https://www.explainxkcd.com/wiki/api.php?action=feedcontributions&user=Cellocgw&feedformat=atomexplain xkcd - User contributions [en]2024-03-28T20:11:14ZUser contributionsMediaWiki 1.30.0https://www.explainxkcd.com/wiki/index.php?title=Talk:2392:_Cyber_Cafe&diff=202558Talk:2392: Cyber Cafe2020-12-01T12:31:59Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
Is it worth noting that this was posted on Cyber Monday? [[Special:Contributions/162.158.75.70|162.158.75.70]] 21:57, 30 November 2020 (UTC)<br />
:Yes! That's almost certainly relevant. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]])<br />
<br />
Unrelated to cybercafés, but why is the edit link the viewed-outside mauve instead of the viewed-wiki violet? <span style="font-family:Palatino,serif">[[User:Bubblegum|<span style="color:#00BFFF">bubblegum</span>]]-[[User_talk:Bubblegum|<span style="color:#BF7FFF">talk</span>]]|[[Special:Contributions/Bubblegum|<span style="color:#FF7FFF">contribs</span>]]</span> <span style="font-family:Palatino">04:13, 1 December 2020 (UTC)</span><br />
:Which edit link(s)? The 'faux tab' ("Read | Edit | View History", etc) the "*TITLE HEADER* (Edit)" or A.N.Other? Is it something specific to your own browser stylesheet? Or set by your Wikilogin? For me (simple IP as I am) the only links of different colours (passing over your own .sig, Bubblegum) are the Main page/Latest comic/Community portal/xkcd.com links in the sidebar((*)), and those are in the universal "visited page" hue (because I have visited these) and all other non-image link text are in the colour of universally standard yet-to-visit link colour that is probably the same as NCSA Mosaic originally established/adopted (though I don't know if that's because it's set by the wikicode/styles or fallen back to default). ((* - plus, now, the "add a comment!" link and also the cybersex one, as a random in-explanation link I tested going to while writing this reply.)) [[Special:Contributions/162.158.158.43|162.158.158.43]] 05:03, 1 December 2020 (UTC)<br />
"Cyber" is 'dated'? Well, I suppose it has been around as a popular term for a while, probably even before Gibson (and long-standing Internet Cafes 'round here now seem more to be rebranded as eSports hosts, because ''almost'' everyone who cares for one has an Internetted-device on their desk, kitchen table, maybe in their pocket, but a good well-maintained machine for the latest faddy FPSing or any satisfyingly tactile wheel/pedal controller seems to be what they can still offer up, almost arcadian...) but I don't think in the last thirty years I ever said "I'm in Cyber", even though I probably am by today's lingo (old fuddy-duddy as I am, I just say I work "in computing", if anybody has had to feign social interest in me to ask - and then reel off some of my actual sub-specialities if they foolishly indicate a desire to know more). Nor have I ever used such a café, in any capacity, but probably more from a "safe hex" standpoint (malware remediation and cracker-thwarting having been a big part of my career, for several years either side of the Millenium) than this year's issue with a certain non-software virus... [[Special:Contributions/162.158.158.43|162.158.158.43]] 05:03, 1 December 2020 (UTC)<br />
<br />
"this comic suggests that [cyber] sounds dated" Maybe that was so long ago that some people don't remember it. In the 90s, everything was cyber. The internet was "cyberspace". This weird, nerdy, futuristic thing. Then it became mainstream and the term mostly vanished. And since then "cyber" was very dated. It only stuck around in some words like "cyber cafe". [[Special:Contributions/162.158.94.186|162.158.94.186]] 11:32, 1 December 2020 (UTC)<br />
<br />
The UK Government still thinks 'cyber' is in use in 2020: https://www.standard.co.uk/news/uk/fatima-ballet-dancer-job-cyber-government-campaign-a4568641.html <br />
<br />
You young kids etc etc. First use of "cybernetics" is from "Cybernetics: Or Control and Communication in the Animal and the Machine is a book written by Norbert Wiener and published in 1948." (Wikipedia). First use of "cyborg" is from 1960 , Manfred Clynes and Nathan S. Kline. Pretty much all compound "Cyber-$NOUN" words derive from "cybernetics." [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 12:31, 1 December 2020 (UTC)<br />
[[Special:Contributions/141.101.98.158|141.101.98.158]] 11:47, 1 December 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2389:_Unread&diff=202275Talk:2389: Unread2020-11-24T11:37:29Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
I have 27,333 unread emails. On the level of "Your email is important to me. Please wait and it'll get read eventually." [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 00:25, 24 November 2020 (UTC)<br />
<br />
Oh hai! https://i.imgur.com/FXt1AYq.png lol [[Special:Contributions/172.68.142.195|172.68.142.195]] 10:17, 24 November 2020 (UTC)<br />
<br />
This graph seems way off to me. It says 'percentage of messages', so the highest point should be at the far left. At some point, you will have a single message saying "Welcome to WhateverMessagingService", which will initially be unread, therefore 100%. When he's standing at the beginning looking at the icon that says 2 messages, that's probably 2 out of 3, or 2 out of 4. It could be back up at 100% depending on the service (does it auto-delete read notifications?), but it's likely lower than at the start. But for the first few weeks, I'd expect to see a series of tall peaks, gradually getting lower as the number of old read messages slowly increases, with flat valleys inbetween where everything is read. Then as you get into the habit of putting off reading them, the valleys start getting shallower until they swallow the peaks, and you get a slowly rising curve that eventually levels off pretty high.<br />
This graph seems to rise forever at the end, which makes sense for a graph of the ''number'' of messages, but not for a ''percentage''. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 11:34, 24 November 2020 (UTC) <br />
<br />
<br />
Which is why everyone needs filters for sub-mailboxes. Of those 27,333 , 27 000 go into the "IgnoreThisCrap" mailbox, 300 go into "Respond by the end of the next Sprint," and 33 remain as candidates for reading maybe after lunch. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 11:36, 24 November 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2389:_Unread&diff=202274Talk:2389: Unread2020-11-24T11:36:55Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
I have 27,333 unread emails. On the level of "Your email is important to me. Please wait and it'll get read eventually." [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 00:25, 24 November 2020 (UTC)<br />
<br />
Oh hai! https://i.imgur.com/FXt1AYq.png lol [[Special:Contributions/172.68.142.195|172.68.142.195]] 10:17, 24 November 2020 (UTC)<br />
<br />
This graph seems way off to me. It says 'percentage of messages', so the highest point should be at the far left. At some point, you will have a single message saying "Welcome to WhateverMessagingService", which will initially be unread, therefore 100%. When he's standing at the beginning looking at the icon that says 2 messages, that's probably 2 out of 3, or 2 out of 4. It could be back up at 100% depending on the service (does it auto-delete read notifications?), but it's likely lower than at the start. But for the first few weeks, I'd expect to see a series of tall peaks, gradually getting lower as the number of old read messages slowly increases, with flat valleys inbetween where everything is read. Then as you get into the habit of putting off reading them, the valleys start getting shallower until they swallow the peaks, and you get a slowly rising curve that eventually levels off pretty high.<br />
This graph seems to rise forever at the end, which makes sense for a graph of the ''number'' of messages, but not for a ''percentage''. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 11:34, 24 November 2020 (UTC)<br />
Which is why everyone needs filters for sub-mailboxes. Of those 27,333 , 27 000 go into the "IgnoreThisCrap" mailbox, 300 go into "Respond by the end of the next Sprint," and 33 remain as candidates for reading maybe after lunch. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 11:36, 24 November 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2388:_Viral_Quiz_Identity_Theft&diff=202236Talk:2388: Viral Quiz Identity Theft2020-11-23T16:27:52Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
I was going to add in the old, old example of constructing your 'pornstar name' of first pet's name and (road you grew up on|mother's maiden name), but I see there's no real agreement which of the latter it is when I wanted to get it straight for editing in. MMN is probably better for "security question" purposes, but it predates The Eternal September anyway, before which it was more a party-thing rather than a security threat against BBS/Usenet/mailing-list users. [[Special:Contributions/162.158.159.132|162.158.159.132]] 00:57, 21 November 2020 (UTC) (a.k.a. Frazier Derwent)<br />
: I briefly googled 'eternal september' and found it was a date when internet dialogue was swamped by new users. How did this relate to security questions? [[Special:Contributions/108.162.219.248|108.162.219.248]] 12:08, 21 November 2020 (UTC)<br />
:: It's a reasonable lower limit on when internet commerce became 'a thing' (and a large enough pool of potential marks, with everyday household access and not institution/corporate, to make it a profitable scattergun tactic). Though I'd have said a little bit later myself, there was no such obvious spike in potentially naive users as lucrative targets such as online banking started to be a thing. (And attack vectors tended towards things like malware-based login-scrapers in that era, in my experience.) Prior to then, though, any spear-phishing (not yet known by that name) would have been unlikely to have been achieved through the Porn-name Game, online, though perhaps it'll have been taken advantage of if brought up as an entertainment/ice-breaker at a physical social gathering, for traditional 'meatspace' fraud and personation crime, opportunistically. [[Special:Contributions/162.158.154.83|162.158.154.83]] 15:21, 21 November 2020 (UTC)<br />
<br />
Hairy tries to do something only to find that Black Hat did it far more efficiently - https://xkcd.com/1027/<br />
<br />
Hmm... what exactly is the purpose/meaning of this sentence?<br />
<br />
<blockquote>Even though White Hat is correct that there are public databases with lists of legal names and addresses, lots of online interactions take place in forums where people adopt pseudonyms.</blockquote><br />
<br />
I understand that the second part has to do with a strategy for doxing, which is fine, but why would it be appendaged to White Hat's strategy like that (and especially with an 'even though')? The entire paragraph following is just a description of how one could use this to attack the participant, but the whole point of the comic was to show that a brief Google search could give you the same results. If anyone could clear that up, it would be helpful. [[User:BlackHat|BlackHat]] ([[User talk:BlackHat|talk]]) 13:44, 22 November 2020 (UTC)<br />
: As you mentioned, White Hat's basic argument is there are already public databases of names and addresses. If that's all the information Hairy needs, then Hairy's more elaborate scheme is unnecessary. The quote you mention is a counterargument to White Hat's point: If Hairy is actually trying to steal the identity of some *specific* online users and all Hairy knows is a pseudonymous username like e.g. turnitup91, then Hairy can't find out anything more about them from the public databases alone. Hairy's more elaborate scheme may actually make sense in such a case.<br />
:<br />
: And that's the purpose of the quote: Even though White Hat is correct about the public databases, that's not enough if you're trying to de-anonymize someone specific and all you have is a pseudonym. [[User:Gertuviti|Gertuviti]] ([[User talk:Gertuviti|talk]]) 15:53, 22 November 2020 (UTC) <br />
Folks: do a little Googling. 420 69th, New York is the address of "The Church of the Dildo Dude" [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 16:27, 23 November 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2379:_Probability_Comparisons&diff=201033Talk:2379: Probability Comparisons2020-11-02T14:08:54Z<p>Cellocgw: /* Free Throw meaning */</p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
(Sidenote: for the 88% entry in the comic, "outside" is misspelled as "outide" as of the current moment.)<br />
<br />
What's the best way to organize the explanations for this comic, when they begin to be added? By the order they're listed in the comic? That seems inefficient, since presumably many of the entries can be answered as a group by a single explanation. If they should be grouped, how should they be grouped? --[[User:V2Blast|V2Blast]] ([[User talk:V2Blast|talk]]) 03:59, 31 October 2020 (UTC)<br />
: The table I added is sortable. You could add a "type" column of some sort and users could sort by that if they want. [[User:Captain Video|Captain Video]] ([[User talk:Captain Video|talk]]) 04:42, 31 October 2020 (UTC)<br />
There's a discrepancy between the version here and the current official version. Here, 0.2% has the red M&Ms thing paired with the odds of drawing a flush in poker ("you draw 5 cards and they're all the same suit"); the official version has it with "You draw 2 random Scrabble tiles and get M and M." Here, the latter piece of information is at 0.1%, and there the 0.1% item is "Three randomly chosen people are all left-handed." I'm guessing we have an old version of the page? [[User:Captain Video|Captain Video]] ([[User talk:Captain Video|talk]]) 06:03, 31 October 2020 (UTC)<br />
: Updated. [[User:Natg19|Natg19]] ([[User talk:Natg19|talk]]) 08:29, 31 October 2020 (UTC)<br />
:: Cool, thanks. [[User:Captain Video|Captain Video]] ([[User talk:Captain Video|talk]]) 01:22, 1 November 2020 (UTC)<br />
<br />
Wouldn't the Lord of the rings one be, technically, 67%, since 66.6666666... rounds to 67%, not 66? Also, we should really add a better comment interface. [[User:BarnZarn|BarnZarn]] ([[User talk:BarnZarn|talk]]) 06:28, 31 October 2020 (UTC)<br />
: The same goes for the next entry, imho, since LOTR-one is 2 out of 3 movies and the dice rolls are 4 out of 6, which comes down to the exact same percentage.<br />
<br />
Hooray, xkcd is finally xkcd again! For the last fifty strips it’s basically been lighter SMBC. Yay Randall! <br />
<br />
Also, if anyone wants to read something very English and very horrible, https://endicottstudio.typepad.com/poetrylist/the-white-road-by-neil-gaiman.html. [[User:Lightcaller|Lightcaller]] ([[User talk:Lightcaller|talk]]) 07:21, 31 October 2020 (UTC)<br />
<br />
I have to think the second to last is off. First, what is meant by "just been"? Minutes, hours, days? Second, does anyone know the correct number of 10-digit phone numbers that are answered by people named "Barack Obama" (as pronounced, not spelled)? I remember that Obama had a cell, and including the phones in his office and his bedroom (separate #'s), so during his term, that's at least 3. [[User:SDSpivey|SDSpivey]] ([[User talk:SDSpivey|talk]]) 15:50, 31 October 2020 (UTC)<br />
:first of all, this is no longer his term, so the number of phone numbers he has nowadays might be different. Also, the scenario requires him to pick up the phone, and he probably wouldn't simultaneously be available to pick up a phone in both his office and bedroom, and unless it's a cell phone, only a fraction of the time would he be there. Also, like many people, he might not answer calls from unknown numbers, or he may have a secretary or someone screening his calls. Judging from the following line though, the calculations used here probably just used 1 in 10 billion for that value, leaving only the "just been an 8.0 earthquake in Calfornia" part.--[[Special:Contributions/108.162.216.124|108.162.216.124]] 09:12, 1 November 2020 (UTC)<br />
<br />
:Isn't the second to last entry really just a sneaky way of listing the probability of a magnitude 8 earthquake having just occurred in California? The entry says nothing about Barack Obama actually answering the phone, nor even that the number dialed being Barack Obama's. If agreed, then can the explanation in the table be updated? If disagreeing, then I'd appreciate you pointing out where I'm in error.<br />
<br />
:Could Obama's phone number be referring to when he Tweeted a phone number to text him at in late September[https://twitter.com/BarackObama/status/1308769164190941187]? And so the chance of it being the correct number is much higher? [[User:B. A. Beder|B. A. Beder]] ([[User talk:B. A. Beder|talk]]) 01:09, 2 November 2020 (UTC)<br />
<br />
guys i have never edited the transcript section im scared.<span> — [[User:Sqrt-1|The <b>𝗦𝗾𝗿𝘁-𝟭</b>]] <sup>[[User talk:Sqrt-1|<span style="color: blue">talk</span>]] [[Special:Contributions/Sqrt-1|<span style="color: blue">stalk</span>]]</sup></span> 16:36, 31 October 2020 (UTC)<br />
:This comic has so many American jokes and brands I can't understand this... I found this from [https://math.stackexchange.com/questions/1263600/probability-of-picking-up-two-mms-of-same-color-randomly mathematics stack exchange] and that helped me understand what this M&M stuff is...<span> — [[User:Sqrt-1|The <b>𝗦𝗾𝗿𝘁-𝟭</b>]] <sup>[[User talk:Sqrt-1|<span style="color: blue">talk</span>]] [[Special:Contributions/Sqrt-1|<span style="color: blue">stalk</span>]]</sup></span> 16:39, 31 October 2020 (UTC)<br />
::Alright, I if the only colours are red green and blue how can there be fucking yellow or brown godammit I give up someone else do this shit AHAHAHA<span> — [[User:Sqrt-1|The <b>𝗦𝗾𝗿𝘁-𝟭</b>]] <sup>[[User talk:Sqrt-1|<span style="color: blue">talk</span>]] [[Special:Contributions/Sqrt-1|<span style="color: blue">stalk</span>]]</sup></span> 16:45, 31 October 2020 (UTC)<br />
:::There are currently 6 colors, blue, red, brown, yellow, green and orange. Each comes in different ratios, for some reason. If there were all the same ratio, then getting 2 that are both red would be 1/36=2.777%, so red is below average. [[User:SDSpivey|SDSpivey]] ([[User talk:SDSpivey|talk]]) 00:58, 1 November 2020 (UTC)<br />
::::The colors used to be different a number of years ago. I forget what year, but they had a contest for people to vote on a new M&M flavor. They had people vote between blue, pink, and purple. I guess blue won as both pink and purple are considered girly colors and blue is considered manly, but the presencee of two girly colors split the vote for that. At the same time they got rid of there having used to be light brown M&Ms, and for a while they had commercials with blue M&Ms singing the blues. Anyway, I also read speculation the reason some colors are more common is they put less of the ones where the dye they use is more expensive, though I'm not sure if that's accurate.--[[Special:Contributions/108.162.216.124|108.162.216.124]] 09:07, 1 November 2020 (UTC)<br />
<br />
I don't understand the "You share a birthday with two US Senators" as being 4%. If there is only one pair of U.S. Senators with the same birthday, then your chance of sharing a birthday with them would be 1/365 (~0.27%). --[[Special:Contributions/162.158.74.143|162.158.74.143]] 20:25, 31 October 2020 (UTC)<br />
:I'm not certain of the math offhand, but it is the odds of randomly sharing a birthday with 2 out of 100 Senators. Not that just a pair shares one with you. Although all this birthday talk ignores Feb 29 births. [[User:SDSpivey|SDSpivey]] ([[User talk:SDSpivey|talk]]) 00:58, 1 November 2020 (UTC)<br />
::I just noticed the note about there being 9 days that have a pair of Senators sharing a birthday. Does the 4% take that into consideration? [[User:SDSpivey|SDSpivey]] ([[User talk:SDSpivey|talk]]) 01:08, 1 November 2020 (UTC)<br />
:::It's been updated to say that there are 15 days that have at least 2 Senators who share a birthday. That would make the probability (15/365.25), or 4.1%, so Randall is correct. (Using 365.25 to account for Feb. 29 births.) --[[Special:Contributions/162.158.74.55|162.158.74.55]] 03:57, 2 November 2020 (UTC)<br />
<br />
Um... in the Trivia section, someone wrote:<br />
<br />
"the 67% probability of rolling at least a 3 with a D6 is correct. "At least a 3" means a 3, 4, 5, or 6."<br />
<br />
Four out of six is ~67%, right? Please don't tell me I've forgotten basic maths. I'm going to delete that section, but feel free to add it back in if I'm just being an idiot. [[User:BlackHat|BlackHat]] ([[User talk:BlackHat|talk]]) 22:28, 31 October 2020 (UTC)<br />
<br />
The explanation for the Social Security Number is wrong- it should be that there are ten possible digits for each of the four digits you're trying to guess. The number of digits in a SSN doesn't matter since the comic specifies you're only guessing the last four. [[User:Duraludon|Duraludon]] ([[User talk:Duraludon|talk]]) 00:59, 1 November 2020 (UTC)<br />
:In addition, there are no valid SSN's with any group as all zeros, so there are only 9999 valid numbers to guess at. Still close enough to .01% [[User:SDSpivey|SDSpivey]] ([[User talk:SDSpivey|talk]]) 13:21, 1 November 2020 (UTC)<br />
<br />
XKCD comics are getting later and later in the (American) day. This one was posted Sunday the 1st, from the point of view of us Aussies. [[Special:Contributions/162.158.119.159|162.158.119.159]] 01:40, 1 November 2020 (UTC)<br />
<br />
== 2/3 = both 66% and 67%? ==<br />
<br />
I get picking either 66% or 67% as a rounding for 2/3 but to have one of each?? Is there any actual reason for this?<br />
<br />
<blockquote>66% A randomly chosen movie from the main Lord of the Rings trilogy has “of the” in the title twice<br/>67% You roll at least a 3 with a d6</blockquote><br />
<br />
[[Special:Contributions/162.158.79.152|162.158.79.152]] 21:40, 31 October 2020 (UTC)<br />
<br />
I wonder what time frame he meant for there "just" having been an earthquake in California.--[[Special:Contributions/108.162.216.124|108.162.216.124]] 09:03, 1 November 2020 (UTC)<br />
<br />
<br />
Angus King is from Maine, that’s ME not MN. [[Special:Contributions/108.162.219.200|108.162.219.200]] 14:43, 1 November 2020 (UTC)<br />
<br />
== Do we do calculus? ==<br />
<br />
I think I've got how Randall did the birthday party/free-throw calculations, but it's kind of math-intensive. How much should I put in the explanation column? It's quite easier to explain with summations, but that requires a lot of background to someone who doesn't know calculus (i.e., probably a lot of people who read this). Should I forego the sum entirely? Should I say "the proof is by magic"? Also, at least some of this is stemming from the fact that I have no clue how one would insert a summation sigma into the editing, and I'm too afraid to try it. I'll write it with a bunch of plus signs (basically a sum, but longhand notation) until somebody decides to step in and clean it up. [[User:BlackHat|BlackHat]] ([[User talk:BlackHat|talk]]) 18:05, 1 November 2020 (UTC)<br />
<br />
== Let's talk M&Ms ==<br />
<br />
I'm beginning to think Randall is nerd-sniping us, because none of the values for M&M colours seem to line up with his source. The easiest example to demonstrate is '77% : An M&M is not blue'. '''Nowhere in the article is there a value which rounds to 23% for blue M&Ms.''' Most of the other calculations also seem to have small-scale differences, and a few have differences so big only using the 95% confidence interval values help. Can anybody figure out his line of reasoning with this? [[User:BlackHat|BlackHat]] ([[User talk:BlackHat|talk]]) 19:12, 1 November 2020 (UTC)<br />
:You have to remember that 87% of all stats are made up. [[User:SDSpivey|SDSpivey]] ([[User talk:SDSpivey|talk]]) 21:24, 1 November 2020 (UTC)<br />
:The source in question does show about 23% for blue M&Ms. In 2008: 24%. In 2017, Cleveland plant: 20.7%, Hackettstown plant: 25% (average 22.85%, assuming both factories produce the same volume).[[Special:Contributions/108.162.229.54|108.162.229.54]] 13:55, 2 November 2020 (UTC)<br />
<br />
== Hemispheres and Seasons ==<br />
<br />
Should there be a note of the fact that the summer/winter percentages are only true in the northern hemisphere? In the southern hemisphere, where summer is December-February and winter is June-August, the figures should be reversed (and at the equator, summer and winter don't really exist). [[Special:Contributions/172.68.86.114|172.68.86.114]] 21:49, 1 November 2020 (UTC)<br />
:I'm not entirely sure ''which'' season boundaries are being espoused. Equinox/Solstice ones (summer starts on "mid-summer's day", ''sic''), mid-way between adjacent equinoces/solstices (mid-summer's day ''is'' exactly half way through summer), meteorlogical (groupings of three calendar months)..? I suspect the latter, to provide the off-quarter values from almost continually variable month-lengths, but the other two (in conjunction with the elliptical orbit of the Earth changing the rate each phase of oscillation made by the ecliptic) would be a far more scientific reason worthy of Randall. [[Special:Contributions/162.158.155.102|162.158.155.102]] 02:47, 2 November 2020 (UTC)<br />
<br />
== Obama earthquake probability ==<br />
<br />
I'm was thinking about the second-to-last probability. This should be Pr[call Obama] * Pr[Magnitude 8 earthquake "just" occured in CA] = 5e-18.<br />
* From the phrasing we assume 10-digit numbers are dialed randomly, giving Pr[call Obama] = 1e-10<br />
* From the previous quake we know Pr[CA quake/year] = 2e-3<br />
* The time period for "just occurred" is not defined.<br />
* SDSpivey points out there is some ambiguity with the number of phones Obama has and whether to include the probability of him answering personally<br />
<br />
If we assume Obama answers a single phone number than the time period would be 5e-18/(1e-10 * 2e-3) = 2.5e-5 years = 13 minutes.<br />
<br />
It seems likely that a 15 min period was considered for "just occurred", which would be within rounding error of the quake probability.<br />
--[[User:Quantum7|Quantum7]] ([[User talk:Quantum7|talk]]) 09:59, 2 November 2020 (UTC)<br />
<br />
== Free Throw meaning ==<br />
<br />
Hi! Would it be possible to add an explanation as to what a free throw is, for the benefit of those of us who know nothing about basketball? Thanks! [[Special:Contributions/162.158.158.183|162.158.158.183]] 13:03, 2 November 2020 (UTC)<br />
Sure: when one of a number of transgressions of the rules occurs (a "foul"), depending on about 17 other variables, the player who was fouled is allowed to stand at a special line called the "Free-throw line" and take either one or two shots at the basket without anyone guarding him. Free throws only count one point, as opposed to baskets made during play which are 2 points (or 3 points outside yet another circular arc some distance from the goal).</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2371:_Election_Screen_Time&diff=199673Talk:2371: Election Screen Time2020-10-14T11:34:53Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
I think there should be a screen time category - there seems to be a lot of comics with this trend <span style="background-image: -webkit-linear-gradient(left, grey, white); border-radius: 5px; font-family:cursive; color: blue;"><i><b>-[[User:Donthaveusername|Donthaveusername]]</b></i><sup>[[User talk:Donthaveusername|talk]]</sup></span><br />
<br />
The title text seems like a reference to the movie {{w|Airplane!}} [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 00:19, 13 October 2020 (UTC)<br />
: I'm not finding the connection, although I'm not familiar with the movie. Could you please explain? [[User:Nk1406|Nk1406]] ([[User talk:Nk1406|talk]]) 02:13, 13 October 2020 (UTC)<br />
::”I picked the wrong day to stop sniffing glue”<br />
"GETTING INTO POINTLESS ARGUMENTS WITH PEOPLE YOU DON'T KNOW: 17h 23m"<br />
:Reminding people to sign their posts: 25h 58m [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 08:39, 13 October 2020 (UTC)<br />
It's probably worth knowing about the fake collecting boxes for ballots. Robert Carnegie rja.carnegie@excite.com [[Special:Contributions/162.158.154.215|162.158.154.215]] 09:56, 13 October 2020 (UTC)<br />
:You're referring to the California Republicans' "unofficial ballot boxes"? Worth knowing about, yes, though I don't see any ''particular'' relevance to the comic. [[User:BunsenH|BunsenH]] ([[User talk:BunsenH|talk]]) 15:33, 13 October 2020 (UTC)<br />
<br />
Seems to me that the transcript should be text-only: "[Short blue bar-chart bar]", or something like that, rather than an actual graphic bar. No? [[User:BunsenH|BunsenH]] ([[User talk:BunsenH|talk]]) 15:02, 13 October 2020 (UTC)<br />
:Agreed. Text describing their relative size would be good too. <br />
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 17:48, 13 October 2020 (UTC) <br />
<br />
'''Write in the candidate you want.''' <br />
That is all. <br />
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 17:48, 13 October 2020 (UTC)<br />
<br />
Coincidentally, or maybe not, https://www.smbc-comics.com/comic/salt [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 11:34, 14 October 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2352:_Synonym_Date&diff=196616Talk:2352: Synonym Date2020-08-31T13:09:14Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
"This explanation may be incomplete or incorrect: Created by an AUTOMATON." That's funny. [[Special:Contributions/172.69.170.50|172.69.170.50]] 01:23, 29 August 2020 (UTC)<br />
:Yeah, there's one on a lot of them and nobody's ever bothered removing them. <span style="font-family:Palatino,serif">[[User:Bubblegum|<span style="color:#00BFFF">bubblegum</span>]]-[[User_talk:Bubblegum|<span style="color:#BF7FFF">talk</span>]]|[[Special:Contributions/Bubblegum|<span style="color:#FF7FFF">contribs</span>]]</span> <span style="font-family:Palatino">01:39, 29 August 2020 (UTC)</span><br />
::"Do NOT kill this warning before it is ready to die" is especially good. [[User:Captain Video|Captain Video]] ([[User talk:Captain Video|talk]]) 05:38, 29 August 2020 (UTC)<br />
:::Do not mistake Synonym for Verbaciousness. A single ''technically'' correct but ''contextually'' dubious word (I suppose the original BOT->AUTOMATON counts) is what it should be. Merely verbosifying an antilaconic and/or polysyllaballic interwoven sentencial restructurisation is very much akin to being ballistically off-target vis-a-vis the inherent humour theme. (i.e. missing the joke.) [[Special:Contributions/141.101.98.70|141.101.98.70]] 10:12, 29 August 2020 (UTC)<br />
<br />
I feel like this is not Megan, but a new character, differentiated by her wearing a dress (which also makes her seem almost strange compared to the others). [[Special:Contributions/173.245.54.75|173.245.54.75]] 06:17, 29 August 2020 (UTC)<br />
:Come on, can't a gal wear a dress without turning into a completely new person? I think she looks cute in that outfit! [[Special:Contributions/172.69.34.214|172.69.34.214]] 07:23, 29 August 2020 (UTC)<br />
<br />
Is grub meant to disgust, or is she merely British and using a perfectly normal word for food in use since 1691.The captcha asked me to click on crosswalks, but all I could seee were Zebra crossings. [[Special:Contributions/162.158.155.108|162.158.155.108]] 07:58, 29 August 2020 (UTC)<br />
:I cannot begin to explain the cascade of confusion and misunderstanding created by having first read The Hitchhiker's Guide to the Galaxy in a UK edition rather than a US edition where the words, "zebra crossing," are replaced by, "crosswalk." Being quite young I thought the idea of zebra crossings must be analogous to deer crossings that exist all over US roads but, perhaps, was a reference to human evolution in Africa and, given Adams's quite loose restrictions on temporal effects, that the 'cleverness' of the human species had echoed back in time and destroyed itself before the cleverness ever took place. In theory, if not in practice. Only because the proof of the non-existence of God due to the existence of the Babelfish wasn't universally accepted was the human species saved. Funny how a colorful expression changes things, in'it?[[Special:Contributions/162.158.79.107|162.158.79.107]] 13:03, 29 August 2020 (UTC)<br />
<br />
We also have other species pelican, puffin, toucan (pedestrian and cycle) and pegasus crossings, the last for those riding horses. Panda crossings are extinct. [[Special:Contributions/162.158.158.197|162.158.158.197]] 22:42, 29 August 2020 (UTC)<br />
<br />
As a member of the Facebook Group "Dr. Anna vs. Danger," I can guarantee that many MANY people would find this woman's approach to language very hot indeed. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 13:09, 31 August 2020 (UTC)<br />
<br />
Isn't Megan just overly using British English expressions, which is misinterpreted as being weird on purpose? [[Special:Contributions/108.162.229.6|108.162.229.6]] 15:02, 29 August 2020 (UTC)<br />
:Maybe, given the dress, but [[1132|I'll bet you $50 she isn't.]] <span style="font-family:Palatino,serif">[[User:Bubblegum|<span style="color:#00BFFF">bubblegum</span>]]-[[User_talk:Bubblegum|<span style="color:#BF7FFF">talk</span>]]|[[Special:Contributions/Bubblegum|<span style="color:#FF7FFF">contribs</span>]]</span> <span style="font-family:Palatino">03:07, 30 August 2020 (UTC)</span><br />
<br />
Clearly, Randall has been watching the most recent episode of Star Trek - Lower Decks (released this Thursday). "Moist" is the word most commonly observed to be found unpleasant, & he just used two synonyms for it in a joke about unsettling phrasings, entitled Synonyms. Moist was right in the ''title'' of the most recent episode.<br />
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 20:02, 29 August 2020 (UTC)<br />
<br />
I think I am in love.[[Special:Contributions/141.101.98.70|141.101.98.70]] 08:27, 30 August 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2351:_Standard_Model_Changes&diff=196505Talk:2351: Standard Model Changes2020-08-27T10:04:39Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
Re: "but for the most part [the changes] are nonsensical"<br />
I find the symbol changes pretty compelling, actually. Much clearer :)<br />
[[Special:Contributions/172.69.34.210|172.69.34.210]] 00:05, 27 August 2020 (UTC) Related: I was going to respond to Randall here with Talking Heads' "Stop Making Sense" :=) [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 10:04, 27 August 2020 (UTC)<br />
<br />
Honestly, I'd vote to change every nu in physics to something else since its so damned hard to write differently and read lazily.<br />
<br />
Yeah. Can we get the president of physics in here please? [[Special:Contributions/172.69.34.140|172.69.34.140]] 01:35, 27 August 2020 (UTC)<br />
<br />
Top/Bottom should probably be In/Out or Front/Back or something. And that's even before Randall's proposed changes. [[Special:Contributions/141.101.98.70|141.101.98.70]] 01:51, 27 August 2020 (UTC) "T" and "B" originally were going to be short for [redacted] and Bums , back when sexism was rampant. Possibly that's an urban legend, but having been in Physics grad school around the time quarks became a thing, I can believe it. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 10:04, 27 August 2020 (UTC)<br />
<br />
<br />
Didn't t/b stand for truth and beauty at some point, thus formerly lining up more favorably with strange and charm? Also, a "cool bugs" ''boson'' with spin 1/2 would itself be a cool bug, in the sense of a glitch. [[Special:Contributions/172.69.34.150|172.69.34.150]] 05:07, 27 August 2020 (UTC)<br />
<br />
It's a bit weird that he added left/right since most of the particle already come in left- and right-handed chirality.<br />
<br />
Comic 2240 has a "cool bug epoch" in the expansion of the universe that could be linked from the "cool bug" particle in this comic. ----</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2350:_Deer_Turrets&diff=196426Talk:2350: Deer Turrets2020-08-25T12:35:39Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
There's no "next" button on [[2349]]? --[[Special:Contributions/108.162.219.250|108.162.219.250]] 18:44, 24 August 2020 (UTC)<br />
:The reason there's no Next button is that it's the newest comic. --[[Special:Contributions/162.158.158.43|162.158.158.43]] 21:04, 24 August 2020 (UTC)<br />
<br />
Is this about something? I mean, it could be a commentary on the way politics handled Covid, some politicians taking terrible decisions, then saying it was a mistake and that science is still learning, but then still taking terrible decisions afterwards. [[Special:Contributions/141.101.69.83|141.101.69.83]] 21:02, 24 August 2020 (UTC)<br />
<br />
The thing about icebergs, is that 9/10ths of them would be ''on fire'', if they weren't kept underwater. Truth! [[Special:Contributions/162.158.155.192|162.158.155.192]] 22:17, 24 August 2020 (UTC)<br />
<br />
(to the tune of “Do-Re-Mi”) ''Does are near, now flee in fear; The ray will boil everyone; The antlered gun is taking aim; Now it’s vaporised my lung...'' [[User:Lightcaller|Lightcaller]] ([[User talk:Lightcaller|talk]]) 22:43, 24 August 2020 (UTC)<br />
<br />
Deer don't gallop. Are you sure that's about the deer? [[Special:Contributions/172.69.33.187|172.69.33.187]] 22:54, 24 August 2020 (UTC) Dear IP_address, deer most certainly do gallop. Since I'm a nice guy (rarely), I LMGTFYed that to confirm. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 12:35, 25 August 2020 (UTC)<br />
<br />
I don't think you can build an iceberk-proof airship. Or at least, you won't get it into air because it would be too heavy. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 00:21, 25 August 2020 (UTC)<br />
<br />
You make a ship iceberg proof by making it fly. You can't be sunk if you fly over. [[User:Hax|Hax]] ([[User talk:Hax|talk]]) 07:16, 25 August 2020 (UTC)<br />
<br />
I think the "Is it really??" means "Is it really okay?", not "Is it really a mistake?". [[Special:Contributions/162.158.183.137|162.158.183.137]] 11:03, 25 August 2020 (UTC)<br />
<br />
== When Mao went to clear the sparrow but for the locust, it was 42% as deadly as fauna-mounted autocannons ==<br />
<br />
Just saying. [[Special:Contributions/172.69.34.150|172.69.34.150]] 07:17, 25 August 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2349:_Rabbit_Introduction&diff=196281Talk:2349: Rabbit Introduction2020-08-21T12:33:27Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
Comic posted shortly after this made national news in the USA:<br />
https://www.newsweek.com/why-hundreds-millions-genetically-engineered-mosquitoes-will-soon-released-florida-1526375<br />
[[Special:Contributions/172.69.34.56|172.69.34.56]] 05:06, 21 August 2020 (UTC)<br />
<br />
This comic was posted incredibly early compared to the other recent comics [[Special:Contributions/172.69.34.232|172.69.34.232]] 07:22, 21 August 2020 (UTC)<br />
<br />
Yeah wtf it's so early [[Special:Contributions/172.69.33.25|172.69.33.25]] 07:50, 21 August 2020 (UTC)<br />
<br />
There's a twitter thread at @xkcd, one word every few days, from 2020-05-15 until 2020-06-01, reading "How's it going I saw a small bun (picture)", continuing the sentence until 2020-06-25, "and an airplane crossing the moon (picture)" [[User:Chrullrich|Chrullrich]] ([[User talk:Chrullrich|talk]]) 07:53, 21 August 2020 (UTC)<br />
<br />
I recognise that 'bun-gap' looks like a pun, but what's it punning about? [[Special:Contributions/162.158.154.131|162.158.154.131]] 10:14, 21 August 2020 (UTC)<br />
<br />
Former POTUS Jimmy Carter is unapologetically completely oppposed to the spread of any species of bunny. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 12:33, 21 August 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2344:_26-Second_Pulse&diff=195906Talk:2344: 26-Second Pulse2020-08-11T10:55:29Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
The transcript is calling the character "Hairbun," and while apparently Hairbun has several different renditions, one thing common to them all is that she has a single bun. This character has two buns, as can be seen in the second panel. Probably should not be conflated with a character that has a single bun. [[Special:Contributions/108.162.237.172|108.162.237.172]] 01:13, 11 August 2020 (UTC)<br />
: I think it's [[Science Girl]]? Definitely not Hairbun. [[Special:Contributions/172.69.35.31|172.69.35.31]] 01:20, 11 August 2020 (UTC)<br />
<br />
<br />
Is this pulse a real phenomenon? A cursory google search turned up nil.<br />
Future me: Yes it's real I was just using poor google-fu. https://phys.org/pdf214488694.pdf<br />
::(Could future future you learn to properly indent and sign comments? Just as courtesy.) [[Special:Contributions/162.158.159.18|162.158.159.18]] 01:47, 11 August 2020 (UTC)<br />
:::(And, while you’re at it, don’t forget to point out the Easter egg in your link. The photographer credited. Coincidence? I think not.) [[User:Dhugot|Dhugot]] ([[User talk:Dhugot|talk]]) 07:50, 11 August 2020 (UTC)<br />
<br />
XKCD seems to be posted later and later. I mean, it was always somewhat Tuesdayish (I'm in Australia) but now I don't seem to see it until Tuesday afternoons... Am I imagining this, or are the posts getting to be much later than they used to be? [[Special:Contributions/172.69.134.139|172.69.134.139]] 03:10, 11 August 2020 (UTC)<br />
:Back in the olden days, it would update at midnight Eastern time ''sharp'', but those days are long gone. Some comics have come out a day late even in Randall's timezone. --[[Special:Contributions/188.114.103.205|188.114.103.205]] 04:29, 11 August 2020 (UTC)<br />
<br />
::My notification script has to check for new comics a lot more often because of how inconsistent the post times are; however, because of the relatively short check interval I know that new comics are posted mostly between 8pm-midnight (UTC) but many as wide as 4pm and 1am the next day.<br />
::...actually, I think I'm going to go plot the post times I have and find out what my data says. [[User:Vaedez|Vaedez]] ([[User talk:Vaedez|talk]]) 05:38, 11 August 2020 (UTC)<br />
<br />
Something similar happened in Oklahoma last year and until the real explanation was found the pulse was a mystery: [https://www.nationalgeographic.com/science/2019/09/strange-waves-rattled-entire-state-scientists-know-why/ National Geographic’s Article]<br />
<br />
The location was probably just not determined exactly. The giant was actually buried at 0° 0° for convenience. [[User:Fabian42|Fabian42]] ([[User talk:Fabian42|talk]]) 08:28, 11 August 2020 (UTC)<br />
<br />
As well as Poe's poem, I wonder if Randall is also thinking of HP Lovecraft's story "The Call of Cthulhu", and of the great old one Cthulhu, unawake beneath the oceans at R'lyeh. https://en.wikipedia.org/wiki/Cthulhu Paul Seed 09:43, 11 August 2020 (UTC) <-- this. I was going to post Cthulhu but ya ninja'd me. So I did some RESEARCH (aka Making Shit Up) and discovered that this pulse is coming from Красный Oктябрь , which accidentally ran aground there and is trying to drive free. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 10:55, 11 August 2020 (UTC)<br />
<br />
Isn't it obviously some human source, like an oil drilling rig or so.<br />
--[[Special:Contributions/162.158.159.18|162.158.159.18]] 09:49, 11 August 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2343:_Mathematical_Symbol_Fight&diff=195822Talk:2343: Mathematical Symbol Fight2020-08-10T13:15:58Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
Can I get aleph-null aleph-shaped throwing stars? [[User:LunarNapolean|LunarNapolean]] ([[User talk:LunarNapolean|talk]]) 20:18, 7 August 2020 (UTC)<br />
<br />
Apologies to whoever added the "citation needed" that I stepped on. -- brad<br />
<br />
That zeta looks conspicuously bad. I wonder if this comic will get a cleaned-up version uploaded. [[Special:Contributions/108.162.237.16|108.162.237.16]] 20:51, 7 August 2020 (UTC)<br />
<br />
[[Megan]] usually has shoulder-length hair, so the person being attacked by Ponytail is probably not Megan... except in so far as all brunettes in this comic are called 'Megan'. [[User:LtPowers|LtPowers]] ([[User talk:LtPowers|talk]]) 20:53, 7 August 2020 (UTC)<br />
:Is one of them [[Danish]]? And one of them Megan? [[Special:Contributions/172.69.33.121|172.69.33.121]] 22:49, 7 August 2020 (UTC)<br />
<br />
I think Randall is underestimating the weapon utility of psi. There's a real-world martial arts [https://en.wikipedia.org/wiki/Sai_(weapon) weapon] that looks somewhat like it.[[Special:Contributions/172.69.68.197|172.69.68.197]] 22:04, 7 August 2020 (UTC)<br />
:I think he’s also seriously underestimating the value of keeping your fingers attached to your hand. Swords have guards for a reason. I’d pick the contour integral over anything else there.<br />
<br />
Considering the title text, a bass clef looks pretty formidable, close to a bat'leth. [[User:Nutster|Nutster]] ([[User talk:Nutster|talk]]) 00:31, 8 August 2020 (UTC)<br />
:Yes, but the treble clef is the one in the title text, and that’s nothing like a Klingon {{w|bat'leth}}. I removed the comment from the table. [[User:Adam1729|Adam1729]] ([[User talk:Adam1729|talk]]) 02:09, 8 August 2020 (UTC)<br />
::If we're talking clefs/klingon weaponry, get on the viola clef. That's bat'leth AF. It's even known as a "K Clef" in some circles. You could do some pretty hefty damage with a viola clef.<br />
::Or a viola...[[Special:Contributions/141.101.98.26|141.101.98.26]] 22:05, 9 August 2020 (UTC)<br />
<br />
These “weapons” seem strangely appropriate for xkcd’s stick figures... -cpl<br />
: Agreed :)<br />
<br />
Are we sure White Hat is holding empty set? There don't appear to be points extending outside the circle in which case I think he's actually holding Theta -jc<br />
<br />
Can I use the LaTeX mathwitch? [[Special:Contributions/141.101.98.26|141.101.98.26]] 10:03, 8 August 2020 (UTC)<br />
<br />
First time editor here,hope I get the notation right! Question on the pi link to wikipedia: I put in the double link to the main page and the disambiguation because unfortunately https://en.wikipedia.org/wiki/Pi_(disambiguation)#Mathematics doesn't include the mathematical constant definition (though it is listed at the top of the page). Thoughts? [[User:Alan g|Alan g]] ([[User talk:Alan g|talk]]) 10:38, 8 August 2020 (UTC)<br />
<br />
I think that’s the is proportional to” symbol rather than just alpha. They are similar but have different Unicode symbols. Thoughts?--[[Special:Contributions/141.101.98.222|141.101.98.222]] 12:01, 8 August 2020 (UTC)<br />
:You're definitely correct. (They don't even look that similar...) It's the direct proportion symbol, not the symbol for Alpha. <br />
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 18:03, 8 August 2020 (UTC)<br />
I don't think → is "implies", particularly as we've had ⇒ earlier. → is often used for "maps to", as in f: x → f(x) [[Special:Contributions/141.101.107.166|141.101.107.166]] 19:24, 8 August 2020 (UTC)<br />
:→ and ⇒ often mean two different kinds of "implies". The single arrow is for the boolean operator that takes in two truth values and outputs a truth value. The double one is for "things on the left justify/prove things on the right", in somewhat of a metalanguage. Here's an example of two different ways of saying Modus Ponens with the operators: ((p→q) ∧p)→q vs p→q,p⇒q [[User:Alan g|Alan g]] ([[User talk:Alan g|talk]]) 03:52, 9 August 2020 (UTC)<br />
Are we sure that is the multiplication sign (center dot)? The placement makes it seem more a decimal point. [[Special:Contributions/162.158.123.47|162.158.123.47]] 21:51, 8 August 2020 (UTC)<br />
:Confusingly, math conventions in some countries use a low dot for multiplication, though it's not as common as it used to be. That's in addition to all the other things that bare dots can represent in math. Personally I can't "see" any particular set of semantics for that symbol, I just see a dot. [[Special:Contributions/162.158.186.136|162.158.186.136]] 22:51, 8 August 2020 (UTC)<br />
We see a greater-than, but no less-than. Where would that appear? I think >≠<, in fact ><<, if wielded properly. Though if thrown, either/both could be a multi-use projectile... [[Special:Contributions/141.101.98.96|141.101.98.96]] 09:08, 9 August 2020 (UTC)<br />
: Took me a little bit to figure out what you meant, but I think it hasn't been clarified which side is the point or sharp side, so until that is clarified "<"=">"<br />
<br />
Anyone else think the title text is hinting at a pun? "I got scared because his weapon looked like treble" sort of thing?<br />
<br />
Where is the opening parenthesis? [[Special:Contributions/172.69.33.223|172.69.33.223]] 21:43, 9 August 2020 (UTC)<br />
: Here! (: [[Special:Contributions/162.158.154.131|162.158.154.131]] 09:33, 10 August 2020 (UTC)<br />
<br />
<br />
If I could implement a line integral as a machine rather than a symbol, I'd use that to encircle my enemy. WIN! [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 13:15, 10 August 2020 (UTC)<br />
<br />
== Would anyone else like to join me in creating an anti-Gamma interest group? ==<br />
<br />
Just asking. [[Special:Contributions/172.69.33.223|172.69.33.223]] 21:47, 9 August 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2342:_Exposure_Notification&diff=195604Talk:2342: Exposure Notification2020-08-06T13:29:00Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
Is it dark mode as in low light UI or dark mode as in depressing? Or both [[Special:Contributions/198.41.238.106|198.41.238.106]] 21:24, 5 August 2020 (UTC)<br />
<br />
I think the title text is using the term "dark mode" not in the sense of UI design but rather that COVID-19 is "dark" and if the app were to have a mode that did what other apps did and gave notifications for potential exposures (bad news) that would be a "dark mode." I have refrained from putting this in the explanation for now as I am curious if there are other interpretations.[[User:Nk1406|Nk1406]] ([[User talk:Nk1406|talk]]) 21:27, 5 August 2020 (UTC)<br />
<br />
I see we were thinking the same thing. I will add it.[[User:Nk1406|Nk1406]] ([[User talk:Nk1406|talk]]) 21:27, 5 August 2020 (UTC)<br />
<br />
Sheesh, why dance around the point, say it loud and proud— ‘’dark humor’’ --[[User:WurmWoode|WurmWoode]] ([[User talk:WurmWoode|talk]]) 21:59, 5 August 2020 (UTC)<br />
<br />
reminds me of people who would freak out when a financial audit report included the standard wording "We find no evidence of fraud ...." [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 12:31, 6 August 2020 (UTC)<br />
<br />
What's this about Stack Overflow? A link to an explanation of what happened to alienate users might be useful. [[User:LtPowers|LtPowers]] ([[User talk:LtPowers|talk]]) 12:36, 6 August 2020 (UTC)<br />
@LtPowers probably the mess when they tossed a moderator after she asked for clarification on some "don't be offensive" rule. (really, SO allowed groups dedicated to discussing the, ummm, finer points of interpreting religions, and then where "shocked, shocked, I tell you" to find that zealots had hissy fits) [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 13:29, 6 August 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2342:_Exposure_Notification&diff=195600Talk:2342: Exposure Notification2020-08-06T12:31:46Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
Is it dark mode as in low light UI or dark mode as in depressing? Or both [[Special:Contributions/198.41.238.106|198.41.238.106]] 21:24, 5 August 2020 (UTC)<br />
<br />
I think the title text is using the term "dark mode" not in the sense of UI design but rather that COVID-19 is "dark" and if the app were to have a mode that did what other apps did and gave notifications for potential exposures (bad news) that would be a "dark mode." I have refrained from putting this in the explanation for now as I am curious if there are other interpretations.[[User:Nk1406|Nk1406]] ([[User talk:Nk1406|talk]]) 21:27, 5 August 2020 (UTC)<br />
<br />
I see we were thinking the same thing. I will add it.[[User:Nk1406|Nk1406]] ([[User talk:Nk1406|talk]]) 21:27, 5 August 2020 (UTC)<br />
<br />
Sheesh, why dance around the point, say it loud and proud— ‘’dark humor’’ --[[User:WurmWoode|WurmWoode]] ([[User talk:WurmWoode|talk]]) 21:59, 5 August 2020 (UTC)<br />
<br />
reminds me of people who would freak out when a financial audit report included the standard wording "We find no evidence of fraud ...." [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 12:31, 6 August 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=User:Cellocgw&diff=195533User:Cellocgw2020-08-04T10:56:35Z<p>Cellocgw: Created page with "Hi there everyone! I've been following XKCD since at least 2004 - can't remember exactly. When I'm not analyzing radar test data for my employer, Veoneer, I'm busy excori..."</p>
<hr />
<div>Hi there everyone! <br />
<br />
I've been following XKCD since at least 2004 - can't remember exactly.<br />
When I'm not analyzing radar test data for my employer, Veoneer, I'm busy excoriating simpleton cow-orkers, playing the cello (how did you ever guess), doing unspeakable things in MeshMixer to respectable 3D -print models, or testing various brands and makes of single-malts.</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2341:_Scientist_Tech_Help&diff=195532Talk:2341: Scientist Tech Help2020-08-04T10:42:43Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
First. [[User:Unpopular Opinions|Goodbye, world!]] ([[User talk:Unpopular Opinions|talk]]) 23:19, 3 August 2020 (UTC)<br />
<br />
But more importantly, I added a transcript and added definitions for a Polaroid and Excel. Also, how should I deal with multiple Cueballs in the transcript? [[User:Unpopular Opinions|Goodbye, world!]] ([[User talk:Unpopular Opinions|talk]]) 23:35, 3 August 2020 (UTC)<br />
: I don't think it is 2 Cueballs. I think the one on the right is Cueball and I don't recognise the other one. He is drawn slightly differently, he's got a bit of a butt-head (crack-head?). [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 07:23, 4 August 2020 (UTC)<br />
<br />
I know of a team whose data was in the form of images - tens of thousands of them. Somehow during a pre-processing step they lost the exif data for the image files - which held the only digital link between the image file which had names assigned by the cameras like Img237856.png and their science which needed things like date and time of the image..... Fortunately the image itself had the date and time in a banner across the bottom 100 pixels. Managed to read the banner using OCR and tesseract. Not so very far off the thrust of this comic! [[Special:Contributions/162.158.126.134|162.158.126.134]] 00:08, 4 August 2020 (UTC)<br />
<br />
I feel old when I know that Polaroid was not a disposable camera; it was an instant camera, meaning that the picture was taken, the film was slowly ejected from the camera body and you held the picture as it developed before your eyes. There were one-time use cameras, or "disposable" cameras, that were made cheaply and the camera was sent in for processing. Yes, probably incomprehensible to one so young to not know what a rotary dial desk phone (or wall phone) was. [[User:Doubting Thomas|Doubting Thomas]] ([[User talk:Doubting Thomas|talk]]) 00:41, 4 August 2020 (UTC)<br />
<br />
I think the resentment stems from the ugly truth that such tool is needed in the first place? Is that a possibility? [[Special:Contributions/172.69.134.229|172.69.134.229]] 01:48, 4 August 2020 (UTC)<br />
<br />
"As you can see from the graphs, we detected significant Gravity Wave events on average once every 30-40 days for the whole two years of the observations, except for ''this'' short period where we seemed to get a consistently low level of background noise hum, that we have yet to fully connect with any of our existing astrophysical theories..." [[Special:Contributions/162.158.154.131|162.158.154.131]] 10:17, 4 August 2020 (UTC)<br />
<br />
<br />
A serious suggestion: instead of webplotdigitizer, if you want to grab data off a chart image, get the java-based DataThief, https://datathief.org/ . It's fast, very customizable, can handle a certain amount of image distortion, i.e. X and Y axes not perpendicular in the crappy image your uncle sent you. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 10:42, 4 August 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2334:_Slide_Trombone&diff=194820Talk:2334: Slide Trombone2020-07-18T11:57:10Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
I can't find any source saying that the CPS 2000 was discontinued ''because it was too powerful''. There's plenty of reasons why products get discontinued, and this product had various points of criticism apparently. --[[User:NeatNit|NeatNit]] ([[User talk:NeatNit|talk]]) 21:09, 17 July 2020 (UTC)<br />
: It's not verified but it appears likely. The nozzle of the CPS 2000 was 2.5x larger than advertised on the box and had a prominent safety warning affixed to it. It shot water with higher pressures than ever before. There was a hullabaloo around somebody losing an eye from it; there's no proof this happened but such hullabaloos are still bad for business. The model was discontinued and no water gun with comparable power has ever been mass produced for consumers since. It's notable that you can shoot water with as much pressure as you want to the point of cutting metal from a distance (see water cutter, found in well funded makerspaces as an improvement from the laser cutter, plasma cutter, cnc machine) and the metal of a brass instrument could be made to hold higher pressure than plastic. CPS 2000 information from https://nerfpedialegacy.fandom.com/wiki/CPS_2000 [[Special:Contributions/108.162.219.192|108.162.219.192]] 23:58, 17 July 2020 (UTC)<br />
::Industrial water cutters use an abrasive (often garnet), as it is hard cut a material with something softer than that material. The water isn't doing the cutting, it is just there to provide pressure. In theory a high enough pressure pure water jet would cut metal, but it probably wouldn't be clean. To quote Randall, imagine throwing a ripe tomato into a cake. [[User:Probably not Douglas Hofstadter|Probably not Douglas Hofstadter]] ([[User talk:Probably not Douglas Hofstadter|talk]]) 05:05, 18 July 2020 (UTC)<br />
<br />
::There are actually two versions of the CPS 2000, and although it is true the original version is the most powerful retail super soaker, the mk2 version was only slightly less powerful. Several water guns were released 1996-2000 with comparable power. Take the CPS 2500 - it was released 2 years later in 1998 with the same pressure chamber as the mk2 CPS 2000, while adding a nozzle selector. It is my personal belief that Laramie (the company behind Super Soakers) actually shortened the pressure chamber in the mk2 to make it more reliable, not to make it safer. The mk1 longer bladder chamber (and associated higher pressure) can cause the firing valve to get stuck closed by the high pressure behind it, causing trouble as either the trigger broke or users over-pressurized and burst the bladder. Could be wrong, but you can only work with so much pressure using plastic parts. In any case, my source on the question of comparable power http://www.isoaker.com/Armoury/soaker_listing.php has a list of all known water guns sortable by their output, range, power, reservoir size, etc.; sscentral.com has really in depth information on the physics of water guns, including a list of water gun related patents (http://www.sscentral.org/patents/ [https://patents.google.com/patent/US5799827 this] one is I think the one that most closely resembles the technology and design of a CPS 2000, Figure 4-6 diagram the pressure bladder, Figure 7-9 the other mechanisms of the gun). Hopefully these provide enough information as to how these water guns work. [[Special:Contributions/172.69.23.7|172.69.23.7]] 06:15, 18 July 2020 (UTC)<br />
<br />
This should come standard with all spit valves. [[Special:Contributions/108.162.219.192|108.162.219.192]] 21:36, 17 July 2020 (UTC)<br />
<br />
Maybe I'm too knowledgeable about musical instruments, but this doesn't seem funny even as a satire. And there are lots of musician jokes about trombonists. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 23:34, 17 July 2020 (UTC)<br />
: Randal probably doesn't play these instruments. I don't either and don't yet understand why the joke is painful to you. It would be good for us to learn to respect musicians like you better. Is it because it's disrespectful of an expensive loved instrument that requires great dedication to own? [[Special:Contributions/108.162.219.192|108.162.219.192]] 23:58, 17 July 2020 (UTC). No, we are good at disrespecting each other. It's just that the proposed "pump action" is nothing like how a 'bone works, or could work. Maybe I'm just being too picky[[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 11:57, 18 July 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2334:_Slide_Trombone&diff=194805Talk:2334: Slide Trombone2020-07-17T23:34:20Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
I can't find any source saying that the CPS 2000 was discontinued ''because it was too powerful''. There's plenty of reasons why products get discontinued, and this product had various points of criticism apparently. --[[User:NeatNit|NeatNit]] ([[User talk:NeatNit|talk]]) 21:09, 17 July 2020 (UTC)<br />
<br />
This should come standard with all spit valves. [[Special:Contributions/108.162.219.192|108.162.219.192]] 21:36, 17 July 2020 (UTC)<br />
<br />
Maybe I'm too knowledgeable about musical instruments, but this doesn't seem funny even as a satire. And there are lots of musician jokes about trombonists. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 23:34, 17 July 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2332:_Cursed_Chair&diff=194646Talk:2332: Cursed Chair2020-07-14T10:38:56Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
why so pixelated?<br />
[[Special:Contributions/162.158.34.206|162.158.34.206]] 23:06, 13 July 2020 (UTC) xkcd addict #40571<br />
: It is ''very'' pixelated, isn't it? <br />
: [[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 00:15, 14 July 2020 (UTC)<br />
:: I was hoping there was some kind of extra joke there, but I can't find it. --[[User:Draco18s|Draco18s]] ([[User talk:Draco18s|talk]]) 01:18, 14 July 2020 (UTC)<br />
<br />
I'm pretty sure if he shops at IKEA he'd try to read one of the names and accidentally summon a demon. [[User:DanielLC|DanielLC]] ([[User talk:DanielLC|talk]]) 23:41, 13 July 2020 (UTC)<br />
<br />
:I'm not sure whether he's summoned a BLECKBERGET, or a HATTEFJÄLL. <br />
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 00:15, 14 July 2020 (UTC)<br />
<br />
I don't think I'd feel safe talking to White Hat without social distancing ''or'' face masks. [[User:Orion205|Orion205]] ([[User talk:Orion205|talk]]) 01:32, 14 July 2020 (UTC) <br />
<br />
This comic's alt-text wins "The Deepest Indirect References" award for sure. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 10:38, 14 July 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2327:_Oily_House_Index&diff=194203Talk:2327: Oily House Index2020-07-02T11:40:48Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
Dangit Randall, this was my retirement plan & now everybody's gonna want to try it! <br />
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 00:53, 2 July 2020 (UTC)<br />
<br />
Negative Equity (owing more than the house is worth) ''shouldn't'' be an immediate problem under most circumstances. If the householder isn't actually wanting to move and can still afford the asked-for repayments then it doesn't change the physical situation at all. The bank has no problems so long as the household has no problems, as they ride over (temporary) pricing crashes and emerge the other side. It's when banks get nervous that the home'owners' ''might'' default and thus put pressures on them (e.g. 'negotiating' for unsustainably greater repayments or 'immediate settlement' of the unforeseen temporary deficit) that they could tip their so-called customer over the edge. And an increase of defaulting further suppresses house-prices (general availability of sell-quick homes by owners/bank and/or the reduced neighbourhood value around abandoned properties not sold ''nor'' (officially) lived in) to draw more agreements into the self-creating danger-zone. Of course it aint as simple as all that. And permanently being underwater due to coastal flooding, ''probably'' won't sit well with the actuaries behind your continuing loan if your property isn't in Innsmouth... [[Special:Contributions/162.158.159.76|162.158.159.76]] 09:31, 2 July 2020 (UTC)<br />
<br />
;Maths<br />
Can someone figure out where I went wrong here?<br><br />
>The comic then applies dimensional analysis to this index: dividing $/sqft by $/bbl yields a result whose dimension is a linear measurement, which can be called length. 1 barrel is 5.6 cubic feet. The average price per square foot of a new single-family dwelling in the USA in 2019 was about 119 $/sqft, while the price of oil in mid 2019 was about $60/BBL or $337/cubic foot. Dividing gives 60/337 feet-1 or about 5.61 feet. (This doesn't match the value shown on the chart of around 15, so we have done something wrong here. :))<br><br />
Thanks. [[User:Stevage|Stevage]] ([[User talk:Stevage|talk]]) 00:54, 2 July 2020 (UTC)<br />
:Since barrels are in the denominator, you have to divide by 5.6 to get the price per cubic foot. [[User:LegionMammal978|LegionMammal978]] ([[User talk:LegionMammal978|talk]]) 01:00, 2 July 2020 (UTC)<br />
<br />
;Units<br />
Shouldn't area divided by volume be height, not length? It would also fit better with the graph. [[Special:Contributions/162.158.123.173|162.158.123.173]] 03:41, 2 July 2020 (UTC)<br />
:For dimensional analysis, you don't care about the physical context of the units, just about the dimension they are associated with. Height is horizontal length, so it has the dimension of length. In the context of the comic this length can be interpreted as a height, but in another context, it could be a length in a different orientation. [[Special:Contributions/162.158.88.78|162.158.88.78]] 04:16, 2 July 2020 (UTC)<br />
<br />
;Category<br />
Should we start a category of dimensional analysis comics: e.g. [[687]], [[1707]], [[2312]] --[[User:WhiteDragon|WhiteDragon]] ([[User talk:WhiteDragon|talk]]) 07:41, 2 July 2020 (UTC)<br />
<br />
;Division Error?<br />
You can't divide by zero; which means Randall made an error. Should we update the page to reflect this? [[Special:Contributions/173.245.52.67|173.245.52.67]] 10:25, 2 July 2020 (UTC)<br />
:"OHI briefly became infinite as oil prices reached zero in 2020" could be read as approaching both infinity and zero; that fixes the problem [[Special:Contributions/162.158.74.249|162.158.74.249]] 11:18, 2 July 2020 (UTC)<br />
::Randall did not divide by zero. If the price went continually to zero the OHI would aproach infinity. Of course at the time the price hit zero (or negative), then the OHI breaks down, which is what infinite means. So he did not make any error. (Wrote this and had an edit conflict with the first reply.) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:20, 2 July 2020 (UTC)<br />
<br />
<br />
The comic should not use the word "mortgage," because the calculations are based on sale price. The size of the mortgage depends on the down payment. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 11:40, 2 July 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2326:_Five_Word_Jargon&diff=194090Talk:2326: Five Word Jargon2020-06-30T13:06:42Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
Approximate nonnegative matrix factorization algorithms <br />
<br />
That's all. -[[Special:Contributions/162.158.62.119|162.158.62.119]] 22:04, 29 June 2020 (UTC)<br />
<br />
super cali fragilistic expiali docious<br />
[[User:Bo Lindbergh|Bo Lindbergh]] ([[User talk:Bo Lindbergh|talk]]) 22:26, 29 June 2020 (UTC)<br />
<br />
Over at [https://languagelog.ldc.upenn.edu/ Language Log] they have fun documenting bewildering "noun piles". In the post '''[https://languagelog.ldc.upenn.edu/nll/?p=3341 noun pile blog post madness]''' for example<br />
: '''data bound control table row action links'''<br />
:: is a header in this page from Microsoft: '''[https://docs.microsoft.com/en-us/dotnet/api/system.web.dynamicdata.dynamichyperlink?view=netframework-4.8 DynamicHyperLink Class]'''<br />
[[User:JohnB|JohnB]] ([[User talk:JohnB|talk]]) 23:59, 29 June 2020 (UTC)<br />
<br />
All cyanobacteria are unicellular. That word is just an imposition. [[User:Nitpicking|Nitpicking]] ([[User talk:Nitpicking|talk]]) 02:25, 30 June 2020 (UTC)<br />
: Cyanobacteria come in various types, such as unicellular, filamentous or colonial. Or even part of a composite organism such as lichen. Plastids, which are intracellular endosymbiotic organelles are technically acellular cyanobacteria. [[Special:Contributions/162.158.165.8|162.158.165.8]] 04:31, 30 June 2020 (UTC)<br />
::Plastids are still unicellular. Living as endosymbionts doesn't make them multicellular, it makes them endosymbionts. Colonial unicellular organisms are still unicellular. [[Special:Contributions/108.162.219.188|108.162.219.188]]<br />
<br />
Cueball could be Randall copying down the phrase into his collection. [[Special:Contributions/173.245.54.131|173.245.54.131]] 03:10, 30 June 2020 (UTC)<br />
<br />
I was expecting these would in fact all mean something incredibly simple. I'm a little disappointed :( [[Special:Contributions/198.41.238.108|198.41.238.108]] 04:03, 30 June 2020 (UTC)<br />
<br />
My undergraduate research was on fluxional behavior in zwitterionic isoindoline complexes, so this struck close to home.[[User:Eärendil|Eärendil]] ([[User talk:Eärendil|talk]]) 04:17, 30 June 2020 (UTC)<br />
<br />
The phrase from the caption '''really satisfying-sounding five-word technical phrases''' also meets (almost) every criteria it states (except maybe 'technical') - having read many of Randall's comics, I can't imagine this to be a coincidence... [[Special:Contributions/172.68.50.54|172.68.50.54]] 07:39, 30 June 2020 (UTC)<br />
<br />
Before reading this explanation, I was convinced these were nonsensical phrases that Randall had made up![[Special:Contributions/162.158.155.168|162.158.155.168]] 08:18, 30 June 2020 (UTC)<br />
<br />
anomalous electroweak sphaleron transition baryogenesis - roughly translates out of Jargon as Weird Forces Slippery change creation [[Special:Contributions/162.158.155.228|162.158.155.228]] 11:33, 30 June 2020 (UTC)<br />
<br />
I really want to dive into the word relationships within these 'semantically multityped divaricatedly polyconstructed descriptors' and see how much or little they obey the 'rules' for {{w|Branching_(linguistics)|word order}} of component {{w|Adjective#Order|adjectives}}, etc. Maybe when I get a piece of paper and pencil and a bit of time to tease them apart. ;) [[Special:Contributions/162.158.155.240|162.158.155.240]] 13:02, 30 June 2020 (UTC)<br />
<br />
<br />
<br />
<br />
Horrifically enough, Pachelbel's Canon uses five chords: I-V-vi-iii-IV-I-IV-V . (It's deeply hated by us musicians who have to play it at weddings and whatnot). Beethoven's 6th: AllegroMaNonTroppo; AndanteMoltoMosso; Allegro; Allegro; Allegretto. Mahler's Fifth: in short terminology, Pan&Bacchus; Flowers; Animals;Man,Angels; Love . [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 13:06, 30 June 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2325:_Endorheic_Basin&diff=194026Talk:2325: Endorheic Basin2020-06-29T12:31:25Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
I think it is a funny comic, but the way water acts towards Beret Guy has nothing to do with what happens in an Endorheic basin. And also if he attracts water more than gravity, then a siphon is no help at all to get rid of the water. A pump would be needed that could make a larger pull then gravity. But the name is just something Beret Guy gives it. And since he is the only hydrophilic person in the world it is hard to say how it will work for him. But given that Randall named the comic it seems to me that either he did not care about this, did not think about it correctly, or else, also a possibility, I do not understand these concepts well enough --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 22:49, 26 June 2020 (UTC)<br />
<br />
I sort of disagree with Kynde. I think the idea here is that Beret Guy is a local low point where water flows toward. It's not that he's "more attractive that gravity" but that from the perspective of the water he's now the lowest point around and thus it flows toward him. Like a Endorheic basin it can't flow out to somewhere else. This makes the siphon comment funnier in my opinion as they're suggesting that if then found an even lower point than Beret Guy they could siphons water off of him and to that lower point. Something that the water wouldn't do on its own because of "walls" in his water potential function. [[Special:Contributions/162.158.63.172|162.158.63.172]] 23:23, 26 June 2020 (UTC)Max<br />
<br />
Do we have a category for comics where Randal is suspected of trolling the explainxkcd community? [[Special:Contributions/108.162.245.132|108.162.245.132]] 00:32, 27 June 2020 (UTC)<br />
:"All Comics"? [[Special:Contributions/162.158.158.167|162.158.158.167]] 00:43, 27 June 2020 (UTC)<br />
<br />
"Generating Electricity" is most likely a reference to the https://en.wikipedia.org/wiki/Qattara_Depression_Project <br />
:Qatarra makes sense; my first thought was the Salton Sea. It's certainly not a Minecraft reference, since rivers in Minecraft are flat (same altitude as the oceans) & hydroelectric dams do not exist in the game. <br />
:[[Special:Contributions/172.69.33.125|172.69.33.125]] 17:25, 27 June 2020 (UTC)<br />
<br />
(Prior item is unsigned.) Worth a link to https://what-if.xkcd.com/143/ aroujd the subject of siphons? If nothing else, it shows that Randall knows how they work (even if there's confusion over whether BG does, or just has the laws of nature do what he ''thinks'' they should do, as per Vacuum Energy). [[Special:Contributions/162.158.155.240|162.158.155.240]] 10:57, 27 June 2020 (UTC)<br />
<br />
:Ordinary siphoning wouldn't work unless MOND or modified inertia dark matter theories are true. [[Special:Contributions/172.68.141.146|172.68.141.146]] 18:25, 27 June 2020 (UTC) <br />
<br />
No, an ordinary siphon will work fine - it just has to feed past the local maximum & then it'll drain to the sea, just as it would if you put a siphon in a reservoir and fed the siphon's output to a point past the dam. It's pretty clear that BeretGuy's local minimum is not all that deep. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 12:31, 29 June 2020 (UTC)<br />
<br />
So, does anyone know what a Colonial Engineer is? I'm unfamiliar with the term. A quick google search just turns up a plastic parts company and a minecraft mod and that's it.[[Special:Contributions/172.69.63.169|172.69.63.169]] 21:13, 27 June 2020 (UTC)<br />
<br />
:Isn't it simply engineer from British colony? You know, from the time of British Empire, when that included Egypt, India and lot more ... -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 22:42, 27 June 2020 (UTC)<br />
<br />
Taking a poo must be awful. All that toilet water getting attracted to his butt... [[User:DrPumpkinz|DrPumpkinz]] ([[User talk:DrPumpkinz|talk]]) 00:07, 28 June 2020 (UTC)<br />
<br />
They could also dress him in a molybdenum disulfide membrane to generate electricity. [https://phys.org/news/2016-07-electricity-salt-three-atoms-thick-membrane.html Electricity generated with water, salt and a three-atoms-thick membrane]<br />
<br />
I just changed the explanation slightly as gravity ''and'' personal attraction explains the foot-pooling of water and the not-yet-face-covering for the shower scene (plus hanging off his hand, at least until he raises his arm or brings it to his side to let it flow to is feet as well). Wanted to add in high surface tension (to explain how his feet are sticking outbl of his accumulation of shower-water), but - as you can see - this gets far too wordy. (Surface tension and core-attraction alone would not explain his feet or hand, of course.) [[Special:Contributions/162.158.154.77|162.158.154.77]] 10:58, 29 June 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2324:_Old_Days_2&diff=193927Talk:2324: Old Days 22020-06-26T14:08:36Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
I've gotta try that, see how the ice cream truck guy reacts. Wonder where I can find an ice cream truck though? [[Special:Contributions/172.69.71.16|172.69.71.16]] 23:42, 24 June 2020 (UTC)<br />
: The above is me, wasn't logged in, would I get in trouble for fixing the signature? [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 23:44, 24 June 2020 (UTC)<br />
(@Mikemk, I recon you sorted it by adding what you did. If you'd have just changed things, probably no crime if you explained it in the edit Summary. But I'm just an IP Address, so no authority.) Anyway. The bit about a phone-call stopping all electronic business is obviously rooted in dial-up needing exclusive use of a POTS line, something that only went out with broadband piggy-backing alongside voice-calls, the respective carrier-signals now microfiltered at each end of the house-to-exchange copper cabling to let them coexist over the same circuit without blocking/overwhelming each other. Though, in this comic, it's hyperbole, overly fuzzy memory, leg-pulling and/or an alternate-history being described. [[Special:Contributions/141.101.98.130|141.101.98.130]] 02:06, 25 June 2020 (UTC)<br />
::I would just have deleted the auto signature and put in the correct after login in. Great you signed it correctly. As there is already a discussion opn this I will not correct it. Had no one answered you I would have just put your signature where the special contribution signature is and deleted your second line... ;-) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 17:24, 25 June 2020 (UTC)<br />
<br />
<br />
In the early days (of the ARPAnet) there was actually something that today would be classed as a "cloud service" (before the term was invented) although limited. It was a computer (in Cambridge, MA) funded by ARPA with massive amounts of storage and anybody on the ARPAnet could use it for storage (primary access was through FTP). So, cloud storage but not cloud computing. If you wanted to do something with the data you had to copy the whole file to your local disk, edit it there, and then send it back. The actual bits were stored on magnetic tape and there was an elaborate X/Y mechanism to select a tape and mount it on a tape drive, and later return it to its cubby. [[User:MAP|MAP]] ([[User talk:MAP|talk]]) 02:38, 25 June 2020 (UTC)<br />
<br />
"State landline" is reminiscent of the old sailing joke where you'd ask a n00b to bring you 100 feet of shoreline. -- brad<br />
<br />
Hm, I'd think that "state landline" is a pun on "state line". [[User:Gvanrossum|Gvanrossum]] ([[User talk:Gvanrossum|talk]]) 04:19, 25 June 2020 (UTC)<br />
<br />
Also, while mainframes didn't exactly knit sweaters when they ran your code, they *did* produce physical artifacts -- reams of line printer paper. [[User:Gvanrossum|Gvanrossum]] ([[User talk:Gvanrossum|talk]]) 04:21, 25 June 2020 (UTC)<br />
:Kniting a sweater out of all teletyp tapes (5 holes width could work) that where common in releationship to mainframe landline interfaces 09:08, 26 June 2020 (UTC)Knitter<br />
<br />
"It's not even likely that any punch patterns used in computer coding would be interpretable as valid sweater-creating instructions." Is anyone up to the challenge? [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 05:04, 25 June 2020 (UTC)<br />
<br />
Wouldn't a loom produce woven textiles rather than knit garments like sweaters? Seems like an additional layer of tall tales. [[Special:Contributions/172.68.189.179|172.68.189.179]] 06:46, 25 June 2020 (UTC) <br />
<br />
In fact, you can buy computer-programmable knitting machines - even consumer models have been around for quite a while. One short article: https://www.futurity.org/knitting-machines-software-1719232/ [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 14:08, 26 June 2020 (UTC)<br />
<br />
It seems to me that the comic is having fun with false etymologies. There is especially one article that 'explains' a lot of idiom (in the sense of making up a fanciful story), which has been debunked by Snopes<br />
https://www.snopes.com/fact-check/life-in-the-1500s/ and the comics seems to allude to a similar situation in computer science, which is now old enough that early days are shrouded in a bit of mist out of which selective trivia is remembered (punch cards had something to do with looms) and then put together into a semi-coherent story that no longer reflects reality. (With part of the joke being that many people here will actually still know or even remember what it was really like in the 'early years', but the fewer those become, the more likely it will be that made-up 'origin stories' become accepted as true.<br />
<br />
[[Special:Contributions/141.101.69.33|141.101.69.33]] 06:54, 25 June 2020 (UTC)<br />
<br />
Is there a pun in the title text, regarding double meaning of driver? [[Special:Contributions/172.68.226.26|172.68.226.26]] 07:59, 25 June 2020 (UTC) Eddy<br />
<br />
The explanation about landlines needs to be reviewed. Landlines are still a thing, people are still using them, they're not a "stone age" technology.[[Special:Contributions/141.101.98.130|141.101.98.130]] 14:35, 25 June 2020 (UTC)<br />
:I disagree. The explanation does not claim landlines are a stone age technology. It instead says that Cueball, in this context, may associate them with an imagined stone age technology. In the same vein, it is the youngster Cueball who may believe that nobody today uses landlines for anything at all. [[User:JohnB|JohnB]] ([[User talk:JohnB|talk]]) 21:22, 25 June 2020 (UTC)<br />
<br />
This comic is why we have children and encourage them to go into the same line of work as us: so we can tell them stories of the "good old days." My wife wants nothing to do with my stories of computers in the 70s and 80s, but my son - now also a developer like me - actually listens. [[User:Gbisaga|Gbisaga]] ([[User talk:Gbisaga|talk]]) 16:13, 25 June 2020 (UTC)<br />
<br />
"Also it is unknown how it should know in which repo to create a pull request and whom to contact about it." I assumed it was akin to those USB dead drops. You give the disk to an ice cream man and hope that there is something interesting in the repo. Also the thrill is more in being one of the few insiders who know how to access it, not necessarily the value of the contents themselves.[[Special:Contributions/173.245.54.131|173.245.54.131]] 19:25, 25 June 2020 (UTC)<br />
:Removed - presumably the contents of the floppy disk would tell the truck driver which repo and whom to contact. Just as the requests you send over a network do now. [[Special:Contributions/108.162.245.28|108.162.245.28]] 00:41, 26 June 2020 (UTC)<br />
<br />
: Git is a version control system, which employs and manages a centralized copy of a coding project to prevent and resolve conflicts from multiple people editing the project at once.<br />
No. Git itself has no concept of "centralized copy". It is 100% distributed. Human developers often choose one of the copy and call it "main", "master", or whatever. But that’s only a convention humans can agree on when using this tool. [[Special:Contributions/141.101.69.91|141.101.69.91]] 21:30, 25 June 2020 (UTC)<br />
:It might be notable that Git is while not first definitely version control system which popularized decentralized distributed version control systems. In old days, version control systems were centralized, with master copy on single server and developers fetching the code from it and then committing their changes back. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 00:21, 26 June 2020 (UTC)<br />
<br />
The circulating mag tape is very reminiscent of quotations such as this.<br />
<br />
"Never underestimate the bandwidth of a station wagon full of tapes hurtling down the highway."<br />
— Andrew S. Tanenbaum<br />
<br />
Related: {{w|Sneakernet}} and {{w|Delay-tolerant networking}}. In areas that are not served by communication lines/wireless communication, vehicles running on a regular route have been used as basis for network communications. [[Special:Contributions/108.162.245.28|108.162.245.28]] 00:41, 26 June 2020 (UTC)<br />
<br />
<br />
"And it's not likely that any punch patterns used in computer coding would be interpretable as a suitable pattern for a sweater." - Is that a CHALLENGE? [[Special:Contributions/172.68.50.50|172.68.50.50]] 08:46, 26 June 2020 (UTC)<br />
: Sounds like it would make an interesting esolang. [[Special:Contributions/172.69.63.125|172.69.63.125]] 13:45, 26 June 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2321:_Low-Background_Metal&diff=193603Talk:2321: Low-Background Metal2020-06-19T10:05:51Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
Spoiler Alert for Avengers Endgame next comment [[Special:Contributions/162.158.75.60|162.158.75.60]] 20:36, 18 June 2020 (UTC)<br />
:I can't help but notice that the basic premise of this comic is very much like the reason for going back to 1970 in ''Avengers: Endgame'', when they needed more Pym particles for time travel. I wonder if Randall re-watched it again recently? — [[User:KarMann|KarMann]] ([[User talk:KarMann|talk]]) 17:10, 17 June 2020 (UTC)<br />
:: Whoa! Spoiler alert! Disney Plus won't have Infinity War until next week. I'm not watching them out of order! [[User:Mathmannix|Mathmannix]] ([[User talk:Mathmannix|talk]]) 12:16, 18 June 2020 (UTC)<br />
<br />
Oh, that's new to me, that they use roman ships to get to higher quantities of lead. For Steel they use German ships. after world war I, the german high seas fleet was captured and put under arrest in scottish waters. To not allow the enemy to utilize the ships, they all sank themselfes. {{w|Scuttling_of_the_German_fleet_at_Scapa_Flow|wikisource}} --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 05:46, 18 June 2020 (UTC)<br />
<br />
== Drawing ==<br />
<br />
There's one leg of the time-machine missing from the 3rd panel. (or is it the side of a base?) --[[Special:Contributions/162.158.155.126|162.158.155.126]] 19:57, 17 June 2020 (UTC)<br />
<br />
<br />
== Mined lead ==<br />
<br />
Pb-210 (half-life 20.4 years) is a decay product of radon, and thus accumulates everywhere that is exposed to the atmosphere or where radon seeps from the ground. I suspect it could be a contaminant in lead from some lead mines, but wasn't able to find any references [[User:ShadwellNH|ShadwellNH]] ([[User talk:ShadwellNH|talk]]) 20:00, 17 June 2020 (UTC) Paul<br />
<br />
== One use only? ==<br />
<br />
The way I understand it, the time machine is one-use unless you find other Low-Background Metal. If you find it, you can make more trips. It would appear that the trip is successful.<br />
--[[Special:Contributions/188.114.103.129|188.114.103.129]] 01:31, 18 June 2020 (UTC)<br />
<br />
So you'd say a car is also one-use, unless you find a gas station? [[Special:Contributions/162.158.158.167|162.158.158.167]] 08:51, 18 June 2020 (UTC)<br />
: No, but if the parts it was made of had to be replaced after every trip, I definitely would. [[Special:Contributions/172.69.70.117|172.69.70.117]] 16:59, 18 June 2020 (UTC)<br />
<br />
:: Sure, but the ability to rebuild the car with completely new material doesn't turn it into a multi-use car. [[Special:Contributions/141.101.98.130|141.101.98.130]] 04:11, 19 June 2020 (UTC)<br />
<br />
== Real life use of this lead? ==<br />
<br />
Does anyone know whether there is any truth whatsoever to scientists using lead from sunken ships to shield delicate equipment? Obviously not time machines, but there are some pieces of equipment that might be sensitive to radiation.<br />
<br />
Also, would lead that was in the ocean actually be safer from nuclear fallout than lead that was underground and mined after the nuclear testing ended? [[Special:Contributions/108.162.216.172|108.162.216.172]] 03:31, 18 June 2020 (UTC)<br />
: Yes. At least it is done with steel. [https://hackaday.com/2017/03/27/low-background-steel-so-hot-right-now/][https://www.good.is/articles/the-search-for-low-background-steel][https://www.stainless-steel-world.net/mobile/webarticles/joanne-mcintyre/disappearing-warships-scavengers-raid-war-graves-for-low-background-steel.html] [[Special:Contributions/172.69.33.129|172.69.33.129]] 04:50, 18 June 2020 (UTC)<br />
<br />
: Low Background Lead is also used, mentioned in the Good article. The equipment that need this stuff is mostly radiation sensors, very precise ones that can detect even smallest amounts of radiation. And for the last Question, you can't find pure natural lead, its mostly contaminated with radioactive elements (most lead in the universe results from decay chains). And common lead is made through recycling. Ancient lead from roman ships had enough time for the radioactive elements to decay into stable lead. --[[Special:Contributions/141.101.105.114|141.101.105.114]] 06:12, 18 June 2020 (UTC)<br />
<br />
== May be complicated ==<br />
<br />
The 1968 Story [https://scifi.stackexchange.com/questions/109243/modern-military-jet-goes-back-to-world-war-i Hawk among Sparrows] discusses the problems modern war hardware may have when used against old tech. -- [[Special:Contributions/141.101.76.82|141.101.76.82]] 07:39, 18 June 2020 (UTC)<br />
: This was also part of the premise of the 1980 movie "Final Countdown", when the aircraft carrier Nimitz shows up in the Pacific Ocean on December 6, 1941. [[User:Nutster|Nutster]] ([[User talk:Nutster|talk]]) 13:38, 18 June 2020 (UTC)<br />
: {{w|Biggles_(film)|Biggles: The Movie}} had a WW1 flying ace ''take'' a 1980s helicopter (ostensibly unarmed, except fortuitously/inevitably against the Big Bad Weapon) back to his era, thanks to a Time-Twin plotline. Thus, IIRC it only did well to defend against era-local aicraft by the mythical skill of the eponymous pilot, and was handily lost once the temporal-trickery job was finally accomplished. If you enjoy that era of kitcsh then I'd suggest you not pass up a viewing, even if not actually seek it out. [[Special:Contributions/141.101.98.130|141.101.98.130]] 17:11, 18 June 2020 (UTC)<br />
* I am also mildly disappointed that the helicopter is not Airwolf. [[User:Nutster|Nutster]] ([[User talk:Nutster|talk]]) 03:11, 19 June 2020 (UTC)<br />
<br />
== Safer alternative? ==<br />
<br />
They could just send a cache of modern lead back in time and wait till it cools down. [[Special:Contributions/141.101.76.82|141.101.76.82]] 06:30, 19 June 2020 (UTC)<br />
Naah, that would totally violate causality. Not to mention that you'd now have the exact same atoms existing in two spatial places at the same time. That could quite easily lead to the Earth being engulfed in a giant wormhole. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 10:05, 19 June 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2315:_Eventual_Consistency&diff=192881Talk:2315: Eventual Consistency2020-06-04T10:56:22Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
The current explanation says that "Cueball's employer wants him to continue his work in the COVID-19 pandemic," but that's a "citation needed" sort of statement. Even if the comic is taken to be literally occurring on the day it is published (which is not always the case as comics have taken place in the past, the future, alternate presents, and even spanning large periods of time), there are perhaps multiple things adding up together to make it "hard to focus right now." In the USA, there's hot temperatures, civil unrest, economic woes springing from or accelerated by the pandemic, and even political considerations that may make it hard to focus (governmental responses to current events potentially being out of proportion with the events, etc). If Cueball is elsewhere in the world, there may be other local conditions that might make things hard to focus. There's stuff going on in Hong Kong, the Middle East, Brazil, Somalia, and all over the world that could be making it hard for someone in those locales to concentrate on their work even if the pandemic weren't a possible contributing factor.<br />
: Is it me, or is "continue his work *in* the COVID-19 pandemic" also incorrect? It's a database, not (necessarily) anything to do with COVID-19. Perhaps "in" should be "during" (leaving aside the other arguments)? [[User:John.Adriaan|John.Adriaan]] ([[User talk:John.Adriaan|talk]]) 01:37, 4 June 2020 (UTC)<br />
::Hi, this is the "makes an edit before checking if anyone already thought to comment about it" contributor. Same again, with added complication of an edit-conflict (someone posted whilst I was trying to identify bicycles, fire-hydrants and traffic lights in the CAPTCHA). Reworded the thing to identify the situation as being ''popularised'' (not the right word!) by the pandemic. Though if Cueball were an existing home-based worker, I'm surprised they didn't fire him at the first hint of an excuse to do so. Anyway, moved the Citation Needed that the conflicter edited into the midst of my chosen edit, hopefully a mutually agreeable spot. [[Special:Contributions/141.101.98.194|141.101.98.194]] 02:02, 4 June 2020 (UTC)<br />
:I agree, Randall has clearly taken a break from the COVID-19 comics in the last weeks, and there no obvious clue that this is a new one. If the "hard to focus right now" has to refer to something current as of June 3rd 2020, it's more likely to be the civil unrest related to George Floyd's death, but that's just another guess.<br />
<br />
Just shows that the database needs more testing - as the page is obviously not reaching consistancy. I must admit that I have not looked at this for a dozen years, but I thought it was an unsolved problem in the general case as there was no way of resolving conflicts like these. [[User:Arachrah|Arachrah]] ([[User talk:Arachrah|talk]]) 08:47, 4 June 2020 (UTC)<br />
<br />
Then, of course, since the comic doesn't specify what is causing it to be hard to concentrate, it's a bit deictic, and the comic can be linked as a response to multiple future situations (not all of them bad -- having a baby, for instance, can make it hard to concentrate on work.) [[Special:Contributions/108.162.216.52|108.162.216.52]] 20:58, 3 June 2020 (UTC)<br />
<br />
Side note: YouTuber Tom Scott explained ''eventual consistency'' in one of his ''[https://www.youtube.com/playlist?list=PL96C35uN7xGLLeET0dOWaKHkAlPsrkcha The Basics]'' videos: [https://www.youtube.com/watch?v=RY_2gElt3SA "Why Computers Can't Count Sometimes"]. --[[User:Aaron of Mpls|Aaron of Mpls]] ([[User talk:Aaron of Mpls|talk]]) 21:30, 3 June 2020 (UTC)<br />
<br />
The current explanation says "His boss retorts that in a heat death, nobody can work" which is completely missing what I assume is intended by "maximum entropy means no useful work can be done!" This statement is likely a reference to the relationship between entropy and the useful work that can be extracted from a thermodynamic system. --[[Special:Contributions/172.68.206.40|172.68.206.40]] 04:13, 4 June 2020 (UTC)<br />
<br />
Purely coincidental, but The Infinite Monkey Cage podcast just had an episode on the end of the universe: https://www.bbc.co.uk/programmes/p08dy6ym. ...and I'd like to add, in that regard, that I predict it'll be Death-By-CAPTCHA (more hydrants, more bicycles, then motorcylcles, when I made a comment above. Let's see what it thinks I need to pursuasively do ''this'' time, eh?) [[Special:Contributions/141.101.98.96|141.101.98.96]] 02:10, 4 June 2020 (UTC)<br />
<br />
Can we agree that this is one of the most Dilbert-like of all xkcds? [[Special:Contributions/141.101.69.91|141.101.69.91]]Eric <-- @Eric Exactly my thought when I read it[[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 10:56, 4 June 2020 (UTC)<br />
<br />
Protest! After the heat death of the universe, suppose there is still a database left (let's skip the fact that alone the existence of a computer means maximum entropy hasn't been reached yet - a local order bubble after heat death is normal anyway). User 1 (also miraculously surviving) checks the files to find data "random1". User 2 "random2". How could that be termed consistent (unless consistent random)? [[Special:Contributions/162.158.158.223|162.158.158.223]] 08:48, 4 June 2020 (UTC)<br />
<br />
Quoting Asimov quoting Emerson, "A foolish consistency is the hobgoblin of little minds." So there's that :-) [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 10:56, 4 June 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2314:_Carcinization&diff=192790Talk:2314: Carcinization2020-06-02T12:36:46Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
Honestly, what is there to explain here? The only thing I can imagine in this explanation page is an explanation of why carcinization happens, which isn't explaining the comic. [[Special:Contributions/162.158.62.119|162.158.62.119]] 22:52, 1 June 2020 (UTC)<br />
:We might need to look at the differences between various 'false crabs' and their relatives, to show that ''in the false crabs' lifestyle'', some crab-feature they have and their close cousinshttps://www.explainxkcd.com/wiki/index.php?title=User:Lightcaller&action=edit&redlink=1 do not is a thing that the CCs would be unable to match if they lived in the FC-like style. This is probably the subject of a whole dissertation (if not several). [[Special:Contributions/141.101.107.80|141.101.107.80]] 00:22, 2 June 2020 (UTC)<br />
<br />
Does this mean all programming languages evolve into Rust?[[Special:Contributions/172.69.68.87|172.69.68.87]] 23:08, 1 June 2020 (UTC)<br />
<br />
Is it just a coincidence that today's Questionable Content also contained a reference to crabs? [[Special:Contributions/172.69.68.195|172.69.68.195]] 00:31, 2 June 2020 (UTC)<br />
<br />
It may be of note that Qwantz (a comic previously parodied in [[145]]) did a [http://www.qwantz.com/index.php?comic=3547 comic about carcinisation] earlier this year [[Special:Contributions/162.158.158.179|162.158.158.179]] 01:08, 2 June 2020 (UTC)<br />
:Why do you call Dinosaur Comic Qwantz? --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:51, 2 June 2020 (UTC) <-- because that's the web URL[[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 12:36, 2 June 2020 (UTC)<br />
<br />
Gotta say, this is the first xkcd in a while that made me laugh. [[User:Lightcaller|Lightcaller]] ([[User talk:Lightcaller|talk]]) 03:49, 2 June 2020 (UTC)<br />
<br />
Nature: Time for crab [[Special:Contributions/162.158.50.204|162.158.50.204]] 04:58, 2 June 2020 (UTC)<br />
<br />
This comic was posted 3 weeks too early, seeing as Cancer doesn't start until June 21 or 22 [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 12:34, 2 June 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2314:_Carcinization&diff=192789Talk:2314: Carcinization2020-06-02T12:34:44Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
Honestly, what is there to explain here? The only thing I can imagine in this explanation page is an explanation of why carcinization happens, which isn't explaining the comic. [[Special:Contributions/162.158.62.119|162.158.62.119]] 22:52, 1 June 2020 (UTC)<br />
:We might need to look at the differences between various 'false crabs' and their relatives, to show that ''in the false crabs' lifestyle'', some crab-feature they have and their close cousinshttps://www.explainxkcd.com/wiki/index.php?title=User:Lightcaller&action=edit&redlink=1 do not is a thing that the CCs would be unable to match if they lived in the FC-like style. This is probably the subject of a whole dissertation (if not several). [[Special:Contributions/141.101.107.80|141.101.107.80]] 00:22, 2 June 2020 (UTC)<br />
<br />
Does this mean all programming languages evolve into Rust?[[Special:Contributions/172.69.68.87|172.69.68.87]] 23:08, 1 June 2020 (UTC)<br />
<br />
Is it just a coincidence that today's Questionable Content also contained a reference to crabs? [[Special:Contributions/172.69.68.195|172.69.68.195]] 00:31, 2 June 2020 (UTC)<br />
<br />
It may be of note that Qwantz (a comic previously parodied in [[145]]) did a [http://www.qwantz.com/index.php?comic=3547 comic about carcinisation] earlier this year [[Special:Contributions/162.158.158.179|162.158.158.179]] 01:08, 2 June 2020 (UTC)<br />
:Why do you call Dinosaur Comic Qwantz? --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:51, 2 June 2020 (UTC)<br />
<br />
Gotta say, this is the first xkcd in a while that made me laugh. [[User:Lightcaller|Lightcaller]] ([[User talk:Lightcaller|talk]]) 03:49, 2 June 2020 (UTC)<br />
<br />
Nature: Time for crab [[Special:Contributions/162.158.50.204|162.158.50.204]] 04:58, 2 June 2020 (UTC)<br />
<br />
This comic was posted 3 weeks too early, seeing as Cancer doesn't start until June 21 or 22 [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 12:34, 2 June 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2313:_Wrong_Times_Table&diff=192715Talk:2313: Wrong Times Table2020-06-01T13:35:05Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
Such an illogical table. Smaller numbers multiply to larger answers than larger numbers? Even numbers multiply to odd numbers?! How?!?! What sort of illiterate alien declared this to be the multiplication table?! [[Special:Contributions/108.162.221.101|108.162.221.101]] 20:54, 29 May 2020 (UTC)<br />
<br />
This is easily one of the worst XKCD comics, period. Not funny, nor clever. Just seems like noise. [[Special:Contributions/172.69.68.183|172.69.68.183]] 20:57, 29 May 2020 (UTC)<br />
:I suspect Randall may have just been feeling random, perhaps after several months of mostly Coronavirus-related comics. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 21:13, 29 May 2020 (UTC)<br />
::That's fair, I'm being a bit harsh, but this just comes across as exceptionally meaningless and contrived, so much so that I felt the need to come here and comment immediately for the first time ever [[Special:Contributions/172.69.71.56|172.69.71.56]] 21:18, 29 May 2020 (UTC)<br />
:I relate to certain mathematical facts not sounding right, like how 54 intuitively feels like it's divisible by 4. Nonsensical, but makes sense anyway. [[Special:Contributions/162.158.62.233|162.158.62.233]] 21:42, 29 May 2020 (UTC)<br />
<br />
This seems like the multiplication equivalent of looking at a word and thinking it is spelled incorrectly. Sometimes I look at a simple word like "fish" and think: "That can't be right." Sometimes multiplication can feel that way, particularly 7's because those were tricky for some reason. The alt text confirms fishiness with 7's [[Special:Contributions/108.162.246.173|108.162.246.173]] 21:09, 29 May 2020 (UTC)<br />
:Is it weird that I ''don't'' get this? I have this sense of "that is obviously wrong" when it comes to multiplication of small numbers like these, even with sevens and eights. If I read that 7 * 8 = 54, my brain screams "NOOOOOOOOO IT IS 56 YOU IDIOT!". [[Special:Contributions/108.162.221.101|108.162.221.101]] 21:14, 29 May 2020 (UTC)<br />
<br />
Well, 2,2 that's actually 2^3=8. 2,3 is addition instead of multiplication. 1,2 is division instead of multiplication. 1,1 is subtraction. 10,10 seems to be a visual gag, though most of the 10s row is either multiplication by 11 or 12... There's some logic to some of these, but it's different for each row, column, or cell. [[Special:Contributions/162.158.74.167|162.158.74.167]] 21:13, 29 May 2020 (UTC)<br />
:Yeah, there is something going on. It looks like a lot of it is remembering the correct answer to a different problem. By my count 55 squares are the correct answer to a square next to it and 31 have a correct answer for somewhere else on the grid. Also, 2*2, 4*4 and 5*5 are double the correct answer.[[Special:Contributions/108.162.245.76|108.162.245.76]] 21:41, 29 May 2020 (UTC)<br />
<br />
It's almost disappointing that he didn't hide one or two asymmetries in there just to throw us off! [[Special:Contributions/108.162.216.114|108.162.216.114]] 22:04, 29 May 2020 (UTC)<br />
<br />
I get the idea that this is the sort of table you'd get if you tried to train an Adversarial AI from scratch to determine x*y purely by stocastic guessing and comparing to a co-evolving 'scorer' that also starts off naively but supports each answer according to the 'rightness' it thinks it has ''except'' for the real answer which is always hard-coded to be down-scored. (Also noting that DA reportedly came by his choice of 42 by asking people which numbers were 'funnier' than others, which can be said to be a similar kind of process but without the arrayed "original multiplication" element.) [[Special:Contributions/162.158.158.179|162.158.158.179]] 22:13, 29 May 2020 (UTC)<br />
<br />
As someone who often confuses 7*8 as 54, I found the alt text very humorous. [[Special:Contributions/172.69.34.118|172.69.34.118]] 22:29, 29 May 2020 (UTC)<br />
<br />
I'm disappointed to see that 6*9 isn't equal to 42. [[User:Probably not Douglas Hofstadter|Probably not Douglas Hofstadter]] ([[User talk:Probably not Douglas Hofstadter|talk]]) 23:01, 29 May 2020 (UTC)<br />
<br />
This is just a collection of equations with the wrong answers. I'm not sure who finds this funny. [[Special:Contributions/108.162.219.96|108.162.219.96]] 00:33, 30 May 2020 (UTC)<br />
<br />
https://www.explainxkcd.com/wiki/index.php/1210:_I%27m_So_Random[[User:Overlord of oddities|Overlord of oddities]] ([[User talk:Overlord of oddities|talk]]) 01:16, 30 May 2020 (UTC)<br />
<br />
I have asked [https://codegolf.stackexchange.com/q/205425/67157 a Code Golf Stack Exchange question] with the goal of producing the shortest program that computes this function. [[User:Aaron Rotenberg|Aaron Rotenberg]] ([[User talk:Aaron Rotenberg|talk]]) 02:29, 30 May 2020 (UTC) @Aaron I had a similar thought, but was going to settle for the generator function for the main diagonal. If we can come up with one, we should submit it to https://oeis.org/ [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 13:30, 1 June 2020 (UTC)<br />
<br />
I'm disappointed that 17 does not show up in any product cell, seeing as I've known since at least 1970 that 17 is the world's most random number. <-- a fact proved for a limited case here: https://www.youtube.com/watch?v=2JPSJL7Kvus [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 13:35, 1 June 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2313:_Wrong_Times_Table&diff=192713Talk:2313: Wrong Times Table2020-06-01T13:30:43Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
Such an illogical table. Smaller numbers multiply to larger answers than larger numbers? Even numbers multiply to odd numbers?! How?!?! What sort of illiterate alien declared this to be the multiplication table?! [[Special:Contributions/108.162.221.101|108.162.221.101]] 20:54, 29 May 2020 (UTC)<br />
<br />
This is easily one of the worst XKCD comics, period. Not funny, nor clever. Just seems like noise. [[Special:Contributions/172.69.68.183|172.69.68.183]] 20:57, 29 May 2020 (UTC)<br />
:I suspect Randall may have just been feeling random, perhaps after several months of mostly Coronavirus-related comics. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 21:13, 29 May 2020 (UTC)<br />
::That's fair, I'm being a bit harsh, but this just comes across as exceptionally meaningless and contrived, so much so that I felt the need to come here and comment immediately for the first time ever [[Special:Contributions/172.69.71.56|172.69.71.56]] 21:18, 29 May 2020 (UTC)<br />
:I relate to certain mathematical facts not sounding right, like how 54 intuitively feels like it's divisible by 4. Nonsensical, but makes sense anyway. [[Special:Contributions/162.158.62.233|162.158.62.233]] 21:42, 29 May 2020 (UTC)<br />
<br />
This seems like the multiplication equivalent of looking at a word and thinking it is spelled incorrectly. Sometimes I look at a simple word like "fish" and think: "That can't be right." Sometimes multiplication can feel that way, particularly 7's because those were tricky for some reason. The alt text confirms fishiness with 7's [[Special:Contributions/108.162.246.173|108.162.246.173]] 21:09, 29 May 2020 (UTC)<br />
:Is it weird that I ''don't'' get this? I have this sense of "that is obviously wrong" when it comes to multiplication of small numbers like these, even with sevens and eights. If I read that 7 * 8 = 54, my brain screams "NOOOOOOOOO IT IS 56 YOU IDIOT!". [[Special:Contributions/108.162.221.101|108.162.221.101]] 21:14, 29 May 2020 (UTC)<br />
<br />
Well, 2,2 that's actually 2^3=8. 2,3 is addition instead of multiplication. 1,2 is division instead of multiplication. 1,1 is subtraction. 10,10 seems to be a visual gag, though most of the 10s row is either multiplication by 11 or 12... There's some logic to some of these, but it's different for each row, column, or cell. [[Special:Contributions/162.158.74.167|162.158.74.167]] 21:13, 29 May 2020 (UTC)<br />
:Yeah, there is something going on. It looks like a lot of it is remembering the correct answer to a different problem. By my count 55 squares are the correct answer to a square next to it and 31 have a correct answer for somewhere else on the grid. Also, 2*2, 4*4 and 5*5 are double the correct answer.[[Special:Contributions/108.162.245.76|108.162.245.76]] 21:41, 29 May 2020 (UTC)<br />
<br />
It's almost disappointing that he didn't hide one or two asymmetries in there just to throw us off! [[Special:Contributions/108.162.216.114|108.162.216.114]] 22:04, 29 May 2020 (UTC)<br />
<br />
I get the idea that this is the sort of table you'd get if you tried to train an Adversarial AI from scratch to determine x*y purely by stocastic guessing and comparing to a co-evolving 'scorer' that also starts off naively but supports each answer according to the 'rightness' it thinks it has ''except'' for the real answer which is always hard-coded to be down-scored. (Also noting that DA reportedly came by his choice of 42 by asking people which numbers were 'funnier' than others, which can be said to be a similar kind of process but without the arrayed "original multiplication" element.) [[Special:Contributions/162.158.158.179|162.158.158.179]] 22:13, 29 May 2020 (UTC)<br />
<br />
As someone who often confuses 7*8 as 54, I found the alt text very humorous. [[Special:Contributions/172.69.34.118|172.69.34.118]] 22:29, 29 May 2020 (UTC)<br />
<br />
I'm disappointed to see that 6*9 isn't equal to 42. [[User:Probably not Douglas Hofstadter|Probably not Douglas Hofstadter]] ([[User talk:Probably not Douglas Hofstadter|talk]]) 23:01, 29 May 2020 (UTC)<br />
<br />
This is just a collection of equations with the wrong answers. I'm not sure who finds this funny. [[Special:Contributions/108.162.219.96|108.162.219.96]] 00:33, 30 May 2020 (UTC)<br />
<br />
https://www.explainxkcd.com/wiki/index.php/1210:_I%27m_So_Random[[User:Overlord of oddities|Overlord of oddities]] ([[User talk:Overlord of oddities|talk]]) 01:16, 30 May 2020 (UTC)<br />
<br />
I have asked [https://codegolf.stackexchange.com/q/205425/67157 a Code Golf Stack Exchange question] with the goal of producing the shortest program that computes this function. [[User:Aaron Rotenberg|Aaron Rotenberg]] ([[User talk:Aaron Rotenberg|talk]]) 02:29, 30 May 2020 (UTC) @Aaron I had a similar thought, but was going to settle for the generator function for the main diagonal. If we can come up with one, we should submit it to https://oeis.org/ [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 13:30, 1 June 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2312:_mbmbam&diff=192597Talk:2312: mbmbam2020-05-28T11:58:24Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
So ... what would the MMMbop unit be?<br />
<br />
This has gotta be at least the third or fourth time he's referenced MBMBaM. https://what-if.xkcd.com/155/ and https://xkcd.com/1836/ I know are two more examples, but there might be more. [[Special:Contributions/162.158.107.13|162.158.107.13]] 00:54, 28 May 2020 (UTC)<br />
<br />
Am I the only one thinking that mbmbam should be a unit of ''work'', not energy? Force x distance... High school physics was a long time ago though. [[User:Philosophicles|Philosophicles]] ([[User talk:Philosophicles|talk]]) 03:15, 28 May 2020 (UTC)<br />
<br />
:Work is energy [[Special:Contributions/172.69.62.154|172.69.62.154]] 05:28, 28 May 2020 (UTC)<br />
<br />
:: The only difference could be absolute or relative energy, comparable to height above sea level vs. distance. Sebastian --[[Special:Contributions/141.101.69.193|141.101.69.193]] 06:36, 28 May 2020 (UTC)<br />
<br />
:My first instinct was "that´s a torque". But of course angles have no unit, and so torque and energy must have the same. --[[Special:Contributions/162.158.88.74|162.158.88.74]] 07:15, 28 May 2020 (UTC)<br />
<br />
Is my vision going blurry, or does that second panel say "milliibarn"? -- [[User:Peregrine|Peregrine]] ([[User talk:Peregrine|talk]]) 09:09, 28 May 2020 (UTC)<br />
<br />
: Yes, two 'i' before the barn. That must be a mistake. --[[Special:Contributions/108.162.229.192|108.162.229.192]] 10:28, 28 May 2020 (UTC) <-- Either that or it's milli - i*barn, going into imaginary dimensions. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 11:58, 28 May 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2309:_X&diff=192365Talk:2309: X2020-05-22T14:03:07Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
id certainly use that language lol ([[User talk:172.69.70.101|172.69.70.101]])<br />
<br />
-- haXkell is a X-based dialect of haskell<br/><br />
<span style="font-family: 'Comic Sans MS';">X</span> :: Integer -> Integer<br/><br />
<span style="font-family: 'Comic Sans MS';">X</span> 0 = 1<br/><br />
<span style="font-family: 'Comic Sans MS';">X</span> X = X * <span style="font-family: 'Comic Sans MS';">X</span> (X-1)<br/><br />
[[User:Capncanuck|Capncanuck]] ([[User talk:Capncanuck|talk]]) 02:35, 21 May 2020 (UTC)<br />
<br />
https://esolangs.org/wiki/X isn't taken. --[[User:Blacksilver|Blacksilver]] ([[User talk:Blacksilver|talk]]) 02:40, 21 May 2020 (UTC)<br />
<br />
Some unique looking variable names would be X and x in the fonts Webdings, Wingdings, Wingdings 2, and Wingdings 3.<br/><br />
They are respectively as follows:<br/><br />
<span style="font-family: 'Webdings';">X</span><br />
<span style="font-family: 'Webdings';">x</span><br />
<span style="font-family: 'Wingdings';">X</span><br />
<span style="font-family: 'Wingdings';">x</span><br />
<span style="font-family: 'Wingdings 2';">X</span><br />
<span style="font-family: 'Wingdings 2';">x</span><br />
<span style="font-family: 'Wingdings 3';">X</span><br />
<span style="font-family: 'Wingdings 3';">x</span> --[[User:Dstrube|Dstrube]] ([[User talk:Dstrube|talk]]) 02:49, 21 May 2020 (UTC)<br/><br />
:This comment is quite uninformative to someone who doesn't have those fonts installed. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 09:57, 21 May 2020 (UTC)<br />
:: This comment highlights another issue with Cueball's language. [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 11:22, 21 May 2020 (UTC)<br />
<br />
As well as esolangs, among which I would consider the likes of Whitespace and b****fuck as potential inspirations, I think I'm also minded of TempleOS and its creator as vaguer but possibly still related influences... [[Special:Contributions/162.158.158.163|162.158.158.163]] 03:28, 21 May 2020 (UTC)<br />
:I find it ironic that you censored the word "brain" but left in the word "fuck". <br />
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 16:09, 21 May 2020 (UTC)<br />
<br />
I added an explanation of what a variable is and why it's bad to have every one named X. It's pretty rudimentary though, hope someone more experienced than me will improve it. [[User:Unpopular Opinions|Goodbye, world!]] ([[User talk:Unpopular Opinions|talk]]) 04:39, 21 May 2020 (UTC)<br />
<br />
:Forth basically doesn't use variable names. Commands operate on and consume the last number mentioned. A Forth program "1 2 3 . . ." prints 3, then 2, then 1. "2 3 + ." prints 5 I think??<br />
:In Microsoft "Transact-SQL" you can script variables named starting @ and temporary objects starting #. I promise I try to resist naming objects @ or # and especially if @ or # is going to be a different object in each program... or is not. And if someone else needs to reads this (and I don't want to punish them). Not to mention "@ " for instance. Robert Carnegie rja.carnegie@gmail.com [[Special:Contributions/141.101.98.54|141.101.98.54]] 09:21, 21 May 2020 (UTC)<br />
<br />
Psh you're all chicken. Chicken chicken chicken.<br />
<br />
<br />
[[https://media.discordapp.net/attachments/677507038607048704/706860858587873310/ShapeLikeItSelf_img1.png?width=282&height=209 Language where you can have return keyword in a if condition]],<br />
[[https://media.discordapp.net/attachments/677507038607048704/712914169774735441/unknown.png?width=292&height=103 Language that uses unicode symbols for built_in operators]],<br />
[[https://media.discordapp.net/attachments/677507038607048704/712915431446282240/unknown.png?width=396&height=379 Language, I have no words to describe]],<br />
and this this '''X''' thing is winning so far...<br />
[[Special:Contributions/162.158.89.139|162.158.89.139]] 06:35, 21 May 2020 (UTC)<br />
<br />
:Yeah, but C++ does that shit either '''unintentionally''' or '''at user demand''' (although, to be clear, I'm not saying it's any good; C++ and Java are possibly the worst programming languages in terms of shoddy design). The X programming language is just the designer being an asshole. [[Special:Contributions/172.68.189.205|172.68.189.205]] 07:04, 21 May 2020 (UTC)<br />
::Those links have nothing to do with C++/Java and you can Not do those things in C++ or Java (except an if in an assignment).[[Special:Contributions/162.158.92.208|162.158.92.208]] 08:02, 21 May 2020 (UTC)<br />
:Those look like pretty sane language features; just looks weird because of the Eliza effect; those keywords don't behave like you'd expect them to based on experience of other languages. In the first example, you can certainly do that in Perl using "if (defined wantarray)"; it's just unusual (but comprehensible) to name the keyword "return". What language is that? [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 09:57, 21 May 2020 (UTC)<br />
::Language is called ShapedLikeItSelf, but it currently has no runner. Documentation is just of images like these on discord server.<br />
::[[https://discord.gg/ercPss9 This is link to it]] if you are intersted. [[Special:Contributions/162.158.89.19|162.158.89.19]] 10:19, 21 May 2020 (UTC)<br />
<br />
Did Randall refer to this comic? https://xkcd.com/1537/<br />
I vaguely remember another one about an esoteric language. Is there a category of programming languages on explainxkcd?<br />
<br />
Am I the only one that tried fiddling the CSS on the page to see if the X would change? Spoiler -> It didn't. [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 08:54, 21 May 2020 (UTC)<br />
<br />
If X is the only variable name, can it be omitted? For example, writing a single-argument function name in a different font to imply which X should be treated as its argument. And that gets me wondering how the source is stored; will the IDE allow use of fonts not installed on your system? Will the compiler fail if it can't find the font, requiring you to track down all of the fonts a developer used in order to compile their code? And what would be the legality of mixing open-source code and proprietary fonts? [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 09:57, 21 May 2020 (UTC)<br />
<br />
"… and array indices start at 8, because anything smaller than that would be unreadable." [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 10:00, 21 May 2020 (UTC)<br />
<br />
Who is going to implement this first??[[Special:Contributions/108.162.216.122|108.162.216.122]] 13:03, 21 May 2020 (UTC)<br />
<br />
Hey guys what coding language did he do to almost be arrested? [[Special:Contributions/162.158.187.139|162.158.187.139]] 14:18, 21 May 2020 (UTC)Anonymous<br />
:Well, I've got this one with just four operands, everything's a relative address in 4-cored circular memory and there's no paractical differentiation between the packed opcodes, addresses and data (or their 2-bit lower-limit boundaries) when operated upon from elsewhere. Everything suggests it should be be Turing-complete. [[Special:Contributions/162.158.155.242|162.158.155.242]] 11:47, 22 May 2020 (UTC)<br />
<br />
Isn't the fixed vs variable width a pun on the variable's internal size, eg. a 64-bit integer [fixed width) vs a string (variable width) ?<br />
<br />
I sure hope this new language at least supports indexed tuples. If so, that wouldn't be so bad, unless for some reason I needed more than one tuple in the same scope.[[User:Whiteheadw|Whiteheadw]] ([[User talk:Whiteheadw|talk]]) 23:01, 21 May 2020 (UTC)<br />
<br />
Harrumph. I'm sticking with LOLcode http://www.lolcode.org/ and thats an end of it. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 14:03, 22 May 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2308:_Mount_St._Helens&diff=192274Talk:2308: Mount St. Helens2020-05-20T11:44:53Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
I'm just excited that he mentioned my home state [[Special:Contributions/108.162.246.251|108.162.246.251]] 16:20, 19 May 2020 (UTC)<br />
<br />
I suspect the wiggles in all the hand-drawn lines are actually more than the changes in height of the various mountains, and almost certainly not correlated to the actual changes in height, since this is all unknown. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 00:56, 19 May 2020 (UTC)<br />
<br />
This comic needs to be translated to non-retard units [[Special:Contributions/162.158.155.212|162.158.155.212]] 07:41, 19 May 2020 (UTC) <-- don't use "retard." That's really gay. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 11:42, 20 May 2020 (UTC)<br />
<br />
:We can't expect everyone to be scientifically literate enough to understand measuring things with the planck length, superior though it may be. Besides, these are American mountains, so they're measured in American units. [[Special:Contributions/108.162.246.251|108.162.246.251]] 16:20, 19 May 2020 (UTC)<br />
:It's pretty common to measure things in years. And while measuring in 20 year gaps isn't normal, I wouldn't call it retarded, especially when they're probably chosen for a good visual spacing. [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 08:54, 19 May 2020 (UTC)<br />
::Maybe he meant feet, which is not a SI unit. I guess the user got the wrong feet out of bed this morning? ;-) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 10:04, 19 May 2020 (UTC)<br />
:All twentyish attoparsecs, you mean? (Yanks like using measures that give them bigger numbers. Feet instead of metres, inches instead of metres (or feet-and-inches), pounds instead of kilos (or stones-and-kilos), US gallons instead of UK ones, the wrong sort of billion/etc. :P ) [[Special:Contributions/162.158.159.76|162.158.159.76]] 11:22, 19 May 2020 (UTC)<br />
::I think the graph should be labeled in seconds. I mean, gigaseconds for time and light microseconds for distance. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 02:55, 20 May 2020 (UTC)<br />
<br />
:Wow you're so cool and epic for using slurs good job<br />
<br />
Could be linked to sudden changes to covid-19 charts due to lockdowns [[Special:Contributions/162.158.34.222|162.158.34.222]] 12:12, 19 May 2020 (UTC)<br />
:It might have been inspired by the art installation where someone cut off the peak (one inch of rock) of Scafell Pike.<br />
<br />
According to the wikipedia article, "The eruption ejected more than one cubic mile (4.2 km^3) of material." That's going to be billions of tonnes, rather than the thousands mentioned in the explanation. [[Special:Contributions/162.158.154.31|162.158.154.31]] 15:23, 19 May 2020 (UTC) I don't think I'm going to be able to contribute here any more if I keep having to provide free training for Google's image recognition of weird American street scenes. What's a "crosswalk" and what does it look like anyway?<br />
: A "crosswalk" is a "{{w|pedestrian crossing}}" in other types of English). [[Special:Contributions/108.162.215.124|108.162.215.124]] 16:46, 19 May 2020 (UTC)<br />
<br />
<br />
I suspect the true slope of the line during that transition period is a heck of a lot closer to negative infinity than as drawn. #itsajokedammit [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 11:44, 20 May 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2308:_Mount_St._Helens&diff=192273Talk:2308: Mount St. Helens2020-05-20T11:42:40Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
I'm just excited that he mentioned my home state [[Special:Contributions/108.162.246.251|108.162.246.251]] 16:20, 19 May 2020 (UTC)<br />
<br />
I suspect the wiggles in all the hand-drawn lines are actually more than the changes in height of the various mountains, and almost certainly not correlated to the actual changes in height, since this is all unknown. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 00:56, 19 May 2020 (UTC)<br />
<br />
This comic needs to be translated to non-retard units [[Special:Contributions/162.158.155.212|162.158.155.212]] 07:41, 19 May 2020 (UTC) <-- don't use "retard." That's really gay. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 11:42, 20 May 2020 (UTC)<br />
<br />
:We can't expect everyone to be scientifically literate enough to understand measuring things with the planck length, superior though it may be. Besides, these are American mountains, so they're measured in American units. [[Special:Contributions/108.162.246.251|108.162.246.251]] 16:20, 19 May 2020 (UTC)<br />
:It's pretty common to measure things in years. And while measuring in 20 year gaps isn't normal, I wouldn't call it retarded, especially when they're probably chosen for a good visual spacing. [[User:Mikemk|Mikemk]] ([[User talk:Mikemk|talk]]) 08:54, 19 May 2020 (UTC)<br />
::Maybe he meant feet, which is not a SI unit. I guess the user got the wrong feet out of bed this morning? ;-) --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 10:04, 19 May 2020 (UTC)<br />
:All twentyish attoparsecs, you mean? (Yanks like using measures that give them bigger numbers. Feet instead of metres, inches instead of metres (or feet-and-inches), pounds instead of kilos (or stones-and-kilos), US gallons instead of UK ones, the wrong sort of billion/etc. :P ) [[Special:Contributions/162.158.159.76|162.158.159.76]] 11:22, 19 May 2020 (UTC)<br />
::I think the graph should be labeled in seconds. I mean, gigaseconds for time and light microseconds for distance. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 02:55, 20 May 2020 (UTC)<br />
<br />
:Wow you're so cool and epic for using slurs good job<br />
<br />
Could be linked to sudden changes to covid-19 charts due to lockdowns [[Special:Contributions/162.158.34.222|162.158.34.222]] 12:12, 19 May 2020 (UTC)<br />
:It might have been inspired by the art installation where someone cut off the peak (one inch of rock) of Scafell Pike.<br />
<br />
According to the wikipedia article, "The eruption ejected more than one cubic mile (4.2 km^3) of material." That's going to be billions of tonnes, rather than the thousands mentioned in the explanation. [[Special:Contributions/162.158.154.31|162.158.154.31]] 15:23, 19 May 2020 (UTC) I don't think I'm going to be able to contribute here any more if I keep having to provide free training for Google's image recognition of weird American street scenes. What's a "crosswalk" and what does it look like anyway?<br />
: A "crosswalk" is a "{{w|pedestrian crossing}}" in other types of English). [[Special:Contributions/108.162.215.124|108.162.215.124]] 16:46, 19 May 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2307:_Alive_Or_Not&diff=192161Talk:2307: Alive Or Not2020-05-18T10:51:46Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
I'm pretty sure high-pressure fire hoses belong on this scale[[User:60sRefugee|60sRefugee]] ([[User talk:60sRefugee|talk]]) 21:47, 15 May 2020 (UTC)<br />
:What about wacky waving inflatable tube guy? [[Special:Contributions/172.68.38.124|172.68.38.124]] 00:41, 16 May 2020 (UTC)<br />
<br />
Funny, for once viruses are said to be alive. That's new... [[Special:Contributions/141.101.107.138|141.101.107.138]] 22:01, 15 May 2020 (UTC)<br />
:Definitely new, and extremely angering! I could scream... [[Special:Contributions/172.68.143.30|172.68.143.30]] 22:47, 15 May 2020 (UTC)<br />
::Jup. The nex disgusting piece of antiscience after Wednesday´s nonsense about handwashing helping against respirational diseases. I think Monroe has caught a bug from Potus Donald. --[[Special:Contributions/141.101.69.33|141.101.69.33]] 07:44, 16 May 2020 (UTC)<br />
<br />
Do we want to bicker over the placement of the line (like "Why is it below viruses"), or the order things are placed in (like "Why are slime molds below plants")? [[User:GreatWyrmGold|GreatWyrmGold]] ([[User talk:GreatWyrmGold|talk]]) 22:06, 15 May 2020 (UTC)<br />
: Oh, go on. If you insist. You go first, unless you already have. ;) [[Special:Contributions/162.158.154.31|162.158.154.31]] 22:46, 15 May 2020 (UTC)<br />
: Seconded, I'm most interested which criterion (even a numeric one, as the diagram is suggestive of) Randall used. [[Special:Contributions/162.158.158.163|162.158.158.163]] 09:43, 16 May 2020 (UTC)<br />
<br />
True fossils have remineralised so generally do not have DNA left. They are merely the shadow of a previous life.<br />
: So fossils are closer to "Rocks with Faces," well, for the ancient vertebrate fossils anyway? [[User:Nutster|Nutster]] ([[User talk:Nutster|talk]]) 15:36, 16 May 2020 (UTC)<br />
<br />
Surprised no one has noticed the typo yet. It's 'archaea', not 'archea'<br />
:(Sign yourself(/ves), "True fossils" and "Surprised"?) I disagree. It's 'archæa'... [[Special:Contributions/162.158.154.31|162.158.154.31]] 22:46, 15 May 2020 (UTC)<br />
<br />
Poor English and a mistake. It should say...<br />
"...discussion about *whether* virus*es* are alive." <br />
Also the (covid for starters) is wrong. Covid19 is the disease caused by the virus (as mentioned in the line above) not the virus itself<br />
<br />
I am disappointed that sponges are not mentioned as an example of weird animals. I mean, come on, way weirder than jellyfish. But it is good that viruses get the recognition they deserve.[[User:Jkrstrt|Jkrstrt]] ([[User talk:Jkrstrt|talk]]) 13:34, 16 May 2020 (UTC)<br />
<br />
When looking at viruses, I consider them made of the things of life (proteins, lipids, nucleic acids), but are not actually alive as they have no metabolism and can not reproduce on their own; they need to co-opt the protein production facility of truly living cells in order to reproduce. Without a host, they just sit there (or maybe blow around on the wind). Also without metabolism, they can not starve to death, like bacteria and other single-cell organisms that get into the wrong environment. [[User:Nutster|Nutster]] ([[User talk:Nutster|talk]]) 15:36, 16 May 2020 (UTC)<br />
<br />
Well, this raises the question where the sun (or any main sequence star) fall on this list. Is it just a really big thermonuclear fire?<br />
<br />
This is not a COVID-19 comic. Just because it is biology-related, doesn't make it a COVID-19 comic. I have removed it from the category and its mention in the explanation.[[Special:Contributions/172.69.34.38|172.69.34.38]] 07:33, 17 May 2020 (UTC)<br />
:Of course it is. The whole idea about this comic is to spark the discussion if Virus (covid) is alive or not. I put it back. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 21:59, 17 May 2020 (UTC)<br />
::I fully disagree, this comic could have been published in previous years. This is only tangentially related to COVID-19, and is a general discussion about "life". Viruses are only barely mentioned in this comic. [[Special:Contributions/172.69.34.38|172.69.34.38]] 23:26, 17 May 2020 (UTC)<br />
:::Agree it shouldn't be classified as COVID-19, but then there's a bunch of others that should be removed: 2278, 2283, 2289, 2292, 2293.[[Special:Contributions/141.101.107.78|141.101.107.78]] 08:34, 18 May 2020 (UTC)<br />
<br />
Somewhat disappointed that he didn't include any fictional items such as golems. For that matter, where to place Alexa? [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 10:51, 18 May 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2306:_Common_Cold&diff=192044Talk:2306: Common Cold2020-05-15T11:08:01Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
WHEN COVID19 IS DONE KEEP UP WITH THE HAND WASHING![[Special:Contributions/108.162.216.122|108.162.216.122]] 23:16, 13 May 2020 (UTC)<br />
<br />
I saw a thing reshared some time last month claiming that after the hand-sanitizer-and-masks outbreak in Japan, some regions were recording record low numbers of influenza hospitalisations for this time of year. Thought that would be nice; but could only find unsourced claims. Would be nice to think there really was that kind of silver lining. [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 23:30, 13 May 2020 (UTC)<br />
:Since people are really staying away from each other, the only way flu and common cold can spread has also been eliminated. So of course the rate has dropped. But yes, would be nice to see some citations. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 12:13, 14 May 2020 (UTC)<br />
::Found this [https://www.abc.net.au/news/2020-04-17/coronavirus-numbers-flu-tracking-data/12134082 Coronavirus isolation measures are reducing all flu-like diseases, not just COVID-19].--[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 12:15, 14 May 2020 (UTC)<br />
::And this is more up to date: [https://www.straitstimes.com/singapore/health/coronavirus-doctors-see-huge-drop-in-flu-common-cold-diarrhoea-and-conjunctivitis Coronavirus: Doctors see huge drop in flu, common cold, diarrhoea and conjunctivitis cases since circuit breaker measures]. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 12:16, 14 May 2020 (UTC)<br />
:::While this SEEMS good news, I have wondered for a while now if, by eliminating harmless cold viruses that our immune systems are more or less accustomed to as "collateral damage", we might not accidentally open up new ecological niches, which then get occupied by MORE new pathogens that our immune systems are NOT accustomed to. So, it may actually a good idea to consider that deal.... --[[Special:Contributions/162.158.159.122|162.158.159.122]] 13:50, 14 May 2020 (UTC)<br />
::::I don't think cold viruses are thought to be part of healthy gut flora (or [[1471: Gut Fauna|gut fauna]]), but the "{{w|hygiene hypothesis}}" posits that failure to properly seed the microbiome in early childhood (i.e. not enough dirt in life) may lead to increased prevalence of allergies and other autoimmune disorders, because (perhaps) the immune system is under-exercised and so some of its regulatory mechanisms are under-developed. --[[User:NotaBene|NotaBene]] ([[User talk:NotaBene|talk]]) 15:02, 14 May 2020 (UTC)<br />
::::: Stepping up the speculativeness up a notch, an immune systeme permanently on the alert by flu might be good against cancer. That said, maybe the poor virii should just try to look more cute? [[Special:Contributions/162.158.159.90|162.158.159.90]] 08:09, 15 May 2020 (UTC)<br />
<br />
<br />
::::By social distancing, we are not harming cold viruses more than anything else ; what we are doing is basically shrinking the ecological niche containing it. So, no ... unless we will be so good in it we really eliminate cold viruses and when we do, we will then stop social distancing and grow the ecological niche again. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 22:16, 14 May 2020 (UTC)<br />
<br />
<br />
You guys are engaging in uneducated speculation. PLEASE STOP! Viruses are nothing at all like bacteria (which make up the gut biome). The mere fact that we need new influenza vaccines every year should make it clear that exposure to flu virus does nothing to generate "multi-capable antibodies" . Yes, playing in dirt may build up the immune system's ability to handle bacterial loads, but no it has nothing to do with viruses. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 11:08, 15 May 2020 (UTC)<br />
<br />
According to Taiwan National Infectious Disease Statistics System, the [https://nidss.cdc.gov.tw/en/SingleDisease.aspx?dc=1&dt=4&disease=487a&position=1 number of severe influenza cases in Taiwan] was 109 on week 1 of 2020, then drop to zero since March. [[Special:Contributions/172.69.34.58|172.69.34.58]] 04:54, 14 May 2020 (UTC)<br />
<br />
Based on the railroad's Twitter feed which announces when service is suspended because someone got hit by a train, it seems that deaths from being hit by trains are down where I live. I'd expect some reduction in accidental deaths due to fewer trains per day running. However, the reduction in deaths is greater than the reduction in train service, so that's not the full explanation, especially since most of the deaths were suicides.[[Special:Contributions/108.162.215.250|108.162.215.250]] 05:27, 14 May 2020 (UTC)<br />
: Has the general rate of suicide changed? [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 16:35, 14 May 2020 (UTC)<br />
:: In Finland the sucide rate has been up [https://yle.fi/uutiset/3-11351803 15% this spring].<br />
<br />
Was this comic posted a day late? [[Special:Contributions/172.69.130.10|172.69.130.10]] 11:36, 14 May 2020 (UTC)<br />
:No. But the DGBRt bot that uploads the comic is in the wrong time zone and there it was May 14th. But in the archive on xkcd it is listed as a May 13 release. I have corrected the wrong date. This has happened with two comics now over the last few releases. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 12:11, 14 May 2020 (UTC)<br />
<br />
Current transcript indicates he is shouting the "no" in the last frame. I read this significantly more as an extremely forceful spoken word, not so much "THIS IS SPARTA!" [[User:OhFFS|OhFFS]] ([[User talk:OhFFS|talk]]) 16:04, 14 May 2020 (UTC)<br />
:Agree. Fixed. [[User:N0lqu|-boB]] ([[User talk:N0lqu|talk]]) 21:21, 14 May 2020 (UTC)<br />
<br />
I AM THE DREAD FAUCET ROBERTS. THERE WILL BE ''NO SURVIVORS''! [[Special:Contributions/108.162.250.67|108.162.250.67]] 00:45, 15 May 2020 (UTC)<br />
<br />
<br />
In the end, the only way to eliminate it *finally,* for good, is either almost everyone has immunity, or social distancing, contact tracing and similar measures. No matter how difficult. If immunity doesn't last long, then you've got a permanent problem unless social distancing can be maintained INDEFINITELY. And I want to point out that the problem becomes not just permanent but gains the potential to kill faster than people can breed. [[Special:Contributions/108.162.246.251|108.162.246.251]] 10:26, 15 May 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2305:_Coronavirus_Polling&diff=191962Talk:2305: Coronavirus Polling2020-05-13T11:40:38Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
Wow am I first? If you want to get the public disunited, wait till you start to try to lift lockdown. Everyone has a different opinion of what to do first and when to do it! From Wales (Dis-UK) [[User:RIIW - Ponder it|RIIW - Ponder it]] ([[User talk:RIIW - Ponder it|talk]]) 20:14, 11 May 2020 (UTC)<br />
<br />
Worth mentioning is the the last COVID poll referenced [http://www.politico.com/news/2020/04/15/poll-dont-stop-social-distancing-coronavirus-spread-187290] is actually a month old as of the publication of this comic ("The poll was conducted April 10-12" - whereas the comic is dated May 11.) I suspect the 81% number has shifted in the time since that poll data was current.[[Special:Contributions/172.69.68.157|172.69.68.157]] 20:28, 11 May 2020 (UTC)MeZimm<br />
<br />
Ummm... "...is remarkably unanimous...", etc, in the description. Isn't that like "very unique" when there it isn't the only example? ("A large proportion are unanimous, with very few others who demur" or something?) [[Special:Contributions/162.158.159.142|162.158.159.142]] 22:13, 11 May 2020 (UTC)<br />
<br />
2011? Why would so many people felt positive about Betty White in 2011? -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 22:38, 11 May 2020 (UTC)<br />
:Beats me, I had to come to explainxkcd to find out who Betty White was.<br />
<br />
I'd just like to point out that this means 24% of people do not feel positively toward kittens, 11% of people think fair elections are unimportant for democracy, and 14% of people think Kim Jong-Un can be trusted to do the right thing. [[Special:Contributions/108.162.215.216|108.162.215.216]] 22:52, 11 May 2020 (UTC)<br />
:That isn't quite right: all those polls included a neutral option. --[[Special:Contributions/172.69.135.210|172.69.135.210]] 05:00, 12 May 2020 (UTC)<br />
::And there could also have been and a I don't know option. Many people are allergic to cats, so I'm sure some of those would not like kittens even if they seem adorable in Facebook posts. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 07:01, 12 May 2020 (UTC)<br />
:One can also believe in fair elections being important for democracy, but think certain issues are too important to risk 'the people' deciding them, so there's no need for a fair election (and maybe you ought to actively avoid the risk). But only 'the other side' does that, of course. If your side does something that ''looks'' like it, it's just a righteous measure to make it fair again and stop Them cheating. [[Special:Contributions/162.158.155.62|162.158.155.62]] 07:14, 12 May 2020 (UTC)<br />
<br />
I removed the connection between Tom Hanks and COVID-19. While it is true that he was tested positive this had no influence on the poll cited which was in 2018. Therefore it's not relevant. [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 08:11, 12 May 2020 (UTC)<br />
:I disagree about removing it. You are correct that the poll has nothing to do with COVID but that Randall include a poll on Tom Hanks one of the first famous people who came forth telling he had the disease may have been the reason he was included. I will reinsert it, and change to make it clear that this is why it is mentioned. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 08:16, 12 May 2020 (UTC)<br />
::It might as well be a coincidence. And with these additions it's imho not only not needed for the explanation but needlessy convulted, too. Randall did randomly choose Tom Hanks before (see 2003 or 1948). [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 09:56, 12 May 2020 (UTC)<br />
<br />
Yeah, but **whatabout** vi vs. emacs? Sunny Side Up vs. Over Easy? Laurel&Hardy vs. Abbott&Costello? [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 11:40, 13 May 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2301:_Turtle_Sandwich_Standard_Model&diff=191569Talk:2301: Turtle Sandwich Standard Model2020-05-04T16:48:51Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
This is the first time I have had a chance to see the comic early enough to make a meaningful contribution to the explanation, but this time I have no idea whatsoever what the comic is about! [[User:Moosenonny10|Moosenonny10]] ([[User talk:Moosenonny10|talk]]) 20:32, 1 May 2020 (UTC)<br />
<br />
Looks like it is referencing the standard model of elementary particles. The title text mentions four of the quarks(top,bottom,charm,strange) [[Special:Contributions/162.158.106.150|162.158.106.150]] 20:38, 1 May 2020 (UTC)<br />
<br />
Disagree with DgbrtBOT that this is primarily to do with genetics. I agree that it's about the standard model. Up, down, charmed and strange. It may 'because I'm dumb', but even I'm not that dumb.<br />
:I agree that this is not about genetics. The usual Mendelian diagram has the same traits in both dimensions. Maybe he didn't make the particle physics connection because that has more than 4 boxes. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 21:52, 1 May 2020 (UTC)<br />
:Agree with Barmar: This is not at all about genetics, but only about the particles standard model. Hence the name given by Randal, hence the dimensions not fitting Mendel, hence the lab reference and hence the biological absurd combinations. It does not fit genetics at all, but it perfectly fits a basic assumption of the standard particle modell: That every combination does exist. Labs all over the world have spend decades trying find/prove the existance of a particle predicted by lining up the dimensions of the particles standard model just as shown here and most seeming just as absurd. [[Special:Contributions/172.68.51.52|172.68.51.52]] 00:06, 2 May 2020 (UTC)<br />
<br />
<br />
I added a bit about the physics part of it, but it can definitely use more information! [[User:ChunyangD|ChunyangD]] ([[User talk:ChunyangD|talk]]) 20:52, 1 May 2020 (UTC)<br />
<br />
Randall missed an obvious physics/turtle joke "turtles all the way down" reference here [[Glenn Strycker]] 4:56pm CDT 1 May 2020<br />
: It was the first thing I thought, Randall can be sure his readers fill in such details... [[Special:Contributions/141.101.104.221|141.101.104.221]] 21:08, 2 May 2020 (UTC)<br />
<br />
If this really is about genetics, which I question, it seems likely that most people who haven't studied genetics would find the use of genetics jargon to be less than helpful in an explanation.[[User:Darthpoppins|Darthpoppins]] ([[User talk:Darthpoppins|talk]]) 22:46, 1 May 2020 (UTC)<br />
<br />
<br />
In my opinion, the ExplainXKCD community has been successfully trolled by the contributor of the explanation of this comic, and with humorous effect. The troll consists of an explanation couched entirely in terms used primarily by biologists but generally difficult for others to understand, contrary to this community's practice of trying to simplify. [[Wikipedia:genotype|Genotypes]], [[Wikipedia:phenotype|phenotypes]], [[Wikipedia:Punnett Square|Punnett Squares]], [[Wikipedia:heterozygous|heterozygous]], [[Wikipedia:homozygous|homozygous]], [[WIkipedia:ontogeny|ontogeny]]. That being said, the contributor is certainly correct that the comic is about [[Wikipedia:genetics|genetics]], in that the depicted two-by-two square is immediately suggestive of the visual tool used for predicting the results of cross-breeding experiments. And the comic is certainly also about [[Wikipedia:particle physics|particle physics]], in that the comic title refers to a "Standard Model" and then the title text alludes to particle names used in the [[Wikipedia:standard model|standard model of particle physics]]. So the comic's joke is about the unexpected juxtaposition of genetics with particle physics, and also is about turtle sandwiches which, as drawn, are intrinsically funny anyway. Yes, @Glen, all the way down. JohnB [[Special:Contributions/162.158.75.116|162.158.75.116]] 00:25, 2 May 2020 (UTC)<br />
<br />
<br />
This looks less like a Punnet Square than it does like one of those political alignment chart memes. Punnet squares use symbols next to each other to designate genotypes, not diagrams of the results. Not to mention that the individual labels along the sides are supposed to be alleles, not separate effing traits! That whole paragraph is completely wrong and should be removed. [[User:GreatWyrmGold|GreatWyrmGold]] ([[User talk:GreatWyrmGold|talk]]) 00:44, 2 May 2020 (UTC)<br />
<br />
Isn't this about supersymmetry? The missing pieces are the bosonic partners of the known fermions (matter particles), and the fermionic partners of the known bosons (force particles).... Joel K<br />
<br />
For a second, I thought it said "Turkey Sandwich Standard Model"[[User:AllTheWayDown|AllTheWayDown]] ([[User talk:AllTheWayDown|talk]]) 01:31, 2 May 2020 (UTC)<br />
<br />
This is clearly a use of the box method for factoring a trinomial in standard form (ax^2 + bx + c) which the coefficient of the first term (say ax^2) is not simply 1 (a<>1). Actually, the moment I saw it I knew exactly what it was, simply because I have been helping my high school son with his algebra the past few weeks. I laughed out loud! I never heard of this method as a math undergrad because it was brand new at the time, but now it's evidently fairly standard. <br />
<br />
You create a 2x2 box, and write the first term of the trinomial (ax^2) in the top right corner and the last term (c) in the lower left. Then you have to figure out what factoring of a x c gives you two middle terms that when added will yield the middle term, bx. Let's call those b1x and b2x (where b1 x b2 = a x c, and b1 + b2 = b). You put those terms, b1x and b2x in the two empty boxes (in either order). Then you pull out common factors along each row and column until they multiply correctly to get the table. The terms you have pulled out then are your two binomial factors of the trinomial. <br />
<br />
Randall has factored a turtle sandwich where the first term (ax^2) is a sandwich and the last term (c) is a turtle. These are the known terms (check marks). The unknown terms, through working the box method, turn out work if the bread is the common factor along the top row and the turtle shell on the bottom row. The sandwich filling is the common factor in the first column, and the shell-less turtle is the common factor on the second column.<br />
<br />
I believe the alt-text is a play on the fact that, if I'm not mistaken, there are more ways to factor a trinomial if you allow imaginary numbers, because that allows square roots of negative numbers. Analogously, dividing shells differently suggests subatomic particles—thus, various quark flavors like charm and strange.<br />
[[User:EternalLearner|EternalLearner]] ([[User talk:EternalLearner|talk]]) 01:52, 2 May 2020 (UTC)<br />
<br />
Apropos of nothing, and just for the comic relief of the commenters, I searched for 'turtle' 'sandwich' 'standard' 'model' and came across [https://www.globalxvehicles.com/turtle.html | this bad boy]. I couldn't resist sharing. Thanks for the knowledge. -- brad<br />
<br />
Uhm,wut,mostly. Okay so the earth is on a turtle. What holds the turtle up? It's turtles, all the way down, I've heard but? "Turtle legs" is my answer. Why I'm here: didn't xkcd.com used to say it was updated Monday, w, f, ? [[Special:Contributions/162.158.78.182|162.158.78.182]] 04:55, 2 May 2020 (UTC)<br />
:Obviously, the turtle doesn't need to be held up. It's a sea turtle, it swims. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 23:13, 2 May 2020 (UTC)<br />
<br />
Please refer to http://recipes-plus.com/recipe/turtle-sandwiches-kids-30062 for the top left sighting. [[User:Steven Nijhuis|Steven Nijhuis]] ([[User talk:Steven Nijhuis|talk]]) 05:35, 2 May 2020 (UTC)<br />
<br />
LOL. This is the most random comments I have seen on one of these. This is 100% particle physics. Standard model of particle physics, up quarks, charmed quarks.. this is a commentary on how we know there is gravity, and we know there are electrons and we have a standard model which is still being filled in, in order to unify the theories.<br />
<br />
--Adam Outler [[Special:Contributions/108.162.238.131|108.162.238.131]] 06:03, 2 May 2020 (UTC)<br />
----<br />
<br />
I'm a bit confused by these comments. It seems like people are getting thrown off by the 2x2 table thinking that the comic must be related to where they've seen tables before (genetics / factoring quadratics / ...). This is wrong though, this comic is 100% particle physics.<br />
In particle theoretical (particle) physics, the way forward has often been unification (combining forces of nature mathematically). We know the Standard Model is wrong, so physicists have been searching for ways to theoretically extend the known theory for decades. One of the most popular ways of doing this is looking for a larger symmetry group that encompasses the known symmetry groups of the equations governing the Standard Model. And the first time that physicists got REALLY close to a working theory was extending to E(5). When doing this mathematical extension of the Standard Model, you automatically get new messenger particles that are predicted (leptoquarks) that would theoretically make a transition between leptons and quarks possible (much like the weak interaction allows for transitions between quarks). The whole thing tends to get represented as a matrix visually, much like the turtle sandwich joke.<br />
tl;dr: The joke makes perfect sense in theoretical particle physics. This type of diagram is common in extending the Standard Model (which is definitely incomplete) to a larger symmetry group like E(5).<br />
Tom B<br />
<br />
<br />
Outside of anything scientific, I think it's also referring to the memetic "Is a BLANK a sandwich?" debate (normally a hotdog or a calzone) [[Special:Contributions/141.101.107.84|141.101.107.84]] 18:12, 2 May 2020 (UTC)<br />
:The big debate, surely, is orientation. If I prepare (say) some chicken-breast in some sort of marinade, and then half-toast some bread (half-way ''towards'' toasting, not one-sidedly; I put the slices in the toaster but manually eject them when it makes a click which equates to roughly half way to the dialled-in toasting degree, at least on my old toaster) then lightly butter(/non-dairy spread) them and use them to sandwich the chicken, but with a slice of cheese atop the chicken, then it tastes nice. If, during consumption or just moving the construct to a plate, I end up inverting it so it's bread/chicken/cheese/bread from top to bottom (happens when passed from hand to hand, I think, between picking up and alighting anew) it tastes... still nice, but ''different''. Yes, the tongue is set only below the route the sandwich takes, but I'm not sure that accounts for it (experiments while inverting myself, with or without inverting the sandwich, are yet to be trialled without other factors going uncontrolled). However, it does mean that a sandwich cannot be assumed to have a reflective or rotational symmetry in the horizontal plane or any horizontal axis, which is the usual bar quoted against the smörgåsbord... [[Special:Contributions/162.158.159.142|162.158.159.142]] 01:35, 3 May 2020 (UTC)<br />
: Try inverting your tongue and see what effect that has.[[Special:Contributions/108.162.215.206|108.162.215.206]] 06:36, 3 May 2020 (UTC)<br />
<br />
Anyone else mistakenly see the tomato slice/cheese/lettuce as a [https://en.wikipedia.org/wiki/Turtles_(chocolate) Turtle Chocolate] and a slice of [https://en.wikipedia.org/wiki/Turtle_pie Turtle Pie]?<br />
<br />
Seeing the turtle without a shell between the two slices of bread in the grid reminds me of the other old question regarding turtles: If a turtle has lost its shell, is it homeless or naked? [[User:RAGBRAIvet|RAGBRAIvet]] ([[User talk:RAGBRAIvet|talk]]) 05:03, 3 May 2020 (UTC)<br />
<br />
The linked page on the [[wikipedia:Standard Model|Standard Model]] doesn't say anything about either turtles or sandwiches, so I think some more explanation on that part is welcome. --[[User:IByte|IByte]] ([[User talk:IByte|talk]]) 10:54, 3 May 2020 (UTC)<br />
<br />
Perhaps we can find some clues at [[2251]]. (That's what this reminded me of, anyway.) —[[User:Scs|Scs]] ([[User talk:Scs|talk]]) 12:59, 3 May 2020 (UTC)<br />
<br />
=== Size<br />
<br />
Why is it big now? Is it just big for me? Anyone else seeing this? [[Special:Contributions/162.158.187.205|162.158.187.205]] 04:52, 4 May 2020 (UTC)<br />
<br />
: I can see it too.<br />
<br />
: Saved in Wayback Machine:<br />
<br />
:https://web.archive.org/web/20200504044811/https://xkcd.com/2301/<br />
https://web.archive.org/web/20200504044520/https://xkcd.com/ --[[Special:Contributions/162.158.238.4|162.158.238.4]] 04:56, 4 May 2020 (UTC)<br />
<br />
:: The issue only affects the non-Retina/HiDPI version. On a high res screen, the 2x image is loaded with a width of 624px. On a normal res screen, the regular image is loaded with a width of 4682px. [[User:Stevage|Stevage]] ([[User talk:Stevage|talk]]) 10:42, 4 May 2020 (UTC)<br />
<br />
<br />
Meanwhile, C++ programmers are waiting to see where to position MockTurtle on the diagram (with no apologies whatsoever to Lewis Carroll)[[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 16:48, 4 May 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2298:_Coronavirus_Genome&diff=191266Talk:2298: Coronavirus Genome2020-04-27T15:38:55Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
Epigenetics is a pun, right? I think it's a pun but I don't know what and it's maddening. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 23:03, 24 April 2020 (UTC)<br />
:...{{w|Epigenetics}} is a real thing&mdash;the study of how changes in things other than the genome itself can be passed down between generations. An example is conditioning a mouse to be scared of the smell of oranges/cherries/almonds by having them associate the scent of acetophenone with an electric shock, then testing whether its pups also have the same fear of that smell: they do, but this obviously can't be by the genome itself changing (no component of this has a lot of ionizing radiation{{Citation needed}}). Whatever causes this is the topic of actual epigenetics. --[[User:Volleo6144|Volleo6144]] ([[User talk:Volleo6144|talk]]) 00:12, 25 April 2020 (UTC)<br />
::I know that, I added the link to the article. But afaik that has nothing to do with how the genome is formatted in Word, and I think it's a pun. [[User:Jacky720|That's right, Jacky720 just signed this]] ([[User talk:Jacky720|talk]] | [[Special:Contributions/Jacky720|contribs]]) 00:31, 25 April 2020 (UTC)<br />
<br />
since when does notepad have spellcheck? [[Special:Contributions/172.68.226.46|172.68.226.46]] 23:05, 24 April 2020 (UTC)<br />
: Word does, so maybe she is using Word instead? Kind of contradictory. [[Special:Contributions/172.69.34.46|172.69.34.46]] 23:14, 24 April 2020 (UTC)<br />
:I assumed Randall meant Wordpad, which ifrc is an upgrade from notepad but has a really thinned out set of Word's features. Maybe there's a spellcheck in there? (haven't used it in ~10 years) [[User:Xseo|Xseo]] ([[User talk:Xseo|talk]]) 07:47, 27 April 2020 (UTC)<br />
<br />
Very disappointed that she's using Notepad and not Notepad++ . I mean,really... [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 15:38, 27 April 2020 (UTC)<br />
<br />
When Dr. Theall first scanned Finnegans Wake, he had to tell Microsoft the language was Old Icelandic.<br />
<br />
The OCR kept trying to spellcheck Finnegans Wake.15:11, 26 April 2020 (UTC)~<br />
True Story: In the 1980s, as part of the Work Experience initiative at my school, I was assigned to one of my local council's offices (I'd applied for their computer department, but someone else got that). I don't ''think'' the word-processor I used at home (Psion Exchange) had spellcheck, but the one the office used (Lotus? Can't actually recall, but it, like most things, was DOS-based) definitely had, and it was very easy to edit in new words. Inspired by the chemistry lessons I'd recently had, and some 'reports' I was asked to write (keeping the kid busy, more like!) that dealt with chemical degradation of concrete under the action of salt and suchlike, I of course added "NaCl" then absolutely any other chemical formulae I could think of. "H2SO4" was an early one (partial subscript formatting wasn't relevent to the spill-chucker) but I eventually got round to CH4, C2H6, C3H8, etc, and then as many of the derived alcohols, alkenes, alkynes, etc that I could be bothered to type in. Which were a lot. By the end I was 'confident' that nobody would ever type ''any'' correct chemical formula into that machine (no network-shared resources!) and have to worry about false-positive typo alerts. Yeah, well, I was still at school and thought I knew ''everything''. [[Special:Contributions/162.158.159.70|162.158.159.70]] 23:37, 24 April 2020 (UTC)<br />
<br />
Can confirm: virus genomes are looked at in notepad. I worked at one of the national laboratories for a summer, experimenting with ways to check for the length of a gene and strength of genetic expression in various circumstances in E. coli. We used notepad because even old computers can open very large files without difficulty, and all our scripts were in Perl, which can easily output to .rtf or .txt file formats. These files are huge, by the way. If you hold down on the scroll bar so it's zooming to the bottom, you could be waiting 20 minutes to reach the end depending on the number of kilobase pairs in your microbe. And epigenetics is not a pun. It's a real word. [[Special:Contributions/172.68.143.192|172.68.143.192]] 00:15, 25 April 2020 (UTC)<br />
:''even old computers can open very large files without difficulty'' - Depending on what you mean by "old" and "very large" that may well not be true. In Windows 3.x, Notepad could open files as large as 54Kb, increasing to 64Kb in Windows95, 512Mb in Windows 8 and 1Gb in Windows 10. I don't know which of those would fit a typical virus genome, but I'm guessing it's not all of them. [[Special:Contributions/162.158.187.151|162.158.187.151]] 13:43, 27 April 2020 (UTC)<br />
<br />
Concurrent to the work in the medical community, work is underway in various open source software communities to fix bugs and other issues with software (eg genome analysis tools) that is useful to the scientists combatting COVID-19. These include the Debian "biohackathon" (https://lwn.net/Articles/816280/) as well as support from Mozilla (https://lwn.net/Articles/816386/). Parallel to these efforts, the FSF (Free Software Foundation) has focused on the shortage of medical equipment: https://lwn.net/Articles/816392/ [[Special:Contributions/108.162.242.5|108.162.242.5]] 00:34, 25 April 2020 (UTC)<br />
<br />
I’m suddenly inspired to write a DNA-edit-mode for Emacs (if it doesn’t have it already) which would allow for the virus spell check as described in this comic. [[Special:Contributions/172.69.63.153|172.69.63.153]] 04:16, 25 April 2020 (UTC)<br />
<br />
- the dna-mode for emacs does exist. Google for it. It is not very useful for real work, though. [[User:Heikkil|Heikkil]] ([[User talk:Heikkil|talk]]) 04:40, 26 April 2020 (UTC)<br />
<br />
Derek Lowe has some insights about actual coronavirus mutations [https://blogs.sciencemag.org/pipeline/archives/2020/04/21/watching-for-mutations-in-the-coronavirus here], if you are interested.<br />
<br />
Given coronavirus has an RNA genome, shouldn't all the 'T's be replaced by 'U's?<br />
<br />
- It is standard practice no to use U's in public sequence database. It simplifies things. [[User:Heikkil|Heikkil]] ([[User talk:Heikkil|talk]]) 04:40, 26 April 2020 (UTC)<br />
<br />
The sequence in the transcript does not actually appear on the [https://www.ebi.ac.uk/ena/data/view/MT344963&display=text site] mentioned in the explanation. In fact, when I google for 'TACTAGCGTGCCTTTGTAAGCACAAGCTGATTAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTA' I only get this particular site.<br />
:<br />
UNSIGNED COMMENT: PLEASE SIGN WITH "<nowiki>~~~~</nowiki>" <br />
:To find this (or any) sequence go to [[https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome|Nucleotide Blast]] and paste the query into the box. You will receive a list of a number of best matches (10, 50 or 100 in standard search), this should look like [[https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastSearch&VIEW_SEARCH=on&UNIQ_SEARCH_NAME=A_SearchOptions_1jST3G_gRB_dgzLunnk2EC_23turP_1HUFpP|this]] <br />
Interestingly, this is an US-specific strain of the virus (top result currently is "Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/NC_0025/2020").[[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 23:21, 25 April 2020 (UTC)<br />
:Well, ''obviously'' it's a new variant, yet unknown to other clinical studies. Of RNA that has switched to looking like DNA, so this is a hot discovery! [[Special:Contributions/162.158.159.142|162.158.159.142]] 12:05, 25 April 2020 (UTC)<br />
<br />
: The site shows several views into the public database entry that are easier to understand by humans than the raw sequence. Click the link at 'View: TEXT'. and scroll down. The relevant lines look like this:<br />
<br />
aatccagtaa tggaaccaat ttatgatgaa ccgacgacga ctactagcgt gcctttgtaa 26220<br />
<br />
gcacaagctg attagtacga acttatgtac tcattcgttt cggaagagac aggtacgtta 26280<br />
<br />
As you can see, these are not meant to be search for and compared in "a notepad". For the same reason, google does not index DNA sequence database entries. There are specialised tools for that.<br />
<br />
The sequnces were published this month, so they are available only in the most recent sequence database updates. [[User:Heikkil|Heikkil]] ([[User talk:Heikkil|talk]]) 04:40, 26 April 2020 (UTC)<br />
<br />
<br />
I have had trouble opening .txt files of even a hundred KB in Notepad! Sometimes it even crashes... It's one of the reasons I started using Notepad++. Notepad++ also happens to have a very extensible spellcheck, & language-specific formatting options. Since I often need to use Windows machines, it's one of my most frequently installed apps, after 7Zip.<br />
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 18:03, 25 April 2020 (UTC)<br />
<br />
The Grammar Checker concept only has a {{w|Colorless_green_ideas_sleep_furiously|limited analytical sophistication}}, though I don't doubt it'd still be enough to get a Nobel given the complexity of the task of deriving trivially feasible sequences from total codswallop. I also added the "next step" (probably much more than a single step), when I revised things, but that might actually be overstepping the explanation of the comic and removable. [[Special:Contributions/162.158.155.122|162.158.155.122]] 20:32, 25 April 2020 (UTC)<br />
:Thanks for mentioning this in the discussion area, as I wondered what that "next step" line meant when I read it a little while ago, let alone how it related to the comic. I'll go ahead and trim that last "next step" sentence off the end, as I think it is unnecessary. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 03:36, 26 April 2020 (UTC)<br />
<br />
Is using Notepad to analyse RNA sequences more or less sane than using a spam filter to play chess? - [[User:Angel|Angel]] ([[User talk:Angel|talk]]) 00:43, 27 April 2020 (UTC)<br />
: Is that filter used to prevent emails pretending to be from Czech mates looking to give you a knight to remember in a message full of pawn images? [[Special:Contributions/162.158.158.211|162.158.158.211]] 15:10, 27 April 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2297:_Use_or_Discard_By&diff=191172Talk:2297: Use or Discard By2020-04-24T13:56:59Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
comics featuring expiration dates<br />
<br />
This comic is definitely not related to the COVID-19 theme. Has Randall decided after 19 (or 20) comics to end his series? [[Special:Contributions/108.162.215.166|108.162.215.166]] 01:28, 23 April 2020 (UTC)<br />
: I personally agree. However some will make the argument that all the people who stocked up on a lifetime supply will face "best by" issues in the next years. --[[Special:Contributions/172.68.215.76|172.68.215.76]] 06:29, 23 April 2020 (UTC)<br />
:: This one is satisfactorily unrelated for me. I was for Exa-Exabyte, and although I understand the slight argument someone had for it, against Garbage. But this one surely only has convoluted arguments on par with the symbiotic relationship it has with yeast. [[Special:Contributions/172.69.71.64|172.69.71.64]] 12:40, 23 April 2020 (UTC)<br />
::: This one feels like a "things to do while stuck at home" that may have been inspired by the COVID-19 lockdown, but that doesn't make it a COVID-related comic. --[[User:Bobson|Bobson]] ([[User talk:Bobson|talk]]) 14:06, 23 April 2020 (UTC)<br />
<br />
She didn’t say it said “use by (some date)”. She just said it says “use by ..”. My interpretation is that it is so old the date has worn off. That happens to my nitroglycerin quite often. I think her interlocutor is saying, if the date has worn off or gotten illegibly smeared, assume it’s expired. —— OTOH the explanation given by the editors is funnier! [[Special:Contributions/108.162.216.232|108.162.216.232]] 05:08, 23 April 2020 (UTC)<br />
:In the first panel she states that the guns (plural) are about to expire. So I guess they have bought 2 guns about the same time, from different vendors who handle this wording differently, but both flare guns have a visible expiry date in the close future. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 05:56, 23 April 2020 (UTC)<br />
::I disagree. The other one says Use By and no date. So think either explanation is wrong, or at least the two possible interpretations should be mentioned --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 14:56, 23 April 2020 (UTC)<br />
I'm struggling to imagine how anyone could come up with such a wrong interpretation. It's dead obvious, at least to a native English-speaker, that the second label reads in full 'Use by April 25 , 2020" and that it's the missing "or discard" that makes the joke. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 13:56, 24 April 2020 (UTC) <br />
:::My interpretation of that panel is that Cueball cut her off before she was able to finish her sentence, aware that she was interested in using the flare gun. [[Special:Contributions/172.69.34.126|172.69.34.126]] 17:24, 23 April 2020 (UTC)<br />
::If she would have been unable to read the date, how would you explain that she knows the gun is "about to expire"? Especially if they were from different manufacturers, there's no way to know when the gun expires, apart from reading the date. [[Special:Contributions/141.101.104.251|141.101.104.251]] 18:44, 23 April 2020 (UTC)<br />
<br />
I play the browser-game Urban Dead. The flare-pistols in that have no expiry date (a handy 15HP damage item, ''if'' they hit, so I often save any I scavenge for a time my Action Points are low but I might appreciate a chance killing shot on a worn-down zombie) and are 'safe' to fire at all times - except for your target if hit, of course. Outside they can act as a signal, though never seen that as useful myself, but I always wished that inside a darkened building they'd at least be seen as a flash (maybe transient blinding) to anyone present but not hit by it. I mean, does ''nobody'' notice someone firing off a flare in an unpowered cinema, even the person it was aimed at but apparently just missed? (It was argued that a 'miss' was a misfire, a similar argument given with shotgun/pistol non-hits that no-one even hears, but they have no failure rate when deployed as signal.) [[Special:Contributions/162.158.158.211|162.158.158.211]] 13:46, 23 April 2020 (UTC)<br />
<br />
How does one properly dispose of these? I have an emergency smoke"grenade" (it's just a tin can) that expired in or before 2012 in my car. Related question, what is the best way to improperly dispose one of those? [[Special:Contributions/162.158.111.175|162.158.111.175]] 15:39, 23 April 2020 (UTC)<br />
:Probably need to contact your local HAZMAT for either smoke grenades or flare guns. Neither one would be appropriate for regular garbage or recycling. And forget about taking them on an airplane. [[User:Rtanenbaum|Rtanenbaum]] ([[User talk:Rtanenbaum|talk]]) 16:55, 23 April 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2296:_Sourdough_Starter&diff=191072Talk:2296: Sourdough Starter2020-04-22T10:48:19Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
Symbiosis is good for the species involved in that relationship, but it may still be harmful to other organisms. What Randall is suggesting is that humans are collateral damage. [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 21:37, 20 April 2020 (UTC)<br />
<br />
Is there controversy around covid-19 coming from cave bats rarely visited by humans, or would the bats be part of the convoluted lifecycle? [[Special:Contributions/162.158.74.211|162.158.74.211]] 22:02, 20 April 2020 (UTC)<br />
<br />
Is this comic suggesting the yeast would allow the virus to survive without a human host, and when we later swap sourdough starters the virus could then find a new human host to infect? [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 01:05, 21 April 2020 (UTC)<br />
:The virus and yeast can have working symbiosis without ever coming into physical contact. It's just that the lockdown probably ends before the virus will be actually eradicated, so large meetings just after end of lockdown is not good idea. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 22:19, 21 April 2020 (UTC)<br />
<br />
That is not a theory in the caption. It has no evidence and makes no testable predictions, at least as far as I can tell. It is just a hypothesis. [[User:Nutster|Nutster]] ([[User talk:Nutster|talk]]) 01:56, 21 April 2020 (UTC)<br />
:Maybe not a theory in the real world, but this isn't the real world. Perhaps in the world of this comic there is evidence and there were predictions that have been tested, making it a theory to Cueball. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 02:17, 21 April 2020 (UTC)<br />
:With a bit of reading online, I've discovered that your definition of "theory" is but one of many different definitions of the word. In some contexts, theory is synonymous with hypothesis, according to Merriam-Webster. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 02:31, 21 April 2020 (UTC)<br />
: Theory: This comic is the same category as "My hobby". Aka: It's a joke. [[User:Elektrizikekswerk|Elektrizikekswerk]] ([[User talk:Elektrizikekswerk|talk]]) 07:21, 21 April 2020 (UTC)<br />
: "theory - noun - an idea used to account for a situation or justify a course of action" - that seems to describe how Randall used the word [[User:Barmar|Barmar]] ([[User talk:Barmar|talk]]) 14:03, 21 April 2020 (UTC)<br />
<br />
In the UK at least, it's been too successful. You can't get flour in the shops most times. Apparently, most flour goes into big sacks for bakeries and the like. The mills haven't been able to gear up their production of small bags for domestic use. [[Special:Contributions/162.158.159.56|162.158.159.56]] 09:24, 21 April 2020 (UT<br />
<br />
<br />
<br />
<br />
My pet theory, before Boris Johnson got a bit better and ''didn't'' relax measures, was that COVID had deliberately infected half the Cabinet in order to gain the authority to infect everyone else, like common Pod People tropes would have happen. (That didn't happen, but maybe it's just being more clever. Like causing the PPE supply chains to break under the strain.) [[Special:Contributions/162.158.34.210|162.158.34.210]] 10:46, 21 April 2020 (UTC)<br />
<br />
Isn't "swapping starters" a Pokemon reference? You know, getting together and trading starter Pokemon until everyone has all 3. [[User:Daevin|Daevin]] ([[User talk:Daevin|talk]]) 14:53, 21 April 2020 (UTC)<br />
<br />
I assumed this was a continuation of the previous comic: precise number + garbage = garbage; perfectly good flour + sourdough starter = garbage that tastes so bad not even microbes want to eat it.<br />
: Bakers gonna bake, Haters gonna hate... [[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 09:48, 22 April 2020 (UTC)<br />
<br />
Have to confess: The yeasts (and lactobacilli) got me - still waiting for the virus. [[User:Tier666|Tier666]] ([[User talk:Tier666|talk]]) 09:48, 22 April 2020 (UTC)<br />
<br />
<br />
Sourdough fanatics insist, despite solid evidence to the contrary, that the yeast strains in their carefully maintained starter material are identical to those present when their greatgreatgrandmother started the very first batch. Stuff flies in through the window, or off your fingers, or whatever, every time the starter is exposed to air. Whatever -- the final product still tastes great. And after all, "Viruses HATE This One Simple Trick To Kill Them" : bake to kill off everything in the dough. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 10:48, 22 April 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2292:_Thermometer&diff=190489Talk:2292: Thermometer2020-04-13T12:49:18Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
First non-Covid post other than April fools?[[Special:Contributions/162.158.107.167|162.158.107.167]] <br />
23:04, 10 April 2020 (UTC)<br />
:Since a fever is a common symptom of Covid-19, I'd say this is as much about Covid-19 as all the previous comics on the topic. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 02:59, 11 April 2020 (UTC)<br />
::I'd disagree. Fevers aren't inherently related to COVID-19, and while it's certainly easy to draw a connection based on current events, at no point is the connection made explicit. [[Special:Contributions/172.69.34.104|172.69.34.104]] 10:29, 11 April 2020 (UTC)<br />
:::Seriously? Fever is associated with 88% of COVID-19 cases! I'd say that's inherently related, and I'm drawing a connection based on that fact. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 12:59, 11 April 2020 (UTC)<br />
::::Fevers are associated with almost all infectious diseases. By that logic, this could be about the flu, mono, or a hundred other conditions. [[User:Shamino|Shamino]] ([[User talk:Shamino|talk]]) 17:24, 11 April 2020 (UTC) <br />
:::::I, too, think calling this a Covid-19 comic is excessive. Sure, thermometers for measuring body temperature are sold out at my local drugstore, and pandemic likely inspired the comic, but if it had been published a year ago, we wouldn't infer any connection to a specific disease or global epidemic. - Ada in New Hampshire, USA [[Special:Contributions/172.69.6.22|172.69.6.22]] 07:56, 12 April 2020 (UTC)<br />
::::::I would assume anything that can be linked, even loosely, is probably part of this chain. I have been assuming since the 6th one that Randel would aim for 19 of these just because. Though perhaps he will keep going till the hype is over. Either way, requiring that it directly mentions the topic it was inspired by would be way overkill. Mentioning things that likely inspired a comic is something we have done for a long time, and the virus seems like the most likely inspiration, especially when taking the full comic chain into account[[Special:Contributions/172.69.198.52|172.69.198.52]] 21:33, 12 April 2020 (UTC)<br />
::The comic doesn't mention a fever. For all we know Cueball is trying to measure the outside air temperature, or how hot his coffee is. We can rule out the idea that he is trying to measure the temperature of some liquid helium only because he skipped past the kelvin scale. [[User:Jeremyp|Jeremyp]] ([[User talk:Jeremyp|talk]]) 18:39, 12 April 2020 (UTC)<br />
<br />
<br />
A common practice in schools and the like prior to quarantine was temperature taking upon arrival. So it's like that this comic continues that to the home setting. [[Special:Contributions/162.158.78.112|162.158.78.112]] 23:19, 10 April 2020 (UTC)<br />
<br />
A pessimist would guess that this means someone in Randall's household has a fever. [[Special:Contributions/108.162.219.52|108.162.219.52]] 23:26, 10 April 2020 (UTC)<br />
<br />
> The Physician Ducks[[Special:Contributions/172.69.62.94|172.69.62.94]] 23:32, 10 April 2020 (UTC)<br />
<br />
Personally I'd welcome a home thermometer marked off in Kelvin, avois all the "twice as cold" sort of confusion you can get with an arbitrary zero as used in Celsius and Fahrenheit. [[Special:Contributions/162.158.34.210|162.158.34.210]] 23:21, 10 April 2020 (UTC)<br />
<br />
I might have enjoyed a "Degrees of Kevin Bacon" joke in this comic somewhere. :-) [[Special:Contributions/172.69.68.143|172.69.68.143]] 23:42, 10 April 2020 (UTC)<br />
<br />
Double-plus-dissapointed we didn't get the Delisle measure referenced at all... [[Special:Contributions/162.158.34.202|162.158.34.202]] 01:17, 11 April 2020 (UTC) ...and now added. It would be better in any Trivia section, but we don't have one so hoping it's no more out of place in the explanation as Fahrenheit. [[Special:Contributions/162.158.34.202|162.158.34.202]] 02:02, 11 April 2020 (UTC) ...''aaaand'' someone removed it (as pure trivia, of course), fair enough. Anticipated. Anyone still interested in what I put just needs to check this IP, at about this timestamp, in Page History, though, so not going to argue the point. [[Special:Contributions/162.158.34.202|162.158.34.202]] 02:08, 11 April 2020 (UTC)<br />
<br />
No temperature scale is defined using melting or boiling points of water anymore. Since 2019 Kelvin is defined via the Boltzmann constant, and all other temperature scales have been (re-)defined relative to the Kelvin scale for quite a while. --[[Special:Contributions/172.69.63.103|172.69.63.103]] 01:24, 11 April 2020 (UTC)<br />
<br />
Randall forgot the Réaumur scale.[[Special:Contributions/162.158.123.97|162.158.123.97]] 03:00, 11 April 2020 (UTC)<br />
<br />
I'm not sure why some people seem to look for any opportunity to take a dig at the US, but I removed the line in the explanation about US-based readers not being familiar with the Celsius temperature scale. I'm sure most Americans are familiar with it but prefer the Fahrenheit scale instead. I don't understand why anyone holds that against us. [[User:Ianrbibtitlht|Ianrbibtitlht]] ([[User talk:Ianrbibtitlht|talk]]) 03:04, 11 April 2020 (UTC)<br />
:Hey, let's assume good faith. Chances are, some rando just genuinely had no idea how that kind of stuff works here. [[Special:Contributions/172.69.34.104|172.69.34.104]] 10:22, 11 April 2020 (UTC)<br />
<br />
Regarding USA Fahrenheit and non-USA Celsius preference, I was in Niagra Falls a few years back, listening to a Canadian station on the radio (ok, more than a few years ago...) and the DJ gave a weather report, saying “The current temperature is 25 degrees, that’s 77 on the understandable scale.” [[Special:Contributions/173.245.54.201|173.245.54.201]] 04:22, 11 April 2020 (UTC)<br />
<br />
I guess if you wanted to use the Newton scale you'd need to have Newton's original "degrees of heat" measuring device. [[Special:Contributions/108.162.250.67|108.162.250.67]] 04:31, 11 April 2020 (UTC)<br />
<br />
Nitpicking alert : the correct writing is "kelvin", not "Kelvin".<br />
<br />
100°F is "really hot"? Maybe on a stripper... [[Special:Contributions/162.158.190.106|162.158.190.106]] 13:00, 11 April 2020 (UTC)<br />
<br />
Randall, as a physicist, should know about the equipartition theorem. It states that all degrees of freedom will carry the same average amount of energy in thermal equilibrium, not only the translational kinetic ones (but also rotational, and potential energies). It is technically not false to exclude some of these, but an arbitrary choice. I guess he just wanted to include the terms “translational” and “kinetic” to make sure it sounds ridiculously over-specific (which works well). [[Special:Contributions/162.158.91.213|162.158.91.213]] 15:07, 11 April 2020 (UTC)<br />
:No, it's still an important distinction. Many Thermometers can only 'measure' the average Translational energy and the rotational and elastic energy is just assumed to match that. (The only Thermometers that measure rotational and elastic Energy are the ones who only measure their own temperature... which is 99.5 of all consumer Thermometers.) And it probably does except in some very specific cases with ultra high speed pressure changes.<br />
<br />
+Using the average Translational Energy would would sidestep all the problems with the different units of temperature and would also eliminate the necessity of using the Boltzmann constant, simplyfying a lot of physics. But nobody wants to make the transition since most everyday temperatures would be between 5 and 8zJ, with 5 being freezing, six being tolerable and seven a desert at noon. The Unit, Zeejays would sound cool though.[[Special:Contributions/162.158.92.70|162.158.92.70]] 09:30, 13 April 2020 (UTC)<br />
:Alternatively, use molar mean disordered translational kinetic energy per mole, making the numbers nicer by a factor of Avogadro's number, and bringing the scale to 2-3kJ/mol. Or add in a factor of 1.5 as well to make the gas K.E. formula simpler. [[User:Sqek|Sqek]] ([[User talk:Sqek|talk]]) 10:27, 13 April 2020 (UTC)<br />
<br />
Well, it has Fahrenheit after a fashion. Just substract 460 from Rankine. It's even easier than converting Kelvin to Celsius!<br />
:I find it much quicker to subtract 0.01C° 27,315 times than to subtract 0.01F° 45,967 times, personally. I think you're quite barmy to suggest otherwise, Unsigned... :P [[Special:Contributions/162.158.34.222|162.158.34.222]] 16:17, 11 April 2020 (UTC)<br />
::Now that I, the formerly Unsigned, think of it, I must agree with you - but for an entirely different reason. 273.15 in binary is a nice, round 100010001.001(00101) with 3 1's in the integer and 4+2n 1's for every 3+5n fractional digits, whereas 459.67 is much messier: 111001011.10110001111110... , with 6 1's in the integer alone. The more 1's there are in a number, the more operations you have to do for each addition or subtraction. So in binary, Kelvin-to-Celsius is much easier to convert than Rankine-to-Fahrenheit. Yet another point in favor of the glorious metric master system, da? [[User:Osato|Osato]] ([[User talk:Osato|talk]]) 19:57, 11 April 2020 (UTC)<br />
<br />
I removed the weasel words, indicating that Fahrenheit is "generally appreciated" because 0 means very cold and 100 very hot. I adjusted it to "some claim" and adjusted the text to fit.<br />
<br />
Make the scale in Celsius 0 to 200, and I think you would have a system much more relatable to Fahrenheit users.<br />
<br />
<br />
I can imagine a worse scaling system! Base it on Cat-Scratch-Fever, Hot-Blooded, Yellow Snow, SpringTime in Alaska, Beds are Burning, Burning Down the House . (not in that order) [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 12:49, 13 April 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2289:_Scenario_4&diff=190124Talk:2289: Scenario 42020-04-06T18:33:36Z<p>Cellocgw: </p>
<hr />
<div>Should definitely make a note re: this officially-Friday comic releasing late Saturday afternoon (EDT). [[User:TPS|TPS]] ([[User talk:TPS|talk]]) 22:06, 4 April 2020 (UTC)<br />
Or is this actually the april fool comic, except it fooled us by being on a Saturday? [[Special:Contributions/162.158.74.81|162.158.74.81]] 22:12, 4 April 2020 (UTC) Sam<br />
Perhaps more likely because the actual April Fool's comic (due Wednesday) delayed 'til Friday. [[User:TPS|TPS]] ([[User talk:TPS|talk]]) 22:19, 4 April 2020 (UTC)<br />
<br />
The title should probably be changed, the xkcd site uses the numeral "4" whereas we're using the word "four."--[[User:GoldNinja|GoldNinja]] ([[User talk:GoldNinja|talk]]) 22:50, 4 April 2020 (UTC)<br />
I accidentaly originally put it under Sequence Four. It shows in the image name.<br />
<br />
I hope I fixed it correctly [[User:Bugstomper|Bugstomper]] ([[User talk:Bugstomper|talk]]) 02:17, 5 April 2020 (UTC)<br />
<br />
Another instance of a graph with poor labels ("bad stuff"), even without the time travel. [[Special:Contributions/162.158.158.225|162.158.158.225]] 23:54, 4 April 2020 (UTC)<br />
<br />
The issue of time-traveling COVID-19 problems has already be considered in Onion Public Radio's The Topical. https://www.youtube.com/watch?v=E3GQwOcsChQ Apologies for any poor rule-following as this is my first edit. [[User:RandomEdditMemory|RandomEdditMemory]] ([[User talk:RandomEdditMemory|talk]]) 00:00, 5 April 2020 (UTC)RandomEditMemory<br />
<br />
The time travel in this comic is probably a reference to the time offset resulting from the April Fool's comic, but possibly coincidentally the comic showed up here in New Zealand in the morning of the April 5 change to Standard Time when the clocks did turn back an hour. [[User:Bugstomper|Bugstomper]] ([[User talk:Bugstomper|talk]]) 01:55, 5 April 2020 (UTC)<br />
: The time travel is almost certainly not a deliberate reference to the April Fool's comic being late (or to any implementation of DST). Rather, there's 4 graphs, each with an increasingly higher curve. the first tapers off, appearing to be approaching an asymptote, with an ever-decreasing rate of increase -- or even heading to a decrease. The second has a steeper slope for a while, but then does start to taper off. whether it becomes linear, approaches an asymptote, or starts declining off the edge of the graph is not known. The third scenario appears to be an exponential curve. The 3.5 scenario (not shown) would be to have a vertical asymptote, where "bad stuff" shoots off toward infinity as time approaches T. Then the only other thing left to do with a curve is to have it continue back the way it came. Been too long since I was in that level of math, but I'm pretty sure it's problematic if you Y-axis has two values at a point on the X-axis. This isn't showing two different functions converging as time progresses, but rather that a high values of "bad stuff," time goes backward.<br />
<br />
From the explanation: "This is another comic in the coronavirus series." But ... is it? It certainly isn't explicitly so. The implicit argument is easy to make, but the fact that it is just "bad stuff" as a function of "time," it could easily be relevant to any number of bad scenarios: velociraptor attacks, Macarena flash mobs, mobile game IAP monetization, nationalistic views in politics, cat-based cheeseburger memes, or so on. It's not much of a stretch to say that the comic is topical to current events (especially given that there are many others in a sequence of implicitly or explicitly CoViD-related comics), but it still is a stretch to _definitely_ say so absent Mr. Munroe actually acknowledging so elsewhere, and then a citation would be needed, right?<br />
:It definitely is. All those graphs (except the fourth, obviously) can be found in real countries' data. South Korea would be an example of scenario 1. The United States would be an example of scenario 3. The virus is on everybody's mind, so there's no way it's a coincidence. (I think labeling [[2283: Exa-Exabyte]] as a coronavirus comic is ''way'' more of a stretch.)<br />
<br />
I suggest the mathematical background of the graph 'bending over backwards' should be explained in more detail because the contradiction between what is 'natural' tendency of the graph and what is possible mathematically is what makes for the core of the joke. I mean, let's imagine that the graph is a picture of some tangible object, as a non-mathematically inclined person might do. Let's say, it's a rope. Then after observing it 'bend upwards' more and more with each scenario that gets progressively 'worse', it would be reasonable to conclude that continuing to bend this object even more and 'overbending it' would naturally mean some kind of a catastrophe. In reality, of course, it is impossible just because of the way the graph is being plotted. Each next segment is added as time goes by and placed more to the right because the time is shown to flow right on the horizontal axis. Thus the only way this graph could bend like this is for the next added segment to be in time 'before' the last one. And since it is impossible to travel back in time (citation needed), such a graph is unlikely to be predicting a real scenario. --[[User:SomethingLike|SomethingLike]] ([[User talk:SomethingLike|talk]]) 06:30, 5 April 2020 (UTC)<br />
:There are graphs, however, that have multiple Y-values for single X-values (graph of a square root function, at least for positive values of X, graphs of circles, or the batman equation. Might need an ELI5 why those are okay but the line curving back in time isn't.<br />
<br />
You laugh here, but I have in fact seen graphs in corporate presentations which folded back. The presenter (a) didn't understand data analysis, (b) thought Excel was the right tool, and finally (c) decided the graph looked "better" by using the (incompetent) Excel pseudo-curve-smoothing graphics tool.[[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 18:33, 6 April 2020 (UTC) <br />
<br />
To me this comic seems a commentary on alocalypse. Some see COVID-19 as the start of a coming apocalypse, and some worst apocalypse scenarios involve either an explosive AI researching things like time travel or ending our timeline as physics knows it, or all of us going back to survival mode on a landscape without any modern infrastructure. [[Special:Contributions/172.69.250.58|172.69.250.58]] 22:03, 5 April 2020 (UTC)<br />
<br />
I think that "The only way to make sense of it would be by using the common trope in science fiction of time traveling creating an alternate timeline in which events are different, thus the cases could be 100 in one timeline and 1000 in a different timeline."..etc is utterly wrong creating a new timeline would have two 'forward' lines over a stretch of chart but would not have a single inflection joining a forward over ibto a backwards one. Maybe a (reverse) Z-bend if you include the retrograde (tachyonic?) leg, but then the true alternate timeline (also as per a single line splitting into two forward-going streams at a given ''t'', whether or not that was invoked by time-travellers arriving at that point or 'mundane' quantum superpositioning if alternate outcomes) would not be backwards. (Alternative time-arrow, maybe, but that's more like a continuation of the existence of the usual one, which has no existence beyond the rotation of time into a backwards framing... However that happens - and this graph seems to indicate gradually, like the rate of time goes for +ve to -ve by having less seconds/'second' and passing zero, perhaps by somehow rotating in the imaginary time plane (similar, then, to a spacial one?) in which case there's probably more to worry about than the (presumably unrelated) Bad Stuff. (Darnit, forgot to sign...). [[Special:Contributions/162.158.34.210|162.158.34.210]] 15:49, 6 April 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2289:_Scenario_4&diff=190116Talk:2289: Scenario 42020-04-06T13:14:17Z<p>Cellocgw: </p>
<hr />
<div>Should definitely make a note re: this officially-Friday comic releasing late Saturday afternoon (EDT). [[User:TPS|TPS]] ([[User talk:TPS|talk]]) 22:06, 4 April 2020 (UTC)<br />
Or is this actually the april fool comic, except it fooled us by being on a Saturday? [[Special:Contributions/162.158.74.81|162.158.74.81]] 22:12, 4 April 2020 (UTC) Sam<br />
Perhaps more likely because the actual April Fool's comic (due Wednesday) delayed 'til Friday. [[User:TPS|TPS]] ([[User talk:TPS|talk]]) 22:19, 4 April 2020 (UTC)<br />
<br />
The title should probably be changed, the xkcd site uses the numeral "4" whereas we're using the word "four."--[[User:GoldNinja|GoldNinja]] ([[User talk:GoldNinja|talk]]) 22:50, 4 April 2020 (UTC)<br />
I accidentaly originally put it under Sequence Four. It shows in the image name.<br />
<br />
I hope I fixed it correctly [[User:Bugstomper|Bugstomper]] ([[User talk:Bugstomper|talk]]) 02:17, 5 April 2020 (UTC)<br />
<br />
Another instance of a graph with poor labels ("bad stuff"), even without the time travel. [[Special:Contributions/162.158.158.225|162.158.158.225]] 23:54, 4 April 2020 (UTC)<br />
<br />
The issue of time-traveling COVID-19 problems has already be considered in Onion Public Radio's The Topical. https://www.youtube.com/watch?v=E3GQwOcsChQ Apologies for any poor rule-following as this is my first edit. [[User:RandomEdditMemory|RandomEdditMemory]] ([[User talk:RandomEdditMemory|talk]]) 00:00, 5 April 2020 (UTC)RandomEditMemory<br />
<br />
The time travel in this comic is probably a reference to the time offset resulting from the April Fool's comic, but possibly coincidentally the comic showed up here in New Zealand in the morning of the April 5 change to Standard Time when the clocks did turn back an hour. [[User:Bugstomper|Bugstomper]] ([[User talk:Bugstomper|talk]]) 01:55, 5 April 2020 (UTC)<br />
: The time travel is almost certainly not a deliberate reference to the April Fool's comic being late (or to any implementation of DST). Rather, there's 4 graphs, each with an increasingly higher curve. the first tapers off, appearing to be approaching an asymptote, with an ever-decreasing rate of increase -- or even heading to a decrease. The second has a steeper slope for a while, but then does start to taper off. whether it becomes linear, approaches an asymptote, or starts declining off the edge of the graph is not known. The third scenario appears to be an exponential curve. The 3.5 scenario (not shown) would be to have a vertical asymptote, where "bad stuff" shoots off toward infinity as time approaches T. Then the only other thing left to do with a curve is to have it continue back the way it came. Been too long since I was in that level of math, but I'm pretty sure it's problematic if you Y-axis has two values at a point on the X-axis. This isn't showing two different functions converging as time progresses, but rather that a high values of "bad stuff," time goes backward.<br />
<br />
From the explanation: "This is another comic in the coronavirus series." But ... is it? It certainly isn't explicitly so. The implicit argument is easy to make, but the fact that it is just "bad stuff" as a function of "time," it could easily be relevant to any number of bad scenarios: velociraptor attacks, Macarena flash mobs, mobile game IAP monetization, nationalistic views in politics, cat-based cheeseburger memes, or so on. It's not much of a stretch to say that the comic is topical to current events (especially given that there are many others in a sequence of implicitly or explicitly CoViD-related comics), but it still is a stretch to _definitely_ say so absent Mr. Munroe actually acknowledging so elsewhere, and then a citation would be needed, right?<br />
:It definitely is. All those graphs (except the fourth, obviously) can be found in real countries' data. South Korea would be an example of scenario 1. The United States would be an example of scenario 3. The virus is on everybody's mind, so there's no way it's a coincidence. (I think labeling [[2283: Exa-Exabyte]] as a coronavirus comic is ''way'' more of a stretch.)<br />
<br />
I suggest the mathematical background of the graph 'bending over backwards' should be explained in more detail because the contradiction between what is 'natural' tendency of the graph and what is possible mathematically is what makes for the core of the joke. I mean, let's imagine that the graph is a picture of some tangible object, as a non-mathematically inclined person might do. Let's say, it's a rope. Then after observing it 'bend upwards' more and more with each scenario that gets progressively 'worse', it would be reasonable to conclude that continuing to bend this object even more and 'overbending it' would naturally mean some kind of a catastrophe. In reality, of course, it is impossible just because of the way the graph is being plotted. Each next segment is added as time goes by and placed more to the right because the time is shown to flow right on the horizontal axis. Thus the only way this graph could bend like this is for the next added segment to be in time 'before' the last one. And since it is impossible to travel back in time (citation needed), such a graph is unlikely to be predicting a real scenario. --[[User:SomethingLike|SomethingLike]] ([[User talk:SomethingLike|talk]]) 06:30, 5 April 2020 (UTC)<br />
:There are graphs, however, that have multiple Y-values for single X-values (graph of a square root function, at least for positive values of X, graphs of circles, or the batman equation. Might need an ELI5 why those are okay but the line curving back in time isn't.<br />
<br />
You laugh here, but I have in fact seen graphs in corporate presentations which folded back. The presenter (a) didn't understand data analysis, (b) thought Excel was the right tool, and finally (c) decided the graph looked "better" by using the (incompetent) Excel pseudo-curve-smoothing graphics tool. <br />
<br />
To me this comic seems a commentary on alocalypse. Some see COVID-19 as the start of a coming apocalypse, and some worst apocalypse scenarios involve either an explosive AI researching things like time travel or ending our timeline as physics knows it, or all of us going back to survival mode on a landscape without any modern infrastructure. [[Special:Contributions/172.69.250.58|172.69.250.58]] 22:03, 5 April 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2286:_6-Foot_Zone&diff=189417Talk:2286: 6-Foot Zone2020-03-29T01:09:44Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
Ok... 34 feet, in total, but how many hands? (All of which you should wash!) [[Special:Contributions/162.158.34.210|162.158.34.210]] 23:34, 27 March 2020 (UTC) <br />
<br />
Well, a typical horse stands 15.2 hands tall. You do the math. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 01:09, 29 March 2020 (UTC)<br />
<br />
: Love it. Given the extra 1.7 feet for the person, a radius of 20.53 hands. If it were just 6 feet, 18 hands -- brad --[[Special:Contributions/108.162.216.122|108.162.216.122]] 00:55, 28 March 2020 (UTC)<br />
<br />
So Randall is figuring about 1.7 feet diameter for the person. --[[Special:Contributions/172.68.174.70|172.68.174.70]] 00:40, 28 March 2020 (UTC)<br />
<br />
The 190,000 people / mile^2 assumes (I'm guessing) flat ground. Skyscrapers make a difference [citation needed] -- brad --[[Special:Contributions/108.162.216.122|108.162.216.122]] 00:55, 28 March 2020 (UTC)<br />
<br />
Interesting that the population density he gives ignores circle packing. Population should be 174,000. -- coyne -- [[Special:Contributions/162.158.122.156|162.158.122.156]] 04:06, 28 March 2020 (UTC)<br />
: Circle packing is unimportant since he's just giving the population of this one circle. He's taking a radius of 6 foot ''around'' that person without specifying what he considers to be the radius of the person, but it can be inferred from the numbers: <br>from area: <math>\sqrt{145/\pi} \approx 6.8</math>, <br>from circumference: <math>43/(2\pi) \approx 6.8</math>, <br>from population density: <math>\sqrt{1/190000/\pi} \cdot 5280 \approx 6.8</math>,<br>so apparently he considers a person to have a radius of 0.8 ft, or about 0.5 m diameter, which seems reasonable. [[User:Zmatt|Zmatt]] ([[User talk:Zmatt|talk]]) 05:11, 28 March 2020 (UTC)<br />
: Note that even if you want to know the population of optimally packed people, your number is still wrong since the circles overlap: your circle is supposed to exclude other people, it doesn't exclude other people's circles. Optimally you'd have a triangular lattice of people with a lattice distance of 7.6 ft (assuming we want 6 ft between people and we consider people to be circles of radius 0.8 ft). This yields a population density of 1 person per <math>\tfrac{1}{4}\sqrt{3} \cdot 7.6^2 \text{ ft}^2</math>, which is about 1.1 million people per square mile. [[User:Zmatt|Zmatt]] ([[User talk:Zmatt|talk]]) 05:24, 28 March 2020 (UTC)<br />
<br />
Much as I love thinking about circle packing density in the plane, I think the above explanation is slightly overthinking the issue. The population density figure appears to be using the idea that one person's zone contains one person; 1 person / (145 ft^2) does indeed equal 192,000 people/square mile. So, he's not saying that 'given these constraints, we can pack people at this maximum density'. He's saying 'given this area, and counting it as a tiny sovereignty, we can calculate its population density to be this'. For this reason, I don't think you should say that the 'population density' figure has an error, only that it is calculated in a different sense than you were thinking about. [[User:Dextrous Fred|Dextrous Fred]] ([[User talk:Dextrous Fred|talk]]) 18:58, 28 March 2020 (UTC)<br />
:I agree. My first instinct on what the population density figure means was the same as one used in the comic. [[Special:Contributions/162.158.103.163|162.158.103.163]] 22:29, 28 March 2020 (UTC)<br />
<br />
Possibly a play on the fact that horses are measured in hands? --orbitalbuzzsaw--<br />
<br />
Page 207 of [https://www.fs.fed.us/t-d/pubs/pdfpubs/pdf07232816/pdf07232816dpi72pt10.pdf US Forest Service Equestrian Design Guidebook for Trails, Trailheads, and Campgrounds] says minimum corral size is 12x12 feet. I didn't find a more likely sounding Forest Service publication. So I assume the ''handbook'' in the comic is a fictional publication. [[User:Hamjudo|Hamjudo]] ([[User talk:Hamjudo|talk]]) 13:15, 28 March 2020 (UTC)<br />
<br />
:Don't look for corrals. Look for how are you supposed to pack the horses for traveling eg. in train or truck/trailer. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 00:22, 29 March 2020 (UTC)<br />
<br />
Always knew cities were bad for humanity. As are airplanes. Need them both to create a pandemic. [[User:Seebert|Seebert]] ([[User talk:Seebert|talk]]) 18:32, 28 March 2020 (UTC)<br />
<br />
Thanks for that explanation! When I saw the title text, I was worried that WHO had increased the recommendation and I'd missed it. [[User:TobyBartels|TobyBartels]] ([[User talk:TobyBartels|talk]]) 00:47, 29 March 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2284:_Sabotage&diff=189043Talk:2284: Sabotage2020-03-23T12:26:09Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
I don't entirely understand this comic (else I wouldn't be here), but I don't think that the current explanation is on the right track. It doesn't fit with the title, Sabotage. My reading is that some people are planning to get together IRL, and Cueball is threatening to sabotage their event with Baby Shark and skunks, presumably hoping that they'll call it off. [[User:TobyBartels|TobyBartels]] ([[User talk:TobyBartels|talk]]) 05:19, 23 March 2020 (UTC)<br />
: +1! [[User:John.Adriaan|John.Adriaan]] ([[User talk:John.Adriaan|talk]]) 05:48, 23 March 2020 (UTC)<br />
<br />
::My Impression is that upon observing some group of people ignoring the social distancing stuff, he's attempting to scare them off actually having their gathering by piling up a long list of things you wouldn't want to be around. Doing an especially-annoying spoken word version of an especially-annoying song for long periods of time(Possible); Bringing a large number of wild skunks (unlikely); claiming to have just come from a cruise ship after several recent cases of mass-infections on cruise ships, making him seem like a high risk person to be around(probably lying); further claiming to have come from an event involving close, physical contact with a large group of random people, again making him seem like he's highly likely to be infected (almost certainly lying).<br />
<br />
::In other words, trying to sabotage their gathering so that nobody shows up... in order to keep their stupidity/ignorance/arrogance from potentially spreading the virus to everyone present. -Graptor [[Special:Contributions/162.158.186.78|162.158.186.78]] 05:54, 23 March 2020 (UTC)<br />
<br />
Shouldn't this comic be about BHG? Seems more up his alley. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 12:26, 23 March 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2280:_2010_and_2020&diff=188710Talk:2280: 2010 and 20202020-03-16T15:24:00Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
<br />
Please maintain your distance in these comments. No comments within 6 vertical inches of other comments, please. And any in-comment sneezing or coughing will result in your account being banned for a period of 3 weeks. [[User:N0lqu|-boB]] Achoo! [[User:Bischoff|Bischoff]] ([[User talk:N0lqu|talk]]) 21:09, 13 March 2020 (UTC) <br />
<br />
<br />
:I used a large projection screen & zoomed in to post this comment, so my comment appears 8" separated from yours. (Your argument is invalid.) <br />
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 12:08, 16 March 2020 (UTC)<br />
<br />
<br />
<br />
<br />
What is this "inch" of which you speak? I, for one, actually stay 2 meters away from any time-travel-caused disturbance in the space-time continuum.[[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 15:24, 16 March 2020 (UTC)<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
If the above information was new to you, please take this concise pamphlet. [[Special:Contributions/172.69.250.58|172.69.250.58]] 23:17, 13 March 2020 (UTC)<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
Maybe we should add a section on what holo-banshees are? That could be useful. [[Special:Contributions/162.158.58.183|162.158.58.183]] 01:51, 14 March 2020 (UTC)<br />
:Since Holo-banshees are something Randall made up, that could be difficult. LOL! All we have is the name, and that's already explained. Though since the explanation talks about how this wouldn't make sense if they're present in EVERY household I'm somewhat inclined to add "therefore this is probably only a common problem, like rats, ants or cockroaches today." :) [[User:NiceGuy1|NiceGuy1]] ([[User talk:NiceGuy1|talk]]) 05:09, 14 March 2020 (UTC)<br />
:: Well, it says " often " there are holo-banshees. Not always or nearly. Banshees are female Irish vocalists who predict a death in the household, so I will assume that The Corrs joined the current mini-trend for touring your music act as a " hologram " and it got out of hand in some way. Robert Carnegie rja.carnegie@gmail.com [[Special:Contributions/141.101.69.5|141.101.69.5]] 11:00, 14 March 2020 (UTC)<br />
:::I think they're like asbestos. Perhaps at one time considered a good idea (insulating/advanced indications of life-threatening household situations) but later on discovered to have unwanted properties forcing complicated handling procedures to make them safe. In the one case, the shedding of fine carcinogenic dust, in the other perhaps the 'holo' emits excessive intensities of certain wavelengths of light that are directly or indirectly an environmental biohazard. Sealing in situ may be the optimal situation. If, say, the non-corporeal (i.e. unmovable) holo-banshee must be sealed within an asbestos container, which must itself be safely coated then that would easily provoke the scenario hinted at. [[Special:Contributions/162.158.94.14|162.158.94.14]] 15:32, 14 March 2020 (UTC) <br />
::::Fun fact: Fiberglass & other silica-based fiber insulation materials do not dissolve in the lungs & continue inflicting severe tissue damage even longer than asbestos does, the scar tissue from which is a major cause of emphysema & risk factor in lung cancer. (Not that asbestos is ''OK'', mind you...) We've replaced an evil we knew with one we knew (at the time) much less about. Much like "PBA-free" plastic... So really unless your home\school\workplace\brake-pad is insulated with wool, try real hard to avoid breathing those fibers no matter what they are.<br />
::::[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 12:26, 16 March 2020 (UTC)<br />
<br />
:I find the entire section about Holo-banshees ridiculously off-topic. It doesn't add anything to understanding the comic and should probably be removed. umläute [[Special:Contributions/162.158.94.122|162.158.94.122]] 21:43, 15 March 2020 (UTC)<br />
::You say that now. But what about in a few comics time, when there may arise a clear and urgent need for an entire Category:Holo-banshees, eh? (Srsly, it's a potential "what's that about, then?" question by those who think they are missing a reference. Even if the answer we have to give is "apparently nothing".) [[Special:Contributions/162.158.90.174|162.158.90.174]] 22:50, 15 March 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2279:_Symptoms&diff=188577Talk:2279: Symptoms2020-03-13T11:13:34Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
Coronavirus or Covid-19 should be tags. [[User:Netherin5|“That Guy from the Netherlands”]] ([[User talk:Netherin5|talk]]) 17:39, 11 March 2020 (UTC)<br />
:Agreed. Depending on how you count [[2278]], this series has been running continuously since [[2275]]. So this is the 4th or 5th NCOV-2019 comic. The only problem is what should we name the tag? [[Special:Contributions/172.68.211.34|172.68.211.34]] 18:37, 11 March 2020 (UTC)<br />
::"COVID-19" I'd say, for scientific accuracy.--[[User:GoldNinja|GoldNinja]] ([[User talk:GoldNinja|talk]]) 18:59, 11 March 2020 (UTC)<br />
:::I just added a [[:Category:SARS-CoV-2]] since {{W|Severe acute respiratory syndrome coronavirus 2}} indicates that's the current official name. BTW, reCAPTCHA got very aggressive after I tagged the second page. I don't suppose there's a proper place to complain? [[Special:Contributions/172.69.33.89|172.69.33.89]] 19:10, 11 March 2020 (UTC)<br />
::::I would use [[:Category:COVID-19]] instead. If I'm reading the Wikipedia articles correctly, SARS-CoV-2 is the ''virus'', while COVID-19 is the ''disease''. And "COVID-19" is actually in fairly common use in the media compared to SARS-CoV-2. --[[Special:Contributions/172.68.38.56|172.68.38.56]] 19:51, 11 March 2020 (UTC)<br />
:::::That makes sense. But I'm not going thru that many reCAPTCHAs again. (I'm also not likely to make an account at this time, or to respond to further messages here. Sorry.) [[Special:Contributions/172.68.46.179|172.68.46.179]] 20:24, 11 March 2020 (UTC)<br />
::::::You not creating account really doesn't make sense. Done. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 23:20, 11 March 2020 (UTC)<br />
:::::::I think Category:Corona virus would have been better. Since that is what everyone calls it and what it will be remembered as later. --[[User:Kynde|Kynde]] ([[User talk:Kynde|talk]]) 11:27, 12 March 2020 (UTC)<br />
:::::::There are now many references to COVID-19 instead of Coronavirus. It seems to be replacing the former, socially speaking. [[Special:Contributions/108.162.246.227|108.162.246.227]] 14:39, 12 March 2020 (UTC)<br />
<br />
Re. the title text, my reaction would be, "The medicine must not be working. I'd better take more." [[Special:Contributions/172.68.38.120|172.68.38.120]] 18:38, 11 March 2020 (UTC)Pat<br />
<br />
Again? I get that this pandemic is a big deal, but I was really hoping Randall would be a little more creative and come up with some other topics to talk about. [[User:Bischoff|Bischoff]] ([[User talk:Bischoff|talk]]) 14:35, 12 March 2020 (UTC)<br />
:I have no clue if he's just jumping on the bandwagon to stay relevant or if he's legitimately extremely panicked over it. --[[User:Youforgotthisthing|Youforgotthisthing]] ([[User talk:Youforgotthisthing|talk]]) 19:49, 12 March 2020 (UTC) @youforgotthingthing: keep in mind that Randall's wife is a cancer survivor and most likely immunocompromised. I wouldn't blame him for being worried. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 11:13, 13 March 2020 (UTC)<br />
<br />
::Or for that matter if he, like most intelligent people, is dealing with what little danger there is by making fun of the people who are legitimately extremely panicked over it.[[Special:Contributions/172.68.174.128|172.68.174.128]] 20:01, 12 March 2020 (UTC)<br />
<br />
Hey, a hummingbird is only 80fps? That's nothing, people are now buying gaming monitors with 260 fps just because they claim they can see frame tear. [[User:Seebert|Seebert]] ([[User talk:Seebert|talk]]) 17:40, 12 March 2020 (UTC)<br />
: Some tests (admittedly run by the companies which make hardware to enable gaming at 240+ fps) have shown benefits of high-refresh monitors in terms of snap reactions to sudden movement, but not the ability to perceive high-frequency cyclical phenomena. --[[User:NotaBene|NotaBene]] ([[User talk:NotaBene|talk]]) 21:14, 12 March 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2275:_Coronavirus_Name&diff=188108Talk:2275: Coronavirus Name2020-03-04T16:24:43Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
Covid-19 is more dangerous than the flu and has already killed more people. And any death rate that starts with 0.00 and then has a number other than zero can only be called "basically zero" if you value human life very little. [[Special:Contributions/162.158.94.132|162.158.94.132]] 21:49, 2 March 2020 (UTC)<br />
:addendum: this seems to depend on what source you use for the chinese yearly flu death rate. number of deaths is either much higher or somewhat lower.[[Special:Contributions/162.158.91.123|162.158.91.123]] 21:53, 2 March 2020 (UTC)<br />
:It's Trump taking point that the coronavirus is a hoax and no worse than the flu. [[Special:Contributions/162.158.74.213|162.158.74.213]] 22:14, 2 March 2020 (UTC)<br />
:At the very least, the fact the virus has over 90,000 confirmed cases makes it a significant disease. [[Special:Contributions/172.69.34.246|172.69.34.246]] 22:28, 2 March 2020 (UTC)<br />
:It doesn't seem like the point of the comic is to comment on the severity of the virus. Seems more on-topic to say things that are objectively true, like "Many people are concerned about the virus" rather than discussing disputed stats.[[Special:Contributions/162.158.106.132|162.158.106.132]] 22:58, 2 March 2020 (UTC) Patb<br />
::I agree, and suggest we remove the line with stats entirely. It isn't relevant to the comic, and having it refer to "current estimates" means someone will have to keep updating it when new estimates are made. [[Special:Contributions/172.69.54.57|172.69.54.57]] 08:17, 3 March 2020 (UTC)<br />
:::A running total here wouldn't be necessary, there is at least one web site especially for that (or a page for Covid-19 on a general disease outbreak tracking site). To me it looks like this virus is about equally dangerous as flu, except that this virus is only in about 70 countries and counting, so if it isn't in yours yet (as far as you know) then you are not yet in danger (as far as you know). Also, flu kills a lot of people, numerically, every year, and if this virus kills an equal number of people, every year, there are twice as many people dead, total. (ish) So it's worth trying to stop this virus from existing, while we might still do that. Robert Carnegie rja.carnegie@gmail.com [[Special:Contributions/162.158.159.76|162.158.159.76]] 13:40, 3 March 2020 (UTC)<br />
::Let's inject a little sanity here: Trump's "talking point" about it being no on par with the flu is, for once, correct. Most people who are infected have mild symptoms, or none at all. In fact, that's how it's suddenly turned out that the spread is so much greater than previously reported: Because most people never even know they have it. Given this, the mortality rate is a tiny fraction of what was previously reported, perhaps 0.3% instead of 3%. And it was only ostensibly 3% in a primitive region where some people still have dirt floors, and almost nobody is willing to deal with their socialized health care system except in an emergency. Therefore most of the infected were not showing up for treatment, only those in serious trouble. In fact, the vast majority of those who have died are elderly or immunocompromised, ''exactly'' the same group who are killed in the tens of thousands each year by the flu, in the US. So no, this has been a tempest in a teapot, stirred up by the unscientific CDC in order to pad their budget, the way they do periodically with a new fake pandemic threat. SARS, West Nile, bird flu, h1n1, and ebola...no competent epidemiologist would ever seriously have expected those to become a threat in the US, or anywhere else outside of primitive regions. But the CDC has continued to redouble their unearned budget on this fraudulent fearmongering. As I learned when consulting for such ilk in DC, "Fear Equals Funding". Oh, and no, 90,000 cases only make it a "significant disease" in the way that another coronavirus, the common cold, is significant. It's not significantly dangerous. In fact, it really is just a strong kind of common cold. « [[User:Kazvorpal|Kazvorpal]] ([[User talk:Kazvorpal|talk]]) 21:32, 3 March 2020 (UTC)<br />
:::While it doesn't seem to be more lethal than flu (or in general having more severe symptoms), either it's more contagious or the fact it's contagious for weeks before symptoms makes it spread easier. In this sense it's more serious threat - imagine for example if ALL employees of nuclear power plant would be infected leaving noone capable of caring of the reactor. That said, it seems that panic is currently more dangerous than the virus itself. -- [[User:Hkmaly|Hkmaly]] ([[User talk:Hkmaly|talk]]) 23:14, 3 March 2020 (UTC)<br />
<br />
:The 2% death rate in the explantion is outdated. [https://news.sina.cn/zt_d/yiqing0121 Here (in Chinese)] is the compiled data for all China. As of March 3rd, the death rate calculated by (death toll)/(confirmed infected patients) is 3.7% for all China and 4.6% for Wuhan city (the epicenter). The number for Wuhan is likely to grow in the following days, too. [[Special:Contributions/162.158.190.86|162.158.190.86]] 20:11, 3 March 2020 (UTC)<br />
::The mortality rate in China is only relevant if one lives in an area with a primitive socialized health care system. As with SARS, it won't turn out to have a significant death rate among people infected in the US who are not elderly or immunocompromised. Perhaps, in fact, a zero death rate outside of that high risk group. « [[User:Kazvorpal|Kazvorpal]] ([[User talk:Kazvorpal|talk]]) 21:32, 3 March 2020 (UTC) @kazvorpal your comment is inappropriate for several reasons, including "primitive" and deprecating socialized medicine. Since there've already been deaths among the small group of known cases in the USA, it's way too early to calculate mortality rates here. [[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 16:24, 4 March 2020 (UTC)<br />
<br />
If the Godzilla movies have taught me anything, it's that giant insects aren't a problem biologists can solve anyways. That's more of a "nuclear paleontology" sort of job. [[User:GreatWyrmGold|GreatWyrmGold]] ([[User talk:GreatWyrmGold|talk]]) 01:43, 3 March 2020 (UTC)<br />
<br />
It is legitimately difficult to tell if Ponytail's use of the word 'catchy' as a descriptor for 'coronavirus' is an intentional or unintentional pun. Either way, it's very opportune. [[Special:Contributions/108.162.221.239|108.162.221.239]] 03:55, 3 March 2020 (UTC)<br />
<br />
The current chapter of Wilde Life (a totally unrelated webcomic) as a giant spider interacting with two of the main characters, starting [https://www.wildelifecomic.com/comic/710/ here]. [[User:Nutster|Nutster]] ([[User talk:Nutster|talk]]) 05:05, 3 March 2020 (UTC)<br />
<br />
I think they missed a trick with the naming. CORVID-19 would have reminded everyone of H5N1 'bird flu', and we could just blame the crows. Kill a magpie to avoid infection!<br />
[[Special:Contributions/162.158.158.253|162.158.158.253]] 10:53, 3 March 2020 (UTC)<br />
:What? How is CORVID-19 supposed to remind anyone of H5N1 or bird flu? --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 13:20, 3 March 2020 (UTC)<br />
::Corvidae is the family including crows, ravens, jays, magpies; so, CORVID~=bird. Not sure how many people would make that connection, but I think that's what the previous poster was getting at.[[Special:Contributions/162.158.187.91|162.158.187.91]] 13:13, 4 March 2020 (UTC)<br />
:I think "SARS-CoV-2: Electric Boogaloo" has a nice ring to it although a little wordy for everyday use. [[Special:Contributions/198.41.238.116|198.41.238.116]] 08:16, 4 March 2020 (UTC)<br />
<br />
Yeah really dodged a bullet on those rhinoviri. [[Special:Contributions/172.69.22.44|172.69.22.44]] 11:36, 3 March 2020 (UTC)<br />
<br />
Is it relevant to mention that some spiders grow larger in cities? https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0105480 <br />
[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 15:39, 3 March 2020 (UTC)<br />
<br />
I'm not really wanting to catch COVID-19. I'm holding out for COVID-19b, which is going to be better beta-tested. (But by the time COVID-19c comes out, it's just going to be a bandwagon of planned obsolescence by then - I'd rather stick with what I've got until the next significent release version and keep a close eye on the advanced reviews and what other vendors are innovating.) [[Special:Contributions/162.158.34.46|162.158.34.46]] 16:15, 3 March 2020 (UTC)<br />
<br />
This is only 3 years too early to be a reference to the spiders in Colorado https://xkcd.com/1688/ especially with Megan holding bio-hazardous material. [[Special:Contributions/162.158.62.33|162.158.62.33]]<br />
<br />
Assorted catchier names: a)Corona-chan (works for every disease with a girl name, Ebola, Zika, Lassa, Malaria, Cholera, Yersinia...Ask 4chan), b) My Corona (OK, a bit 1970-ish), c) Coronjob (for conspiracy buffs). (Personally, I'm less afraid of getting infected than getting, showing no symptoms as always and killing half of my environment...) [[Special:Contributions/172.69.54.9|172.69.54.9]] 09:36, 4 March 2020 (UTC)<br />
<br />
I think that it's worth noting that this comic came out the day after the American Super Tuesday primaries.--[[Special:Contributions/172.69.71.64|172.69.71.64]] 15:42, 4 March 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2273:_Truck_Proximity&diff=187868Talk:2273: Truck Proximity2020-02-28T13:32:55Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
Lots of dinosaurs driving equipment on a farm out there: https://www.youtube.com/watch?v=0bUmxUWs1Uk or https://www.youtube.com/watch?v=YmgHz8zBZlk [[Special:Contributions/173.245.52.97|173.245.52.97]] 20:47, 26 February 2020 (UTC)<br />
<br />
Being pedantic, those are tractors: https://play.google.com/store/apps/details?id=com.imayi.dinofarmfree&hl=en_US Perhaps dinosaurs driving trucks on farms is a niche just begging to be filled ;-) [[Special:Contributions/172.68.189.127|172.68.189.127]] 06:09, 27 February 2020 (UTC)<br />
<br />
Can see a strong argument that Randall got the axes wrong here... [[User:Heylukeatthat|Heylukeatthat]] ([[User talk:Heylukeatthat|talk]]) 21:09, 26 February 2020 (UTC)<br />
:How so? I don't see it... There are people with truck-related hobbies who know more info about trucks than the frequency of their proximity to them might demand; which accounts for the asymmetry in the upper-right cluster. Having kids (especially male children raised with heteronormative socially dimorphic entertainment sets, which frequently adhere to traditional social expectations of "stuff for boys") ''definitely'' increases one's exposure to truck-related topics. What's the case for the axes being reversed? <br />
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 21:30, 26 February 2020 (UTC)<br />
::I just read his comment as suggesting the x and y axes should be swapped, where 'proximity to trucks' should be on the x-axis. I'd agree that conventionally that would make more sense, and it was likely done this way to impact the 'reading order' of the clusters for comic effect. --[[Special:Contributions/162.158.214.88|162.158.214.88]] 22:18, 26 February 2020 (UTC) <br />
<br />
This is a graph with two independent variables (x and y axes) and the dependent variables grouped on the chart. So it really doesn't matter which axis is which.[[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 13:30, 28 February 2020 (UTC)<br />
:::Don't you know? Having knowledge of trucks causes a physical attraction force between you and the truck. [[Special:Contributions/172.69.34.58|172.69.34.58]] 01:25, 27 February 2020 (UTC)<br />
:::The real issue is that the most proximity (distance 0) is at some random point far away from the center of the coordinate system and the center of the coordinate system is some random distance away from a truck. [[User:Fabian42|Fabian42]] ([[User talk:Fabian42|talk]]) 02:59, 27 February 2020 (UTC)<br />
:::A graph doesn't necessary show that x axis causes y axis. even less when it is mapped on the plane instead of being a line graph. But even line graphs may just show correlation, see [[111: Firefox and Witchcraft - The Connection?]] --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:35, 27 February 2020 (UTC)<br />
::Economics graphs often reverse the axes like that. Though in this case, I saw it as correlational rather than explicitly causal, so I didn't even notice.<br />
<br />
Wait, has Randall come into possession of ''offspring''? Specifically, of the "between 2 and 5 years of age, assigned male at birth" variety? [[Special:Contributions/162.158.79.35|162.158.79.35]] 22:37, 26 February 2020 (UTC)<br />
:This is what I came here curious about! Or is he just making this observation about some friends/family he spends time with?--[[Special:Contributions/162.158.214.82|162.158.214.82]] 23:11, 26 February 2020 (UTC)<br />
:Seems unlikely given the lack of units on the [[833|axes]]. --[[Special:Contributions/172.68.54.130|172.68.54.130]] 15:23, 27 February 2020 (UTC)<br />
::[[833]] is about labeling axes in general, not about putting units on them. If you just want to show a correlation, but not detailed values, such as here, it is totally valid to not put units. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 15:25, 27 February 2020 (UTC)<br />
:::It's not clear if it's linear or log or [[2023|something weird]]. --[[Special:Contributions/172.68.54.142|172.68.54.142]] 17:44, 27 February 2020 (UTC)<br />
<br />
I can think of one job that puts someone into that bottom-right corner: total loss valuation specialists (particularly ones specializing in commercial vehicles). We don't get within a hundred miles of trucks, and yet we know substantially more about them than the people who submit the claims to us do (and sometimes more than the owners do). --[[User:Skyrender|Skyrender]] ([[User talk:Skyrender|talk]]) 02:31, 27 February 2020 (UTC) <-- A new car built by my company leaves somewhere traveling at 60 mph. The rear differential locks up. The car crashes and burns with everyone trapped inside. Now, should we initiate a recall? Take the number of vehicles in the field, A, multiply by the probable rate of failure, B, multiply by the average out-of-court settlement, C. A times B times C equals X. If X is less than the cost of a recall, we don't do one. <br />
<br />
Clearly Randall (and other parents) should investigate Dinotrux, which I enjoyed with my kids. [[Special:Contributions/162.158.62.15|162.158.62.15]] 10:40, 27 February 2020 (UTC)<br />
<br />
Wait... This is almost a Venn diagram -- does this mean parents of 2 to 5 year olds are not "normal people"? How DARE you, sir! I'm as normal as any other sleep-deprived person! (Well, I guess my sanity is questionable since I consciously and deliberately hang around with preschoolers...) --BigMal // [[Special:Contributions/172.69.68.185|172.69.68.185]] 13:15, 27 February 2020 (UTC)<br />
<br />
"Apparently trucks and farms do not mix very well." Seriously? Go spend half an hour listening to country music; that'll disabuse you of that mistaken notion rather quickly! :P ← Older edit<br />
[[Special:Contributions/172.68.34.190|172.68.34.190]] 15:17, 27 February 2020 (UTC)<br />
: I can recommend ''The Dinosaur Truckers'', though I didn't find any farm-related lyrics on a cursory search. But there's a modernized children's song/book "Old MacDonald had a Truck" by someone else. [[Special:Contributions/172.69.54.9|172.69.54.9]] 03:37, 28 February 2020 (UTC)<br />
<br />
The title text of the comic mentions children's media, not specifically books. The Google search, which Randall didn't perform, "dinosaurs driving trucks on a farm" does produce results. For instance, a game called Dinosaur Farm https://www.amazon.com/Dinosaur-Farm-Tractor-Truck-Simulator/dp/B01MSA2OVD. The images appear to show a variety of vehicles, including tractors and others that more closely resemble various kinds of trucks. --[[User:Shabegger|Shabegger]] ([[User talk:Shabegger|talk]]) 17:57, 27 February 2020 (UTC)<br />
:This mobile game was published for iOS in 2017. [[Special:Contributions/141.101.77.134|141.101.77.134]] 03:15, 28 February 2020 (UTC)<br />
<br />
"but parents won't and are unlikely to go near any truck." What? I know plenty of parents who go against this idea. This comic mostly just applies to urban areas though. Rural Canada or the States, you see tons of people with trucks just for everyday driving, even lots of non-farmers. For a lot of people, it can just come in handy from time to time (hauling boats or furniture (furniture stores etc may not deliver to more rural areas) or people), or they use it because it's better at handling bad road conditions, or for some, it's kind of a status symbol.[[Special:Contributions/162.158.106.144|162.158.106.144]] 02:16, 28 February 2020 (UTC)<br />
:I wondered about that line too, but didn't feel confident enough to raise it. I think it partly comes from a misconception on what defines a truck. I think for many non native speakers it is a bit surprising that in the US basically any pickup is regarded a "truck". https://en.wikipedia.org/wiki/Truck#Types_by_size - E.g. for me, until not so long ago, a truck always meant huge commercial vehicle. See the wikilink here, where also differences for UK/Europe are mentioned. Anything mentioned here as very-light and ultra-light might not be considered a truck for non-americans, and light trucks hardly exist outside the US. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:20, 28 February 2020 (UTC)</div>Cellocgwhttps://www.explainxkcd.com/wiki/index.php?title=Talk:2273:_Truck_Proximity&diff=187867Talk:2273: Truck Proximity2020-02-28T13:30:06Z<p>Cellocgw: </p>
<hr />
<div><!--Please sign your posts with ~~~~ and don't delete this text. New comments should be added at the bottom.--><br />
Lots of dinosaurs driving equipment on a farm out there: https://www.youtube.com/watch?v=0bUmxUWs1Uk or https://www.youtube.com/watch?v=YmgHz8zBZlk [[Special:Contributions/173.245.52.97|173.245.52.97]] 20:47, 26 February 2020 (UTC)<br />
<br />
Being pedantic, those are tractors: https://play.google.com/store/apps/details?id=com.imayi.dinofarmfree&hl=en_US Perhaps dinosaurs driving trucks on farms is a niche just begging to be filled ;-) [[Special:Contributions/172.68.189.127|172.68.189.127]] 06:09, 27 February 2020 (UTC)<br />
<br />
Can see a strong argument that Randall got the axes wrong here... [[User:Heylukeatthat|Heylukeatthat]] ([[User talk:Heylukeatthat|talk]]) 21:09, 26 February 2020 (UTC)<br />
:How so? I don't see it... There are people with truck-related hobbies who know more info about trucks than the frequency of their proximity to them might demand; which accounts for the asymmetry in the upper-right cluster. Having kids (especially male children raised with heteronormative socially dimorphic entertainment sets, which frequently adhere to traditional social expectations of "stuff for boys") ''definitely'' increases one's exposure to truck-related topics. What's the case for the axes being reversed? <br />
:[[User:ProphetZarquon|ProphetZarquon]] ([[User talk:ProphetZarquon|talk]]) 21:30, 26 February 2020 (UTC)<br />
::I just read his comment as suggesting the x and y axes should be swapped, where 'proximity to trucks' should be on the x-axis. I'd agree that conventionally that would make more sense, and it was likely done this way to impact the 'reading order' of the clusters for comic effect. --[[Special:Contributions/162.158.214.88|162.158.214.88]] 22:18, 26 February 2020 (UTC) <br />
<br />
This is a graph with two independent variables (x and y axes) and the dependent variables grouped on the chart. So it really doesn't matter which axis is which.[[User:Cellocgw|Cellocgw]] ([[User talk:Cellocgw|talk]]) 13:30, 28 February 2020 (UTC)<br />
:::Don't you know? Having knowledge of trucks causes a physical attraction force between you and the truck. [[Special:Contributions/172.69.34.58|172.69.34.58]] 01:25, 27 February 2020 (UTC)<br />
:::The real issue is that the most proximity (distance 0) is at some random point far away from the center of the coordinate system and the center of the coordinate system is some random distance away from a truck. [[User:Fabian42|Fabian42]] ([[User talk:Fabian42|talk]]) 02:59, 27 February 2020 (UTC)<br />
:::A graph doesn't necessary show that x axis causes y axis. even less when it is mapped on the plane instead of being a line graph. But even line graphs may just show correlation, see [[111: Firefox and Witchcraft - The Connection?]] --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:35, 27 February 2020 (UTC)<br />
::Economics graphs often reverse the axes like that. Though in this case, I saw it as correlational rather than explicitly causal, so I didn't even notice.<br />
<br />
Wait, has Randall come into possession of ''offspring''? Specifically, of the "between 2 and 5 years of age, assigned male at birth" variety? [[Special:Contributions/162.158.79.35|162.158.79.35]] 22:37, 26 February 2020 (UTC)<br />
:This is what I came here curious about! Or is he just making this observation about some friends/family he spends time with?--[[Special:Contributions/162.158.214.82|162.158.214.82]] 23:11, 26 February 2020 (UTC)<br />
:Seems unlikely given the lack of units on the [[833|axes]]. --[[Special:Contributions/172.68.54.130|172.68.54.130]] 15:23, 27 February 2020 (UTC)<br />
::[[833]] is about labeling axes in general, not about putting units on them. If you just want to show a correlation, but not detailed values, such as here, it is totally valid to not put units. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 15:25, 27 February 2020 (UTC)<br />
:::It's not clear if it's linear or log or [[2023|something weird]]. --[[Special:Contributions/172.68.54.142|172.68.54.142]] 17:44, 27 February 2020 (UTC)<br />
<br />
I can think of one job that puts someone into that bottom-right corner: total loss valuation specialists (particularly ones specializing in commercial vehicles). We don't get within a hundred miles of trucks, and yet we know substantially more about them than the people who submit the claims to us do (and sometimes more than the owners do). --[[User:Skyrender|Skyrender]] ([[User talk:Skyrender|talk]]) 02:31, 27 February 2020 (UTC)<br />
<br />
Clearly Randall (and other parents) should investigate Dinotrux, which I enjoyed with my kids. [[Special:Contributions/162.158.62.15|162.158.62.15]] 10:40, 27 February 2020 (UTC)<br />
<br />
Wait... This is almost a Venn diagram -- does this mean parents of 2 to 5 year olds are not "normal people"? How DARE you, sir! I'm as normal as any other sleep-deprived person! (Well, I guess my sanity is questionable since I consciously and deliberately hang around with preschoolers...) --BigMal // [[Special:Contributions/172.69.68.185|172.69.68.185]] 13:15, 27 February 2020 (UTC)<br />
<br />
"Apparently trucks and farms do not mix very well." Seriously? Go spend half an hour listening to country music; that'll disabuse you of that mistaken notion rather quickly! :P ← Older edit<br />
[[Special:Contributions/172.68.34.190|172.68.34.190]] 15:17, 27 February 2020 (UTC)<br />
: I can recommend ''The Dinosaur Truckers'', though I didn't find any farm-related lyrics on a cursory search. But there's a modernized children's song/book "Old MacDonald had a Truck" by someone else. [[Special:Contributions/172.69.54.9|172.69.54.9]] 03:37, 28 February 2020 (UTC)<br />
<br />
The title text of the comic mentions children's media, not specifically books. The Google search, which Randall didn't perform, "dinosaurs driving trucks on a farm" does produce results. For instance, a game called Dinosaur Farm https://www.amazon.com/Dinosaur-Farm-Tractor-Truck-Simulator/dp/B01MSA2OVD. The images appear to show a variety of vehicles, including tractors and others that more closely resemble various kinds of trucks. --[[User:Shabegger|Shabegger]] ([[User talk:Shabegger|talk]]) 17:57, 27 February 2020 (UTC)<br />
:This mobile game was published for iOS in 2017. [[Special:Contributions/141.101.77.134|141.101.77.134]] 03:15, 28 February 2020 (UTC)<br />
<br />
"but parents won't and are unlikely to go near any truck." What? I know plenty of parents who go against this idea. This comic mostly just applies to urban areas though. Rural Canada or the States, you see tons of people with trucks just for everyday driving, even lots of non-farmers. For a lot of people, it can just come in handy from time to time (hauling boats or furniture (furniture stores etc may not deliver to more rural areas) or people), or they use it because it's better at handling bad road conditions, or for some, it's kind of a status symbol.[[Special:Contributions/162.158.106.144|162.158.106.144]] 02:16, 28 February 2020 (UTC)<br />
:I wondered about that line too, but didn't feel confident enough to raise it. I think it partly comes from a misconception on what defines a truck. I think for many non native speakers it is a bit surprising that in the US basically any pickup is regarded a "truck". https://en.wikipedia.org/wiki/Truck#Types_by_size - E.g. for me, until not so long ago, a truck always meant huge commercial vehicle. See the wikilink here, where also differences for UK/Europe are mentioned. Anything mentioned here as very-light and ultra-light might not be considered a truck for non-americans, and light trucks hardly exist outside the US. --[[User:Lupo|Lupo]] ([[User talk:Lupo|talk]]) 07:20, 28 February 2020 (UTC)</div>Cellocgw