2299: Coronavirus Genome 2

Explain xkcd: It's 'cause you're dumb.
Revision as of 15:33, 28 April 2020 by NotaBene (talk | contribs) (Transcript)
Jump to: navigation, search
Coronavirus Genome 2
[moments later, checking phone] Okay, I agree my posting it was weird, but it's somehow even more unnerving that you immediately liked the post.
Title text: [moments later, checking phone] Okay, I agree my posting it was weird, but it's somehow even more unnerving that you immediately liked the post.

Explanation

Ambox warning blue construction.png This is one of 44 incomplete explanations:
Created by a SANITIZED PHONE. Please mention here why this explanation isn't complete. Do NOT delete this tag too soon. If you can fix this issue, edit the page!

This comic is another comic in a series of comics related to the 2020 pandemic of the coronavirus SARS-CoV-2, which causes COVID-19.

Is is also a direct continuation of the previous comic, 2298: Coronavirus Genome, making this a new series.

Megan sent her copy of the coronavirus genome to Cueball, who then proceeded to share it with his friends on social media. In effect, he is spreading the virus over the internet, though not in a form that can actually make people sick with COVID-19 (which may seem obvious, but then some people believe 5G causes coronavirus.) If his post catches on and is widely shared, it might be described as "going viral".

He first attempts to tweet it, but Twitter has a 280 character limit, and the coronavirus genome is much larger than that. He decides to use Facebook instead, which has a character limit of 63,206.

This strip draws humor from the contrast between the costly physical precautions that are being taken to prevent the spread of coronavirus between people and the blitheness with which Cueball attempts to share (the genome of) the coronavirus electronically. Cueball's response (that it's okay, because he sanitized his phone before posting) could be taken as a sarcastic rebuttal, given that Megan sent the genome to him without knowing why he wanted it, or a commentary on the useless or counterproductive behaviors of clueless people (e.g. people who wear gloves before touching potentially-contaminated surfaces, but then scratch their noses while still wearing the possibly-contaminated gloves).

The title text deals with the almost inevitable outcome of the resulting message being 'liked' by some other party. In this case Megan, although she just told Cueball it was weird that he shared it. Sometimes people Like a social media posting for an element they appreciate, such as a well composed photograph, blind to the fact that they seem to be tacitly supporting the subject of the photo which may depict something not entirely laudible. "Liking" this message, which defines a potentially deadly disease, may seem to be even more misanthropic of the Liker.

Transcript

[Megan sits in an office chair at her desk with a laptop. She is leaning on the back of the chair with one arm while turning away from her desk to talk to Cueball standing behind her.]
Cueball: Hey, if you have the coronavirus genome as a text file, can you email it to me?
Megan: Sure.
Megan: ...Why?
[Megan has turned to her her laptop typing on it, Cueball is off-panel.]
Cueball (off-panel): Nothing.
Megan: I ... see.
Megan: Well, here you go.
Laptop: Click
[In "two" frame-less panels in a row Cueball is shown twice while typing on his phone with both hands. The second time the text on his phone screen is shown above it in a square "speech bubble" with a "speech line" going down to the phone. It displays a Twitter interface, highlighting that he is trying to tweet too many characters. The last line of text in the tweet is marked with red. A number below is in red font and the + in a circle after that is in cyan font. The last word is in white font inside a cyan strip.]
Phone:
GAAAGGTAAGATGGAGAGGCCTTGTC
CCTGGTTCAACGAGAA
-29,602 (+)
Tweet
[Back to the original setting but with Megan still typing on her laptop while Cueball looks at his phone that he holds up in one hand.]
Cueball: Okay, it's too long for Twitter, but it can fit in a Facebook post.
Megan: Unsettling that your first instinct is "share it online."
Cueball: It's cool, I sanitized my phone before posting.

comment.png  Add comment      new topic.png  Create topic (use sparingly)     refresh discuss.png  Refresh 

Discussion

How long is it likely to be before somebody does this? Hours? Minutes? Angel (talk) 23:56, 27 April 2020 (UTC)

I'd do it myself right now if I still used Facebook... and if I knew where to find it... 173.245.54.115 01:20, 28 April 2020 (UTC)
I did. ¯\_(ツ)_/¯. In vivo veritas (talk) 01:54, 28 April 2020 (UTC)
Although, I wouldn't be surprised if someone's beaten me to the punch. In vivo veritas (talk) 03:32, 28 April 2020 (UTC)
I would be very surprised if someone didn't already posted it days before this XKCD was drawn. -- Hkmaly (talk) 22:06, 28 April 2020 (UTC)

I find it pretty funny that while you can't tweet it, per a recent twitter discovery, you could set that genome as your official gender on twitter (proof of character limit, as an example: https://twitter.com/FaxonFury/status/1254775943664504832). 172.69.22.110 09:03, 28 April 2020 (UTC)

In fact, someone already tweeted it three weeks ago, but they cheated by encoding it into base-64. Here it is on threadreaderapp. Arcorann (talk) 11:00, 28 April 2020 (UTC)

Timgor also made a series of tweets, not just one. Cueball gave up on Twitter too easily. --NotaBene (talk) 12:02, 28 April 2020 (UTC)
I'm wondering what an LZW-type compression scheme could do to sequences, especially with the propensity for repeating sequences (at least outside viruses). And with a known short alphabet you could pre-tune it to work with just four "literal" items and free up a lot more (starting shorter) "dictionary" slots right from the get-go. Not gonna reduce to single-Tweet lengths, even if you could transmit your encoded prompts all across the unicode character sets rather than in 7ish-bit or nearly-8-bit data only. 162.158.158.211 12:22, 28 April 2020 (UTC)
xz -9e sequence.fasta compressed the SARS-CoV-2 genome from 30 kb to 9 kb. Impressive, but not nearly enough to fit in a single tweet. Perhaps the entire genome could fit within an image? Then use OCR to convert back to text. In vivo veritas (talk) 16:14, 28 April 2020 (UTC)
Well, you can just tweet a link to another website where it is given as text... easier than actual compressing. --Lupo (talk) 05:23, 30 April 2020 (UTC)
If you converted each base pair into a 2-bit value and then converted this raw image into a png: Would twitter allow you to send losslessly-encoded images? Gunterkoenigsmann (talk) 10:42, 2 May 2020 (UTC)

When I started reading it, I fully expected the punchline was going to be something about emailing viruses, and/or something about virus checkers letting it get through undetected. 172.69.35.67 16:53, 29 April 2020 (UTC)

Is the wednesday comic missing? It should be Thursday now in Randalls time zone as well...--Lupo (talk) 05:20, 30 April 2020 (UTC)

Haven't seen it either, it is almost Thursday in PDT. 172.69.34.132 06:38, 30 April 2020 (UTC)
Seems he have missed a release. Although it it still Wednesday for three more hours in Hawaii and a few more hours near the date line... --Kynde (talk) 06:59, 30 April 2020 (UTC)

Could be a reference to GenomeTweet series of accounts done by Jennifer Harrison @GeneticJen between 2013 and 2014?
There are been posted - in "CTAG" non-compressed - format on Twitter HIV (HIV-1, 20131030-20131030), E. coli (GenomeTweet @GenomeTwee, 201307__-20131208), yeast (S. cerevisiae, GenomeTweet - Fungi @GenomeFungi, 201310__-20140318), nematode (C. elegans, GenomeTweet Nematode @GenomeNematode, 201311_-20140121), and fruit fly (Drosophila melanogaster, GenomeTweet - Fly @GenomeTweetFly, 201311__-20140203) genomes.
The human genome is [was?] underway.
All of these were made by Jennifer Harrison @GeneticJen.
I've found them thanks to geneticjen.com/genometweet-the-first-genomes-on-twitter (its source is off-line now and not archived by web.archive.org) 20190820 post.

Have a nice day! Nickh ²+, --108.162.229.176 18:50, 3 May 2020 (UTC).

      comment.png  Add comment