https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&user=141.101.77.56&feedformat=atomexplain xkcd - User contributions [en]2024-03-28T17:56:13ZUser contributionsMediaWiki 1.30.0https://www.explainxkcd.com/wiki/index.php?title=2298:_Coronavirus_Genome&diff=1912272298: Coronavirus Genome2020-04-25T14:48:31Z<p>141.101.77.56: /* Explanation */ RNA does not contain T</p>
<hr />
<div>{{comic<br />
| number = 2298<br />
| date = April 24, 2020<br />
| title = Coronavirus Genome<br />
| image = coronavirus_genome.png<br />
| titletext = Spellcheck has been great, but whoever figures out how to get grammar check to work is guaranteed a Nobel.<br />
}}<br />
<br />
==Explanation==<br />
{{incomplete|Created by a NOBEL IN SPELLCHECKING. Do NOT delete this tag too soon.}}<br />
This comic is another comic in a [[:Category:COVID-19|series of comics]] related to the {{w|2019–20 coronavirus outbreak|2020 pandemic}} of the {{w|coronavirus}} {{w|SARS-CoV-2}}, which causes {{w|COVID-19}}.<br />
<br />
[[Megan]] is a {{w|Genetics|geneticist}} doing research on the SARS-CoV-2 virus. She is analyzing the virus's {{w|genome}}, its genetic material composed of {{w|RNA}}. The genomic sequence can be represented as a list of {{w|nucleotide}} bases ({{w|guanine}}, {{w|adenine}}, {{w|cytosine}}, {{w|thymine}} and {{w|uracil}} - often abreveated as G, A, C, T, and U).<br />
<br />
The nucleotide sequence displayed currently finds an 100% match to six SARS-CoV-2 sequences in public databases, all of them originating from USA East Coast. The sequence is from nucleotides 26202-26280 of the virus genome and overlaps an unknown open reading frame/gene named ORF3a. One of the matching sequences is [https://www.ebi.ac.uk/ena/data/view/MT344963]. However, SARS-CoV-2 is an RNA-virus, and so its genetic material (not containing any DNA) would not include thymine (T) but would use uracil (U) instead. The sequence has been altered to resemble the more familiar codes of DNA. <br />
<br />
<br />
[[Cueball]] is surprised that she and her colleagues actually use {{w|Microsoft Notepad}}, a simple {{w|text editor}}, to look at the genome, instead of more modern technology. She explains that better research institutions use {{w|Microsoft Word}}, a more advanced editor, to allow additional formatting (such as '''bolding''' and ''italics''), and humorously calls this "{{w|epigenetics}}". In the real world, epigenetics is the study of changes that are not caused by changeing of nucleotides, but other chemical modifications to DNA and chromosomes that cause changes in patterns of gene expression and activation, often many generations down. This might be considered analogous to altering the meaning of a text by changing its formatting rather than the content; for example, content can be moved into parentheses or footnotes to be de-emphasized, or placed in bold and made large to attract attention and emphasize key points. Much as text can be wrapped in HTML tags or similar markup to change its formatting, nucleotides can be {{w|DNA methylation|methylated}} to prevent transcription, and the {{w|histone}}s around which DNA is wound can also be modified to promote or repress gene expression.<br />
<br />
The real punchline comes when Megan uses {{w|Spell checker|spellcheck}} to detect mutations in the genome by adding the previous genome to spellcheck and comparing them. Overall, Megan uses ridiculously and humorously crude methods to analyze a major genetic item. The genome of SARS-CoV-2 is almost 30,000 base-pairs long, which exceeds the {{w|longest words}} of any natural language by two orders of magnitude, and may exceed the capabilities of any available spell-checking program.<br />
<br />
The title text mentions {{w|Grammar checker|grammar checking}} and claims that whoever discovers how to use that to compare genomic material should be awarded a {{w|Nobel Prize}}. Spell-checking is analogous to comparing sequences to see their differences and similarities that is bread and butter of bioinformatics nowadays. Grammar checking would be analogous to being able to understand the chemical and biological function of a sequence straight from its nucleotides, something were unable to do at the moment except in very limited way and in a few and simple cases.<br />
<br />
==Transcript==<br />
{{incomplete transcript|Do NOT delete this tag too soon.}}<br />
<br />
:[Megan sits at a desk, working on a laptop. A genome sequence is displayed on her laptop screen, shown with a jagged line in a text bubble.]<br />
:Cueball (off-screen): So that's the coronavirus genome, huh?<br />
:Megan: It is!<br />
:Laptop: TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA<br />
<br />
:[Cueball walks up and stands behind Megan, still working on the laptop.]<br />
:Cueball: It's weird that you can just look at it in a text editor.<br />
:Megan: It's essential!<br />
:Megan: We geneticists do most of our work in Notepad.<br />
<br />
:[A frameless panel, Cueball still standing behind Megan.]<br />
:Cueball: Notepad?<br />
:Megan: Yup! Nicer labs use Word, which lets you change the genome font size and make nucleotides bold or italic.<br />
:Cueball: Ah, okay.<br />
:Megan: That extra formatting is called "epigenetics".<br />
<br />
:[A regular panel, Cueball still stands behind Megan. He has his hand on his chin.]<br />
:Cueball: Hey, why does that one have a red underline?<br />
:Megan: When we identify a virus, we add its genome to spellcheck. That's how we spot mutations.<br />
:Cueball: ''Clever!''<br />
<br />
{{comic discussion}}<br />
[[Category: Comics featuring Cueball]]<br />
[[Category: Comics featuring Megan]]<br />
[[Category: Biology]]<br />
[[Category:COVID-19]]</div>141.101.77.56https://www.explainxkcd.com/wiki/index.php?title=Talk:2098:_Magnetic_Pole&diff=168186Talk:2098: Magnetic Pole2019-01-16T11:45:17Z<p>141.101.77.56: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
GPS relies on satellites not the magnetic pole, so it wouldn't be affected.<br />
: I originally mentioned that modern GPS receivers like in smartphones may integrate the compass, gyro, and GPS to provide higher-quality location data using heuristics, which may get fouled-up if the pole moves too far, but I wrote it in too playful a manner and it has been deleted since. There was no citation anyway; it was just a vague memory. [[Special:Contributions/162.158.79.245|162.158.79.245]] 06:08, 15 January 2019 (UTC)<br />
<br />
So, GPS ''receivers'' don't need magnetic poles... but what about the GPS ''satellites''? GPS works being them transmitting their exact location, so they need so way of knowing what that is. [[User:JamesCurran|JamesCurran]] ([[User talk:JamesCurran|talk]]) 22:58, 14 January 2019 (UTC)<br />
<br />
I was wondering about that. Just added {{Citation needed}} to that and a couple of other alleged facts that should really be cited if true, and removed if not. [[Special:Contributions/108.162.216.208|108.162.216.208]] 20:35, 14 January 2019 (UTC)<br />
<br />
It was speculated that reversals were linked to mass extinctions. This would make the alt-text appear to be a bit blase - but " Statistical analysis shows no evidence for a correlation between reversals and extinctions." so it seems we will probably be OK.<br />
It does seem odd that GPS wouldn't be calibrated against fixed ground positions. [[User:Baldrickk|Baldrickk]] ([[User talk:Baldrickk|talk]]) 22:06, 14 January 2019 (UTC)<br />
<br />
I expect we'll be fine, but don't a lot of migratory critters use the Earth's magnetic field for navigation over very long distances? I mean, it's not as though they check a calendar and say, "Oh, hey, winter's coming, I guess I'd better head North." They just go in the direction they are 'programmed' to go when they start to feel the urge to do so. So... If the poles reverse (or whatever else) aren't they going to go the wrong direction? There are lots of other species that rely on those migratory species for their lunch. Yeah, I can imagine that there could be a lot of problems. Assuming, of course, that what I read about migratory species using the magnetic field of the Earth for navigation is true.[[Special:Contributions/162.158.79.143|162.158.79.143]] 02:39, 15 January 2019 (UTC)<br />
<br />
I don't believe any "location systems" depend on magnetic field for their accuracy, other than a magnetic compass. As noted above, GPS is calculated numerically from signals received from satellites, so the only effect the magnetic field could have on that is if it somehow disrupts the broadcast of the satellite radio signals. Similarly, LORAN calculates location based on radio signal, from towers on land. There are others as well, and I'm pretty sure none that depend on the location of the magnetic pole. GPS in general is not calibrated to fixed ground positions, but there are enhancements to GPS that do. But those still use radio broadcasts from towers whose locations are known, and don't need to take into account the location of magnetic north.<br />
[[User:Lnthomp|Lnthomp]] ([[User talk:Lnthomp|talk]]) 22:28, 14 January 2019 (UTC)<br />
<br />
I agree that the way it is currently phrased is misleading (to the point of being wrong), but some "location systems" use multiple factors to increase their accuracy. A good smartphone will use GPS together with signal strengths to wifi routers with known locations together with its compass to increase accuracy above that which it could obtain from GPS alone. I've only taken little glimpses into the issue professionally but if I were making an algorithm for such a thing I'd also use input from the accelerometers. In any event, I'd most certainly use the built-in compass. Cheap estimation of direction of travel. Of course I'm just being pedantic with all of that. The difference in accuracy for such a scenario would most likely be minor to the point that nobody would notice. I just kind of think the algorithms that try to combine all that sensor data are cool. --[[Special:Contributions/162.158.62.51|162.158.62.51]] 01:24, 15 January 2019 (UTC)<br />
:It's navigation systems rather than location/positioning systems that rely on magnetic field (although both are often combined). You need a compass to know which direction your are facing and how to go to your destination.[[Special:Contributions/141.101.104.11|141.101.104.11]] 11:32, 15 January 2019 (UTC)<br />
<br />
Granted no one has ever experienced and documented a magnetic reversal event, however, would it be possible for the magnetic flux to cause errors on magnetic media? (eg HDD, credit cards, floppies, cassette, VHS, etc) If it were a cause for alarm, would a faraday cage be useful in protecting against the effects? [[Special:Contributions/172.68.34.34|172.68.34.34]] 23:05, 14 January 2019 (UTC)<br />
: Faraday cages attenuate electric, not magnetic, fields. I think magnetic shielding involves thick, rounded material with high permeability such as iron, steel, mu-metal, often placed inside a faraday cage to prevent RF signals from saturating the permeability; never done it myself though. [[Special:Contributions/162.158.79.245|162.158.79.245]] 06:13, 15 January 2019 (UTC)<br />
<br />
No. Magnetic media would not be affected. Geomagnetic field strengths are orders of magnitude weaker than those used to write to magnetic media. --[[Special:Contributions/162.158.62.51|162.158.62.51]] 01:27, 15 January 2019 (UTC)<br />
<br />
The biggest issue during a magnetic pole reversal will be the loss of the Van Allen belt, frying all of us. [[User:RandalSchwartz|RandalSchwartz]] ([[User talk:RandalSchwartz|talk]]) 02:39, 15 January 2019 (UTC)<br />
:Unlikely to literally fry us, but there could definitely be damages on the electrical grids around the world as the magnetic field is weakened during the transition. Probably also a rise in radiation-induced cancers.[[Special:Contributions/141.101.104.11|141.101.104.11]] 11:32, 15 January 2019 (UTC).<br />
<br />
<br />
GPS and Solar weather [https://www.swpc.noaa.gov/impacts/space-weather-and-gps-systems citation ] - worth a read. Basically, the ionosphere disturbance from a changing Earth field (analogous to a changing solar wind) leads to notable inaccuracy and service disruption. [[Special:Contributions/108.162.221.167|108.162.221.167]] 23:12, 14 January 2019 (UTC)<br />
<br />
We'll have to renumber all our runways, which will be annoying. [[Special:Contributions/162.158.58.111|162.158.58.111]] 04:27, 15 January 2019 (UTC)<br />
:actually, several runways have already had to have been renumbered because of change in the magnetic poles.[[Special:Contributions/162.158.79.143|162.158.79.143]] 05:19, 15 January 2019 (UTC)<br />
<br />
Wait, "geomagnetic reversal in the next few decades"? Last I checked, it was scheduled to happen in the next few ''millennia''. Have there been new data? [[Special:Contributions/141.101.104.131|141.101.104.131]] 09:00, 15 January 2019 (UTC)<br />
:Reversals appear to happen randomly, so there's no way to know when the next one will happen. Even if the last one happened about 800 000 years ago, there have been periods of tens of millions of years without reversal.[[Special:Contributions/141.101.104.11|141.101.104.11]] 11:32, 15 January 2019 (UTC)<br />
::800 000 = 0. [[User:Lysdexia|Lysdexia]] ([[User talk:Lysdexia|talk]]) 16:08, 15 January 2019 (UTC)<br />
:::Not when the fields can reverse as often as 5 times in a million years.[[Special:Contributions/141.101.77.128|141.101.77.128]] 16:37, 15 January 2019 (UTC)<br />
:https://www.sciencedaily.com/releases/2012/10/121016084936.htm might shed some light on things. In any case, “scheduled” is definitely the wrong word. [[Special:Contributions/172.68.142.77|172.68.142.77]] 13:49, 15 January 2019 (UTC)<br />
<br />
What about the SOUTH magnetic pole?<br />
[[Special:Contributions/162.158.186.54|162.158.186.54]] 15:29, 15 January 2019 (UTC)<br />
<br />
We should mention the other comic with similar reaction: https://xkcd.com/2029/ [[Special:Contributions/141.101.77.56|141.101.77.56]] 11:45, 16 January 2019 (UTC)</div>141.101.77.56https://www.explainxkcd.com/wiki/index.php?title=Talk:2070:_Trig_Identities&diff=165743Talk:2070: Trig Identities2018-11-09T20:45:11Z<p>141.101.77.56: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
I am confused by the insect line. This seems to be true only if s=t.<br />
[[Special:Contributions/141.101.96.209|141.101.96.209]] 19:03, 9 November 2018 (UTC)<br />
<br />
:That one and the `cas` aren't making any sense to me. [[User:GreatBigDot|GreatBigDot]] ([[User talk:GreatBigDot|talk]]) 20:02, 9 November 2018 (UTC)<br />
::Oh, the casinus is much important to... What was it? --[[User:Dgbrt|Dgbrt]] ([[User talk:Dgbrt|talk]]) 20:15, 9 November 2018 (UTC)<br />
<br />
:I think insect is.. a bug.. ;) [[User:Smerriman|Smerriman]] ([[User talk:Smerriman|talk]]) 20:18, 9 November 2018 (UTC)<br />
<br />
Is Enchant at target a magic:the gathering reference? [[Special:Contributions/141.101.77.56|141.101.77.56]] 20:45, 9 November 2018 (UTC)</div>141.101.77.56https://www.explainxkcd.com/wiki/index.php?title=Talk:2067:_Challengers&diff=165111Talk:2067: Challengers2018-11-02T08:21:16Z<p>141.101.77.56: more comic</p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
''Calling it now'': lots of complaining about campaigning, by folks who prefer jokes. [[User:KangaroOS|Kangaro]][[User talk:KangaroOS|OS]] 06:25, 2 November 2018 (UTC)<br />
<br />
There are hidden comics. I've found three so far: <br />
Attack ad comic in north half of Texas. <br />
Ballot measure comic in north half of California. <br />
Gerrymandering comic in north half of Washington.<br />
IronyIsGood 06:16, 2 November 2018 (AEST) {{unsigned ip|108.162.249.184}}<br />
<br />
: Steve King comic in north-western Iowa<br />
: St Louis comic on the border of Missouri and Illinois {{unsigned ip|162.158.90.144}}<br />
: "Abigail Spanberger for Congress", just below Richmond, Virginia [[Special:Contributions/172.69.54.165|172.69.54.165]] 08:17, 2 November 2018 (UTC)<br />
: "Only Poll That Counts" comic on border of California and Nevada, South West of Las Vegas [[Special:Contributions/141.101.77.56|141.101.77.56]] 08:21, 2 November 2018 (UTC)</div>141.101.77.56https://www.explainxkcd.com/wiki/index.php?title=599:_Apocalypse&diff=164143599: Apocalypse2018-10-13T02:30:38Z<p>141.101.77.56: /* Transcript */</p>
<hr />
<div>{{comic<br />
| number = 599<br />
| date = June 19, 2009<br />
| title = Apocalypse<br />
| image = apocalypse.png<br />
| titletext = I wonder if I still have time to go shoot a short film with Kevin Bacon.<br />
}}<br />
<br />
== Explanation ==<br />
This comic begins with the beginning of the {{w|Apocalypse}}, hence the title. It is depicted, properly, with a very dystopian color picture with several yellow burning {{w|meteors}} striking down from the blood red sky, towards a black, red, orange and yellow ground. The way the panels are drawn below makes a transition from this dark image to a normal comic, with the first normal panel being superimposed on the dark image.<br />
<br />
In this image [[Beret Guy]] shouts out '''The apocalypse!''' And then he continues to explain what this will mean: ''The skies burn, the seas turn to blood, and the dead walk the earth!'' <br />
<br />
All three sentences are attributed to the apocalypse, but it seems that the first one about the sky burning, actually comes from a translation of one of {{w|Nostradamus}} predictions, which has among other been used to "{{w|Nostradamus_in_popular_culture#September_11.2C_2001|predict 9/11}}". In {{w|Revelation 16}} from the bible about the {{w|Seven bowls}}, which are a set of seven plagues of God's wrath poured over the wicked towards the Apocalypse, the {{w|Seven_bowls#Second_Bowl|second bowl}} describes that ''{{w|Revelation_16#Structure|The Sea Turns to Blood}}''. The {{w|Universal resurrection|resurrection of the dead}} is from the biblical version of the Apocalypse, the {{w|Last Judgment}}.<br />
<br />
After Beret Guy has announced this, he runs into [[Cueball]] who has heard part of this, but he is only interested in the last part and asks to check if he understood correctly that the dead will walk the earth. When this is confirmed Cueball becomes very busy.<br />
<br />
He runs to his office and quickly writes a scientific math paper, then runs as fast as he can to the math department and get his colleagues to sign it. Then he runs to a cemetery where the dead are rising, finds the one he searched for, and asks the resurrected {{w|zombie}} if he is Erdős. When confirmed that he is indeed Erdős, Cueball asks him to sign the math paper. <br />
<br />
{{w|Paul Erdős}} (26 March 1913 – 20 September 1996) was a Hungarian mathematician who (according to Wikipedia) published more papers than any other mathematician in history, working with hundreds of collaborators. His grave is in the Kozma Street Cemetery in Budapest.<br />
<br />
There is an in-joke developed among mathematicians called the {{w|Erdős number}} (similar to a Bacon number for film actors, referenced in the title text, see below). By definition, Erdős has an Erdős number of 0. Everyone who has co-written a mathematical paper with Erdős has an Erdős number of 1. Everyone who collaborated with them (but not Erdős himself) is assigned an Erdős number of 2. In general, if ''k'' is the minimal Erdős number of all the people you've written papers with, your Erdős number is ''k'' + 1. The Erdős number is the length of the shortest "chain" from you to Erdős.<br />
<br />
Thanks to collaboration between mathematicians and other researchers, many people in science and medical research now have Erdős numbers. Not everyone has an Erdős number, though; people without any chain linking them to Erdős have an undefined Erdős number. For example, most people who are not mathematicians or scientists do not have Erdős numbers. Nor do mathematicians and scientists whose publications were written by themselves only with no collaborators.<br />
<br />
By this trick Cueball thinks that he and his colleagues will now all have a an Erdős number of 1. The joke is that he would be using his last few hours in this life to write a math paper just to improve his and his friends' Erdős numbers.<br />
<br />
There are, however, many problems with his idea, even assuming the dead will walk the earth on that day. First of all, just having your name on a piece of paper with Erdős's signature does nothing for your Erdős number. It needs to be a {{w|Scientific_literature#Scientific_article|scientifically valid paper}}, published in a {{w|peer reviewed}} {{w|scientific journal}}. And given that the apocalypse is happening, there seems no time, chance or reason to publish any more math papers. <br />
<br />
Even if there were time, it would not count for much to have someone sign a math paper they haven't even read, let alone had anything to do with the actual writing and research. The same would be true for the other five mathematicians who signed it. But of course many papers have coauthors who did not do much more than work in the same department as the person who actually wrote the paper (a sad but true fact). Presumably Cueball's friends assume that nobody will investigate whether they, or Erdős, truly participated in the writing and research of Cueball's paper.<br />
<br />
Furthermore, even if it did count, they will not be able to take the paper with them into the afterlife, and thus since no one would have had time to read the paper, no one would know they had an Erdős number of 1. In the afterlife they could all say that they had such a number, but then again everyone else with such an interest could do the same, since no one could prove otherwise. Of course if you end up in the same part ({{w|Heaven}} or {{w|Hell}}) of the {{w|afterlife}} as Erdős he could confirm or deny the claim, but that would probably not help Cueball and his friends, since he could tell the truth about their paper. (Erdős was known for using an idiosyncratic set of slang terms, in which he described people who had stopped doing mathematics as having "died", whereas people who had died had "left".)<br />
<br />
That the whole comic is about the Erdős number, and not just Erdős signature, is made clear in the title text which refers to a similar (and less esoteric) meme called "{{w|Six Degrees of Kevin Bacon}}", or simply Bacon numbers. This time, the chain's center is actor {{w|Kevin Bacon}}, and the links are formed by two people appearing in the same movie. Unlike Erdős, Kevin Bacon is not dead, so those of you wishing to get a Bacon number of 1 still have a chance. <br />
<br />
In the title text Cueball thus wonders if there is still time for him to run on an make a short film with Kevin Bacon, now he has used so much time on improving his Erdős number. Again, if the film hasn't been shown to the public it would not count for anything...<br />
<br />
One of the mathematical scribbles appearing in panel 5 shows the square root of 163, which may be a reference to {{w|Ramanujan's constant}}.<br />
<br />
[[403: Convincing Pickup Line]] has a parody of the Erdős collaboration graph.<br />
<br />
Zombies are a [[:Category:Zombies|recurring theme]] in xkcd, particularly zombie scientists, which has also occurred both before with {{w|Richard Feynman}} in [[397: Unscientific]] and after with {{w|Marie Curie}} in [[896: Marie Curie]].<br />
<br />
==Transcript==<br />
:[The first panel is very large and shows a dark scene with one large meteor in front and four smaller in the background showering the darkened earth. They are all five black with yellow fire around them and a fire trail behind them, and all are flying from the top left corner and down towards right. The sky at the top is pitch black, but then the sky turns blood red under dark clouds. Two large mountain peaks, one almost pyramid shaped, are shown to the left and to the right there are two smaller peaks towards the distant horizon. The mountains and the ground around them are mainly black, but with red, orange and yellow streaks spread all over the black area beneath the mountain peaks, maybe indicating fire or lava, or reflections in water or blood. At the bottom right corner a normal white panel is superimposed on this apocalyptic image.]<br />
<br />
:[The smaller panel at the bottom of the first is halfway over the first panel, haflway below, and only to the right of the middle of the first panel. Beret Guy is running towards left, with his arms raised in the air.]<br />
:Beret Guy: The apocalypse! The skies burn, the seas turn to blood, and the dead walk the earth!<br />
<br />
:[From here a normal sequence of panels in three rows begin beneath the second panel. This leaves a gap between the apocalyptic panel and the first row of regular panels, on the left side where the 2nd panel did not reach over. In this panel Beret Guy (coming from the right) finds Cueball.]<br />
:Cueball: The dead what?<br />
:Beret Guy: Walk the earth!<br />
<br />
:[Cueball running right in a thin panel.]<br />
:Cueball: I have to go.<br />
<br />
:[Cueball sitting on a chair at a table scribbling vigorously and noisily with a pen on a paper. Mathematical symbols appear above Cueball's head, including a summation from i=0 to n, a logarithm of n and the square root of a number.]<br />
:<math>\sum_{i=0}^n i_k \frac1{i} \quad \log(n) \quad \sqrt{163}</math><br />
:''Scribble''<br />
:''Scribble''<br />
<br />
:[Cueball running right again, in a thin panel, pen and paper in hand.]<br />
<br />
:[Cueball opening door with label:]<br />
:Math Dept<br />
:Cueball: The dead return! <br />
:Cueball: Everyone, quick, get your names on here!<br />
<br />
:[Cueball stand on the left side of a table looking left over his shoulder. Five people are lining up to sign the paper lying on the right side of the table. The first who signs with a pen is Blondie, then in line follows Megan, a Cueball-like guy, Ponytail and another Cueball-like guy who stand with one hand to his chin looking right, away from the other.]<br />
:Blondie: At last!<br />
:Guy looking right: I hope there's time!<br />
<br />
:[Cueball running right in yet a thin panel, with pen and the paper flowing behind him.]<br />
<br />
:[Cueball walks right with the paper and pen in his hand as he arrives at at a cemetery as revealed by an old worn sign. Scary sounds appear off-panel right.]<br />
:Sign: Cemetery <br />
:Rising dead (off-panel): ''Hurrghhh''<br />
<br />
:[Cueball, still going right, arrives at a grave, pen in hand and the other hand almost outside the panel, but with a corner of the paper just visible. The grave has a large gravestone to the right and in front of it there is a Cueball-like guy rising up from the ground using his arms to push up on the base of the stone and the small pile of earth towards Cueball. The guy looks very worn, with dirt on his head and scratches on his cheek.]<br />
<br />
:[Cueball bends a little down and offers pen and paper to the raised dead man who looks up at him when he is addressed.]<br />
:Cueball: Paul Erdős?<br />
:Erdős: Yes?<br />
:Cueball: We need you to sign this.<br />
<br />
==Trivia==<br />
*This version of [[Blondie]] seems to be employed at a mathematical department on a university. It could thus also be [[Miss Lenhart]], but there is no proof that she is a teacher... <br />
<br />
{{Comic discussion}}<br />
<br />
[[Category:Comics with color]]<br />
[[Category:Comics featuring Beret Guy]]<br />
[[Category:Comics featuring Cueball]]<br />
[[Category:Comics featuring Blondie]] <br />
[[Category:Comics featuring Megan]]<br />
[[Category:Comics featuring Ponytail]]<br />
[[Category:Multiple Cueballs]]<br />
[[Category:Comics featuring real people]]<br />
[[Category:Math]]<br />
[[Category:Zombies]]</div>141.101.77.56https://www.explainxkcd.com/wiki/index.php?title=2055:_Bluetooth&diff=1636942055: Bluetooth2018-10-05T15:34:39Z<p>141.101.77.56: Fixed typos</p>
<hr />
<div>{{comic<br />
| number = 2055<br />
| date = October 5, 2018<br />
| title = Bluetooth<br />
| image = bluetooth.png<br />
| titletext = Bluetooth is actually named for the tenth-century Viking king Harald "Bluetooth" Gormsson, but the protocol developed by Harald was a wireless charging standard unrelated to the modern Bluetooth except by name.<br />
}}<br />
<br />
==Explanation==<br />
{{incomplete|Please edit the explanation below and only mention here why it isn't complete. Do NOT delete this tag too soon.}}<br />
<br />
==Transcript==<br />
{{incomplete transcript|Do NOT delete this tag too soon.}}<br />
<br />
[Cueball and White Hat are talking, Cueball is holding a cell phone and wireless headphones]<br />
<br />
Panel One<br />
<br />
:Cueball: I haven't used a wireless/Bluetooth thingy in like ten years. Is audio stuff still a nightmare?<br />
<br />
:White Hat: Nah, it's great now.<br />
<br />
Panel Two<br />
<br />
:White Hat: You tap devices together twice to link them and they flash in sync. (It pairs using accelerometer timing and sound.) Tap them three times to disconnect.―You can pair multiple inputs and outputs and it handels it smoothly.<br />
<br />
:Cueball (off screen): Nice!<br />
<br />
:White Hat: It just works. Sound comes from where you expect.<br />
<br />
:Cueball (off screen): Wonderful<br />
<br />
Panel Three<br />
<br />
:White Hat: Haha, just kidding, it's a nightmare.<br />
<br />
:Cueball: NOOOOOO!<br />
<br />
:White Hat: When i connect to my car, music starts blasting from my headphones while the car repeatedly plays a "NEW CONNECTION" chime.<br />
<br />
:Cueball: This is not what Josiah Bluetooth Intended!<br />
<br />
<br />
{{comic discussion}}</div>141.101.77.56https://www.explainxkcd.com/wiki/index.php?title=1783:_Emails&diff=1636321783: Emails2018-10-03T20:08:35Z<p>141.101.77.56: /* Explanation */</p>
<hr />
<div>{{comic<br />
| number = 1783<br />
| date = January 9, 2017<br />
| title = Emails<br />
| image = emails.png<br />
| titletext = Hey Rob, sorry it took me a while to get back to you! Sure, I'd love to see WALL-E opening weekend! Are you still doing that, or...?<br />
}}<br />
<br />
==Explanation==<br />
In this rather late [[:Category:New Year|New Year comic]] (January 9th), [[Megan]] asks [[Cueball]] if he has any {{w|New Year's resolution}}s. New Year's is, to many people, a time for thinking about the year and coming up with resolutions to improve themselves. These kind of resolutions {{w|New_Year's_resolution#Success_rate|hardly ever work}}.<br />
<br />
Cueball replies that he has one resolution. It's to finish reading and replying to his backlog of emails from 2008, 9 years prior to this comic. He obviously does not read his email when they arrive in his inbox, and he now vows to at least get those e-mails from 9 years ago read. <br />
<br />
As he further states in the caption below, he now (finally) begins to doubt his method for replying to e-mails, since his backlog now approaches 10 years. Some would probably say he should have found this out when his backlog approached 10 days, or at least when it reached a month.<br />
<br />
A common technique for some more productive or efficient users of email is to batch reply to email instead of replying to each one individually as they come. The principle is that setting aside specific times to reply instead of always being "on call" gives the messages the attention they deserve while avoiding the urge to constantly check your email when you should be doing important work. Such a technique could be to check and answer all your emails once a day, or once a week, for instance and allocating a specific amount of time like one hour every day to do so. It is unlikely that somebody would wait years to start the task of checking emails, so obviously the time reserved per unit of time is way too short, if even existing. This would create a backlog of emails, that could soon be so large it would take years to catch up to the e-mail you just got right now.<br />
<br />
Another technique for efficient people is ''not'' to answer certain e-mails; if a subject really is important, the sender will send a reminder a few days later. (If he does not, the sender can be presumed to have solved the problem himself, saving lots of time on the receiver's side. Of course then you have to check your e-mails to realize if someone has sent a reminder.) Cueball has possibly used this technique on a friend's request, but became remorseful after nine years.<br />
<br />
The title text is a reply to an email in which [[Rob]] wished to see the movie ''{{w|WALL-E}}'', a film that came out in 2008, with Cueball during its opening weekend. However, the opening weekend is now far in the past, and yet Cueball doesn't realize it and trails off with "are you still doing that, or...?" Mentioning the release of a popular movie and then making it clear that it will soon be ten years ago that the movie came out, feels a lot like a hidden [[:Category:Comics to make one feel old|comic to make one feel old]], but it may be stretching it to include this directly in that category. But it is a technique often used by [[Randall]], quite clearly in most of that category, for instance [[891: Movie Ages]].<br />
<br />
A real (and useful{{Citation needed}}) New Year's resolution would involve trying to answer his emails as they arrive (instead of spending any more time on years old emails), which would have avoided the mess he's currently in, and will stop it from getting worse in the future.<br />
<br />
In this comic Cueball may represent [[Randall]]. He receives so many e-mail due to the xkcd comic that he may have a hard time going through them all. Then there is his [[what if?]] email, and possibly many more. Hopefully he has a separate e-mail for friends that wish to send him a request for going to the opening of new recent movie. On the [http://www.xkcd.com/about/ about page] on xkcd he does write the following for one of the e-mails he cites as contact: <br />
:press @ xkcd.com -- Press questions, etc (may take a long time to get to me).<br />
<br />
==Transcript==<br />
:[Megan and Cueball are walking along.]<br />
:Megan: Did you have any New Year's Resolutions?<br />
:Cueball: Gonna finally finish dealing with those emails from 2008.<br />
<br />
:[Caption below the panel:] <br />
:As my email backlog approaches 10 years, I'm starting to have doubts about my approach.<br />
<br />
{{comic discussion}}<br />
<br />
[[Category:New Year]]<br />
[[Category:Comics featuring Cueball]]<br />
[[Category:Comics featuring Megan]]<br />
[[Category:Comics featuring Rob]] <!-- In the title text --><br />
[[Category:Email]]</div>141.101.77.56https://www.explainxkcd.com/wiki/index.php?title=Talk:1928:_Seven_Years&diff=149266Talk:1928: Seven Years2017-12-15T02:19:54Z<p>141.101.77.56: Undo revision 149261 by 162.158.74.9 (talk) I don't think deleting others comments sits well with anyone. Alas, medicine is a science too, so opinions about it can vary greatly.</p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
no... I'm not crying... [[User:Zazathebot|Zazathebot]] ([[User talk:Zazathebot|talk]])<br />
<br />
Liar [[Special:Contributions/172.68.34.34|172.68.34.34]] 20:13, 13 December 2017 (UTC)<br />
<br />
<br />
:([[Special:Contributions/162.158.58.105|162.158.58.105]] 23:04, 13 December 2017 (UTC)<br />
<br />
Do we know her name? [[User:Dogman15|Dogman15]] ([[User talk:Dogman15|talk]]) 00:34, 14 December 2017 (UTC)<br />
<br />
Should we remove the transcript incomplete mark? I know it's early, but I don't think it can be any better. [[Special:Contributions/162.158.166.233|162.158.166.233]] 02:25, 14 December 2017 (UTC)<br />
<br />
Is someone cutting onions here? I am almost close to tears soon.Boeing-787lover 08:10, 14 December 2017 (UTC)<br />
<br />
Why is my face leaking??? <sub>--[[User:Nialpxe|<span style="color: #000; text-decoration: none;">Nialpxe</span>]], 2017. [[User_talk:Nialpxe|<span style="color: #000; text-decoration: none;">(Arguments welcome)</span>]]</sub><br />
<br />
Yay life!<br />
[[Special:Contributions/162.158.178.183|162.158.178.183]] 11:27, 14 December 2017 (UTC)<br />
<br />
I love the phrasing "Panel 17: The sky has been brightened." I'm just commenting to preserve it from edits. [[Special:Contributions/198.41.230.52|198.41.230.52]] 13:22, 14 December 2017 (UTC)<br />
<br />
I feel it important to point out to anyone who may be looking at here and thinking about dealing with cancer...<br />
Chemotherapy and Radiology, '''Don't do it!'''. These were the best that science had about 20 years ago, but we've come much further since then. Immuno-oncology is less intensive, cheaper, and much more effective. Most of the developed world has quit using radiology and chemotherapy (which works by the very imprecise method of 'kill everything, good and bad, and hopefully kill more of the bad than the good'. Immuno-oncology works by creating specialized and personalized medicines that train your white blood cells to seek out and destroy the particular cancer cells, leaving all your good cells in tact and leaving you an immunity to that particular cancer. This knowledge won't be that much use to most of the developed world, but if you live in the U.S., it could save your life. (A few certain large companies who will go unnamed have been lobbying to prevent entry of new cancer solutions as they see chemo and radiotherapy as a cash cow and don't want their income stifled.) --[[User:Joshupetersen|Joshupetersen]] ([[User talk:Joshupetersen|talk]]) 18:33, 14 December 2017 (UTC)<br />
<br />
I don't want to take away anything from this very moving comic, but he does realize there's an eclipse or two <i>every</i> year, somewhere on the planet? Does the fear of cancer somehow limit them from ever leaving the US?<br />
<br />
God that's beatiful. [[Special:Contributions/162.158.91.17|162.158.91.17]] 20:39, 14 December 2017 (UTC)<br />
<br />
First off this is fantastic. As someone in the same situation, at the same part of the timeline, this rings so honest and true. The tree scene ... brilliant. Walking among beings for who a human lifespan is insignificant. Second. a hearty, contemptuous, giant F you to Joshupetersen. I can't stand conspiratorial know it alls like you. You think people in this situation don't know every single treatment that is out there? Every single immunotherapy drug in Cuba, every single clinical trial being run out of some backwater lab in China? There is no big pharma conspiracy. There is however a conspiracy called "evolution," which after several million years of practice ensures that cancer is one of the wiliest, most resilient killers out there. [[Special:Contributions/172.68.47.30|172.68.47.30]] 22:26, 14 December 2017 (UTC)Kaeleku<br />
<br />
I feel it important to point out to anyone who may be looking at here and thinking about dealing with cancer... talk with your trusted health care professional who knows your case, and is not only well aware of but well practiced in modern medicine. [[Special:Contributions/162.158.74.9|162.158.74.9]] 23:58, 14 December 2017 (UTC)</div>141.101.77.56