvin}}, {{w|Sun}}: 5800K) visible to the naked eye.

==Transcript==
Opening Question: Who are today's 10 hottest actors?

[Cueball is holding a clipboard, taking notes, while Megan aims an infrared thermometer at Justin.]

Megan: 81.5, but I think it got part of his shirt. [Megan yells] Hey Justin! Hold still!

Closing: We grab an infrared thermometer and find out!

{{comic discussion}}

1396: Actors

2014-07-18T08:06:44Z

Tier666: /* Explanation */

{{comic
| number = 1396
| date = July 18, 2014
| title = Actors
| image = actors.png
| titletext = Once again topping the list of tonight's hottest rising stars in Hollywood is ξ Persei!
}}

==Explanation==
The comic uses two different meanings of the word ''hottest''. In the opening question, "Who are today's 10 hottest actors?" the word ''hottest'' could refer to an actor's popularity, success, demand or attractiveness. Cueball and Megan think the word ''hottest'' is asking them to the list the 10 actors who have the highest surface temperature, and we see them measuring Justin's surface temperature using an infrared thermometer. The measured temperature of 81.5 is given (this being the USA) in {{w|Fahrenheit}} and corresponds to 27.5{{w|°C}}

With such a measurement of ''hotness'', the hottest actor on any given day would probably be whoever is having a fever. Or, an animal actor, of a species with a higher body temperature than humans. {{w|Category:Films_about_birds}}

The title-text references the temperatures of Hollywood's rising stars, this time misunderstanding ''stars'' as actual stars, not famous people. In this case, the star {{w|Xi Persei}} in the Perseus constellation (which is located in, and responsible for the fluorescence of, an object called the California Nebula, a possible joke on the location of Hollywood), one of the hottest stars (35.000 {{w|Kelvin}}, {{w|Sun}}: 5800K) visible to the naked eye.

==Transcript==
Opening Question: Who are today's 10 hottest actors?

[Cueball is holding a clipboard, taking notes, while Megan aims an infrared thermometer at Justin.]

Megan: 81.5, but I think it got part of his shirt. [Megan yells] Hey Justin! Hold still!

Closing: We grab an infrared thermometer and find out!

{{comic discussion}}

Talk:1396: Actors

2014-07-18T08:03:22Z

Tier666:

Could be Bieber... 04:42, 18 July 2014 (UTC)
:Good point. [[User:Sjrsimac|Sjrsimac]] ([[User talk:Sjrsimac|talk]]) 04:48, 18 July 2014 (UTC)
:More likely Timberlake.[[Special:Contributions/108.162.246.207|108.162.246.207]] 06:48, 18 July 2014 (UTC)Nix
:It's referring to Justin Theroux, currently in ninth place on IMDB's Most Popular Males list. (http://www.imdb.com/search/name?gender=male) Yeah, I have no idea who he is either. I feel old. [[Special:Contributions/108.162.237.170|108.162.237.170]] 06:49, 18 July 2014 (UTC)
Do you think it's necessary to add that the temperature is in Fahrenheit, and that normal body temperature is around 98.6? The part about getting a bit of his shirt should also probably be explained in that context. [[Special:Contributions/173.245.56.211|173.245.56.211]] 05:39, 18 July 2014 (UTC)
:Yeah, please do. Most Americans can't handle metric units, and I can't handle Fahrenheit. The only thing I can remember is that body temperature is around 100°F. --[[Special:Contributions/108.162.254.59|108.162.254.59]] 07:26, 18 July 2014 (UTC)
:Inserted Fahrenheit and Celcius into the explanation...
:Compared Suns temp. to Xi Persei, inserted link to films about birds (them being the hottest warm-blooded creatures I know of) [[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 08:03, 18 July 2014 (UTC)

I seem to recall several other comics making fun of these generic headlines of the form "The <n> <adjective> <nouns> you must see". I could only find one though: http://xkcd.com/1283/ --[[Special:Contributions/141.101.104.95|141.101.104.95]] 07:40, 18 July 2014 (UTC)

Talk:1396: Actors

2014-07-18T07:51:27Z

Tier666:

Could be Bieber... 04:42, 18 July 2014 (UTC)
:Good point. [[User:Sjrsimac|Sjrsimac]] ([[User talk:Sjrsimac|talk]]) 04:48, 18 July 2014 (UTC)
:More likely Timberlake.[[Special:Contributions/108.162.246.207|108.162.246.207]] 06:48, 18 July 2014 (UTC)Nix
:It's referring to Justin Theroux, currently in ninth place on IMDB's Most Popular Males list. (http://www.imdb.com/search/name?gender=male) Yeah, I have no idea who he is either. I feel old. [[Special:Contributions/108.162.237.170|108.162.237.170]] 06:49, 18 July 2014 (UTC)
Do you think it's necessary to add that the temperature is in Fahrenheit, and that normal body temperature is around 98.6? The part about getting a bit of his shirt should also probably be explained in that context. [[Special:Contributions/173.245.56.211|173.245.56.211]] 05:39, 18 July 2014 (UTC)
:Yeah, please do. Most Americans can't handle metric units, and I can't handle Fahrenheit. The only thing I can remember is that body temperature is around 100°F. --[[Special:Contributions/108.162.254.59|108.162.254.59]] 07:26, 18 July 2014 (UTC)
:Inserted Fahrenheit and Celcius into the explanation...[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 07:51, 18 July 2014 (UTC)

I seem to recall several other comics making fun of these generic headlines of the form "The <n> <adjective> <nouns> you must see". I could only find one though: http://xkcd.com/1283/ --[[Special:Contributions/141.101.104.95|141.101.104.95]] 07:40, 18 July 2014 (UTC)