Difference between revisions of "2299: Coronavirus Genome 2"

Explain xkcd: It's 'cause you're dumb.
Jump to: navigation, search
m (Explanation)
(Explanation)
Line 11: Line 11:
 
This comic is a continuation of the previous comic, [[2298: Coronavirus Genome]].
 
This comic is a continuation of the previous comic, [[2298: Coronavirus Genome]].
  
Megan sent her copy of the coronavirus genome to Cueball, who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the internet (though not in a form that can actually make people sick with COVID-19.)
+
Megan sent her copy of the coronavirus genome to Cueball, who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the internet (though not in a form that can actually make people sick with COVID-19.) If his post catches on and is widely shared, it might be described as "going viral".
  
 
He first attempts to tweet it, but Twitter has a 280 character limit, and the coronavirus genome is much larger than that. He decides to use Facebook instead, which has a character limit of 63,206.
 
He first attempts to tweet it, but Twitter has a 280 character limit, and the coronavirus genome is much larger than that. He decides to use Facebook instead, which has a character limit of 63,206.

Revision as of 01:54, 28 April 2020

Coronavirus Genome 2
[moments later, checking phone] Okay, I agree my posting it was weird, but it's somehow even more unnerving that you immediately liked the post.
Title text: [moments later, checking phone] Okay, I agree my posting it was weird, but it's somehow even more unnerving that you immediately liked the post.

Explanation

40x40px This is one of 60 incomplete explanations:
Created by a A SANITIZED PHONE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon. If you can fix this issue, edit the page!

This comic is a continuation of the previous comic, 2298: Coronavirus Genome.

Megan sent her copy of the coronavirus genome to Cueball, who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the internet (though not in a form that can actually make people sick with COVID-19.) If his post catches on and is widely shared, it might be described as "going viral".

He first attempts to tweet it, but Twitter has a 280 character limit, and the coronavirus genome is much larger than that. He decides to use Facebook instead, which has a character limit of 63,206.

Transcript

Ambox warning green construction.svg This is one of 37 incomplete transcripts:
Do NOT delete this tag too soon. If you can fix this issue, edit the page!

[Megan sits at a desk with a laptop. She is turning away from her desk to talk to Cueball.]

Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?
Megan: Sure.
Megan: ...Why?

[Tight focus on Megan, who is typing on her laptop.]

Cueball (off-panel): Nothing.
Megan: I ... see. Well, here you go.
Laptop: Click

[Borderless panel focusing on Cueball, typing on his phone.]

[Borderless panel focusing on Cueball. His phone is showing a Twitter interface, highlighting that he is trying to tweet too many characters.]

Phone: GAAAGGTAAGATGGAGAGGCCTTGTC / CCTGGTTCAACGAGAA -29,602 (+) Tweet

[Megan back in frame.]

Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post.
Megan: Unsettling that your first instinct is "share it online."
Cueball: It's cool, I sanitized my phone before posting.

comment.png  Add comment      new topic.png  Create topic (use sparingly)     refresh discuss.png  Refresh 

Discussion

How long is it likely to be before somebody does this? Hours? Minutes? Angel (talk) 23:56, 27 April 2020 (UTC)

I'd do it myself right now if I still used Facebook... and if I knew where to find it... 173.245.54.115 01:20, 28 April 2020 (UTC)
I did. ¯\_(ツ)_/¯. In vivo veritas (talk) 01:54, 28 April 2020 (UTC)
Although, I wouldn't be surprised if someone's beaten me to the punch. In vivo veritas (talk) 03:32, 28 April 2020 (UTC)
I would be very surprised if someone didn't already posted it days before this XKCD was drawn. -- Hkmaly (talk) 22:06, 28 April 2020 (UTC)

I find it pretty funny that while you can't tweet it, per a recent twitter discovery, you could set that genome as your official gender on twitter (proof of character limit, as an example: https://twitter.com/FaxonFury/status/1254775943664504832). 172.69.22.110 09:03, 28 April 2020 (UTC)

In fact, someone already tweeted it three weeks ago, but they cheated by encoding it into base-64. Here it is on threadreaderapp. Arcorann (talk) 11:00, 28 April 2020 (UTC)

Timgor also made a series of tweets, not just one. Cueball gave up on Twitter too easily. --NotaBene (talk) 12:02, 28 April 2020 (UTC)
I'm wondering what an LZW-type compression scheme could do to sequences, especially with the propensity for repeating sequences (at least outside viruses). And with a known short alphabet you could pre-tune it to work with just four "literal" items and free up a lot more (starting shorter) "dictionary" slots right from the get-go. Not gonna reduce to single-Tweet lengths, even if you could transmit your encoded prompts all across the unicode character sets rather than in 7ish-bit or nearly-8-bit data only. 162.158.158.211 12:22, 28 April 2020 (UTC)
xz -9e sequence.fasta compressed the SARS-CoV-2 genome from 30 kb to 9 kb. Impressive, but not nearly enough to fit in a single tweet. Perhaps the entire genome could fit within an image? Then use OCR to convert back to text. In vivo veritas (talk) 16:14, 28 April 2020 (UTC)
Well, you can just tweet a link to another website where it is given as text... easier than actual compressing. --Lupo (talk) 05:23, 30 April 2020 (UTC)
If you converted each base pair into a 2-bit value and then converted this raw image into a png: Would twitter allow you to send losslessly-encoded images? Gunterkoenigsmann (talk) 10:42, 2 May 2020 (UTC)

When I started reading it, I fully expected the punchline was going to be something about emailing viruses, and/or something about virus checkers letting it get through undetected. 172.69.35.67 16:53, 29 April 2020 (UTC)

Is the wednesday comic missing? It should be Thursday now in Randalls time zone as well...--Lupo (talk) 05:20, 30 April 2020 (UTC)

Haven't seen it either, it is almost Thursday in PDT. 172.69.34.132 06:38, 30 April 2020 (UTC)
Seems he have missed a release. Although it it still Wednesday for three more hours in Hawaii and a few more hours near the date line... --Kynde (talk) 06:59, 30 April 2020 (UTC)

Could be a reference to GenomeTweet series of accounts done by Jennifer Harrison @GeneticJen between 2013 and 2014?
There are been posted - in "CTAG" non-compressed - format on Twitter HIV (HIV-1, 20131030-20131030), E. coli (GenomeTweet @GenomeTwee, 201307__-20131208), yeast (S. cerevisiae, GenomeTweet - Fungi @GenomeFungi, 201310__-20140318), nematode (C. elegans, GenomeTweet Nematode @GenomeNematode, 201311_-20140121), and fruit fly (Drosophila melanogaster, GenomeTweet - Fly @GenomeTweetFly, 201311__-20140203) genomes.
The human genome is [was?] underway.
All of these were made by Jennifer Harrison @GeneticJen.
I've found them thanks to geneticjen.com/genometweet-the-first-genomes-on-twitter (its source is off-line now and not archived by web.archive.org) 20190820 post.

Have a nice day! Nickh ²+, --108.162.229.176 18:50, 3 May 2020 (UTC).

      comment.png  Add comment